Molecules

Editorial

5 pages, 211 KiB

Open AccessEditorial

Special Issue “Frontiers in Nucleic Acid Chemistry—In Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry”

by Montserrat Terrazas, Ramon Eritja and Daniela Montesarchio

Molecules 2023, 28(21), 7278; https://doi.org/10.3390/molecules28217278 - 26 Oct 2023

Viewed by 638

Abstract

This Special issue is dedicated to the memory of Enrique Pedroso, Professor Emeritus of Organic Chemistry at University of Barcelona, who passed away at the age of 72 in September 2020 [...] Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

Research

Jump to: Editorial, Review, Other

13 pages, 1732 KiB

Open AccessArticle

Convenient Solid-Phase Attachment of Small-Molecule Ligands to Oligonucleotides via a Biodegradable Acid-Labile P-N-Bond

by Nadezhda O. Kropacheva, Arseniy A. Golyshkin, Mariya A. Vorobyeva and Mariya I. Meschaninova

Molecules 2023, 28(4), 1904; https://doi.org/10.3390/molecules28041904 - 16 Feb 2023

Cited by 1 | Viewed by 1527

Abstract

One of the key problems in the design of therapeutic and diagnostic oligonucleotides is the attachment of small-molecule ligands for targeted deliveries in such a manner that provides the controlled release of the oligonucleotide at a certain moment. Here, we propose a novel, [...] Read more.

One of the key problems in the design of therapeutic and diagnostic oligonucleotides is the attachment of small-molecule ligands for targeted deliveries in such a manner that provides the controlled release of the oligonucleotide at a certain moment. Here, we propose a novel, convenient approach for attaching ligands to the 5′-end of the oligonucleotide via biodegradable, acid-labile phosphoramide linkage. The method includes the activation of the 5′-terminal phosphate of the fully protected, support-bound oligonucleotide, followed by interaction with a ligand bearing the primary amino group. This technique is simple to perform, allows for forcing the reaction to completion by adding excess soluble reactant, eliminates the problem of the limited solubility of reagents, and affords the possibility of using different solvents, including water/organic media. We demonstrated the advantages of this approach by synthesizing and characterizing a wide variety of oligonucleotide 5′-conjugates with different ligands, such as cholesterol, aliphatic oleylamine, and p-anisic acid. The developed method suits different types of oligonucleotides (deoxyribo-, 2′-O-methylribo-, ribo-, and others). Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Figure 1

18 pages, 2813 KiB

Open AccessArticle

DNA Base Excision Repair Intermediates Influence Duplex–Quadruplex Equilibrium

by Mark L. Sowers, James W. Conrad, Bruce Chang-Gu, Ellie Cherryhomes, Linda C. Hackfeld and Lawrence C. Sowers

Molecules 2023, 28(3), 970; https://doi.org/10.3390/molecules28030970 - 18 Jan 2023

Cited by 2 | Viewed by 1814

Abstract

Although genomic DNA is predominantly duplex under physiological conditions, particular sequence motifs can favor the formation of alternative secondary structures, including the G-quadruplex. These structures can exist within gene promoters, telomeric DNA, and regions of the genome frequently found altered in human cancers. [...] Read more.

Although genomic DNA is predominantly duplex under physiological conditions, particular sequence motifs can favor the formation of alternative secondary structures, including the G-quadruplex. These structures can exist within gene promoters, telomeric DNA, and regions of the genome frequently found altered in human cancers. DNA is also subject to hydrolytic and oxidative damage, and its local structure can influence the type of damage and its magnitude. Although the repair of endogenous DNA damage by the base excision repair (BER) pathway has been extensively studied in duplex DNA, substantially less is known about repair in non-duplex DNA structures. Therefore, we wanted to better understand the effect of DNA damage and repair on quadruplex structure. We first examined the effect of placing pyrimidine damage products uracil, 5-hydroxymethyluracil, the chemotherapy agent 5-fluorouracil, and an abasic site into the loop region of a 22-base telomeric repeat sequence known to form a G-quadruplex. Quadruplex formation was unaffected by these analogs. However, the activity of the BER enzymes were negatively impacted. Uracil DNA glycosylase (UDG) and single-strand selective monofunctional uracil DNA glycosylase (SMUG1) were inhibited, and apurinic/apyrimidinic endonuclease 1 (APE1) activity was completely blocked. Interestingly, when we performed studies placing DNA repair intermediates into the strand opposite the quadruplex, we found that they destabilized the duplex and promoted quadruplex formation. We propose that while duplex is the preferred configuration, there is kinetic conversion between duplex and quadruplex. This is supported by our studies using a quadruplex stabilizing molecule, pyridostatin, that is able to promote quadruplex formation starting from duplex DNA. Our results suggest how DNA damage and repair intermediates can alter duplex-quadruplex equilibrium. Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Figure 1

21 pages, 10835 KiB

Open AccessArticle

Factors Impacting Invader-Mediated Recognition of Double-Stranded DNA

by Caroline P. Shepard, Raymond G. Emehiser, Saswata Karmakar and Patrick J. Hrdlicka

Molecules 2023, 28(1), 127; https://doi.org/10.3390/molecules28010127 - 23 Dec 2022

Viewed by 1773

Abstract

The development of chemically modified oligonucleotides enabling robust, sequence-unrestricted recognition of complementary chromosomal DNA regions has been an aspirational goal for scientists for many decades. While several groove-binding or strand-invading probes have been developed towards this end, most enable recognition of DNA only [...] Read more.

The development of chemically modified oligonucleotides enabling robust, sequence-unrestricted recognition of complementary chromosomal DNA regions has been an aspirational goal for scientists for many decades. While several groove-binding or strand-invading probes have been developed towards this end, most enable recognition of DNA only under limited conditions (e.g., homopurine or short mixed-sequence targets, low ionic strength, fully modified probe strands). Invader probes, i.e., DNA duplexes modified with +1 interstrand zippers of intercalator-functionalized nucleotides, are predisposed to recognize DNA targets due to their labile nature and high affinity towards complementary DNA. Here, we set out to gain further insight into the design parameters that impact the thermal denaturation properties and binding affinities of Invader probes. Towards this end, ten Invader probes were designed, and their biophysical properties and binding to model DNA hairpins and chromosomal DNA targets were studied. A Spearman’s rank-order correlation analysis of various parameters was then performed. Densely modified Invader probes were found to result in efficient recognition of chromosomal DNA targets with excellent binding specificity in the context of denaturing or non-denaturing fluorescence in situ hybridization (FISH) experiments. The insight gained from the initial phase of this study informed subsequent probe optimization, which yielded constructs displaying improved recognition of chromosomal DNA targets. The findings from this study will facilitate the design of efficient Invader probes for applications in the life sciences. Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Figure 1

14 pages, 4067 KiB

Open AccessArticle

Enzymatic Synthesis of Vancomycin-Modified DNA

by Chiara Figazzolo, Frédéric Bonhomme, Saidbakhrom Saidjalolov, Mélanie Ethève-Quelquejeu and Marcel Hollenstein

Molecules 2022, 27(24), 8927; https://doi.org/10.3390/molecules27248927 - 15 Dec 2022

Cited by 7 | Viewed by 2318

Abstract

Many potent antibiotics fail to treat bacterial infections due to emergence of drug-resistant strains. This surge of antimicrobial resistance (AMR) calls in for the development of alternative strategies and methods for the development of drugs with restored bactericidal activities. In this context, we [...] Read more.

Many potent antibiotics fail to treat bacterial infections due to emergence of drug-resistant strains. This surge of antimicrobial resistance (AMR) calls in for the development of alternative strategies and methods for the development of drugs with restored bactericidal activities. In this context, we surmised that identifying aptamers using nucleotides connected to antibiotics will lead to chemically modified aptameric species capable of restoring the original binding activity of the drugs and hence produce active antibiotic species that could be used to combat AMR. Here, we report the synthesis of a modified nucleoside triphosphate equipped with a vancomycin moiety on the nucleobase. We demonstrate that this nucleotide analogue is suitable for polymerase-mediated synthesis of modified DNA and, importantly, highlight its compatibility with the SELEX methodology. These results pave the way for bacterial-SELEX for the identification of vancomycin-modified aptamers. Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Graphical abstract

9 pages, 2635 KiB

Open AccessArticle

Using the Intrinsic Fluorescence of DNA to Characterize Aptamer Binding

by Chang Lu, Anand Lopez, Jinkai Zheng and Juewen Liu

Molecules 2022, 27(22), 7809; https://doi.org/10.3390/molecules27227809 - 12 Nov 2022

Cited by 3 | Viewed by 1987

Abstract

The reliable, readily accessible and label-free measurement of aptamer binding remains a challenge in the field. Recent reports have shown large changes in the intrinsic fluorescence of DNA upon the formation of G-quadruplex and i-motif structures. In this work, we examined whether DNA [...] Read more.

The reliable, readily accessible and label-free measurement of aptamer binding remains a challenge in the field. Recent reports have shown large changes in the intrinsic fluorescence of DNA upon the formation of G-quadruplex and i-motif structures. In this work, we examined whether DNA intrinsic fluorescence can be used for studying aptamer binding. First, DNA hybridization resulted in a drop in the fluorescence, which was observed for A30/T30 and a 24-mer random DNA sequence. Next, a series of DNA aptamers were studied. Cortisol and Hg²⁺ induced fluorescence increases for their respective aptamers. For the cortisol aptamer, the length of the terminal stem needs to be short to produce a fluorescence change. However, caffeine and adenosine failed to produce a fluorescence change, regardless of the stem length. Overall, using the intrinsic fluorescence of DNA may be a reliable and accessible method to study a limited number of aptamers that can produce fluorescence changes. Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Figure 1

15 pages, 3919 KiB

Open AccessFeature PaperArticle

Exploring the Interaction of G-quadruplex Binders with a (3 + 1) Hybrid G-quadruplex Forming Sequence within the PARP1 Gene Promoter Region

by Stefania Mazzini, Salvatore Princiotto, Roberto Artali, Loana Musso, Anna Aviñó, Ramon Eritja, Raimundo Gargallo and Sabrina Dallavalle

Molecules 2022, 27(15), 4792; https://doi.org/10.3390/molecules27154792 - 26 Jul 2022

Cited by 1 | Viewed by 1758

Abstract

The enzyme PARP1 is an attractive target for cancer therapy, as it is involved in DNA repair processes. Several PARP1 inhibitors have been approved for clinical treatments. However, the rapid outbreak of resistance is seriously threatening the efficacy of these compounds, and alternative [...] Read more.

The enzyme PARP1 is an attractive target for cancer therapy, as it is involved in DNA repair processes. Several PARP1 inhibitors have been approved for clinical treatments. However, the rapid outbreak of resistance is seriously threatening the efficacy of these compounds, and alternative strategies are required to selectively regulate PARP1 activity. A noncanonical G-quadruplex-forming sequence within the PARP1 promoter was recently identified. In this study, we explore the interaction of known G-quadruplex binders with the G-quadruplex structure found in the PARP gene promoter region. The results obtained by NMR, CD, and fluorescence titration, also confirmed by molecular modeling studies, demonstrate a variety of different binding modes with small stabilization of the G-quadruplex sequence located at the PARP1 promoter. Surprisingly, only pyridostatin produces a strong stabilization of the G-quadruplex-forming sequence. This evidence makes the identification of a proper (3+1) stabilizing ligand a challenging goal for further investigation. Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Graphical abstract

12 pages, 1467 KiB

Open AccessArticle

Sustainable Protocol for the Synthesis of 2′,3′-Dideoxynucleoside and 2′,3′-Didehydro-2′,3′-dideoxynucleoside Derivatives

by Virginia Martín-Nieves, Yogesh S. Sanghvi, Susana Fernández and Miguel Ferrero

Molecules 2022, 27(13), 3993; https://doi.org/10.3390/molecules27133993 - 21 Jun 2022

Cited by 1 | Viewed by 1586

Abstract

An improved protocol for the transformation of ribonucleosides into 2′,3′-dideoxynucleoside and 2′,3′-didehydro-2′,3′-dideoxynucleoside derivatives, including the anti-HIV drugs stavudine (d4T), zalcitabine (ddC) and didanosine (ddI), was established. The process involves radical deoxygenation of xanthate using environmentally friendly and low-cost reagents. Bromoethane or 3-bromopropanenitrile was [...] Read more.

An improved protocol for the transformation of ribonucleosides into 2′,3′-dideoxynucleoside and 2′,3′-didehydro-2′,3′-dideoxynucleoside derivatives, including the anti-HIV drugs stavudine (d4T), zalcitabine (ddC) and didanosine (ddI), was established. The process involves radical deoxygenation of xanthate using environmentally friendly and low-cost reagents. Bromoethane or 3-bromopropanenitrile was the alkylating agent of choice to prepare the ribonucleoside 2′,3′-bisxanthates. In the subsequent radical deoxygenation reaction, tris(trimethylsilyl)silane and 1,1′-azobis(cyclohexanecarbonitrile) were used to replace hazardous Bu₃SnH and AIBN, respectively. In addition, TBAF was substituted for camphorsulfonic acid in the deprotection step of the 5′-O-silyl ether group, and an enzyme (adenosine deaminase) was used to transform 2′,3′-dideoxyadenosine into 2′,3′-dideoxyinosine (ddI) in excellent yield. Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Graphical abstract

20 pages, 3320 KiB

Open AccessArticle

Properties of Parallel Tetramolecular G-Quadruplex Carrying N-Acetylgalactosamine as Potential Enhancer for Oligonucleotide Delivery to Hepatocytes

by Anna Clua, Santiago Grijalvo, Namrata Erande, Swati Gupta, Kristina Yucius, Raimundo Gargallo, Stefania Mazzini, Muthiah Manoharan and Ramon Eritja

Molecules 2022, 27(12), 3944; https://doi.org/10.3390/molecules27123944 - 20 Jun 2022

Cited by 1 | Viewed by 2492 | Correction

Abstract

The development of oligonucleotide conjugates for in vivo targeting is one of the most exciting areas for oligonucleotide therapeutics. A major breakthrough in this field was the development of multifunctional GalNAc-oligonucleotides with high affinity to asialoglycoprotein receptors (ASGPR) that directed therapeutic oligonucleotides to [...] Read more.

The development of oligonucleotide conjugates for in vivo targeting is one of the most exciting areas for oligonucleotide therapeutics. A major breakthrough in this field was the development of multifunctional GalNAc-oligonucleotides with high affinity to asialoglycoprotein receptors (ASGPR) that directed therapeutic oligonucleotides to hepatocytes. In the present study, we explore the use of G-rich sequences functionalized with one unit of GalNAc at the 3′-end for the formation of tetrameric GalNAc nanostructures upon formation of a parallel G-quadruplex. These compounds are expected to facilitate the synthetic protocols by providing the multifunctionality needed for the binding to ASGPR. To this end, several G-rich oligonucleotides carrying a TGGGGGGT sequence at the 3′-end functionalized with one molecule of N-acetylgalactosamine (GalNAc) were synthesized together with appropriate control sequences. The formation of a self-assembled parallel G-quadruplex was confirmed through various biophysical techniques such as circular dichroism, nuclear magnetic resonance, polyacrylamide electrophoresis and denaturation curves. Binding experiments to ASGPR show that the size and the relative position of the therapeutic cargo are critical for the binding of these nanostructures. The biological properties of the resulting parallel G-quadruplex were evaluated demonstrating the absence of the toxicity in cell lines. The internalization preferences of GalNAc-quadruplexes to hepatic cells were also demonstrated as well as the enhancement of the luciferase inhibition using the luciferase assay in HepG2 cell lines versus HeLa cells. All together, we demonstrate that tetramerization of G-rich oligonucleotide is a novel and simple route to obtain the beneficial effects of multivalent N-acetylgalactosamine functionalization. Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Graphical abstract

14 pages, 3016 KiB

Open AccessArticle

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

by Francesca Greco, Domenica Musumeci, Nicola Borbone, Andrea Patrizia Falanga, Stefano D’Errico, Monica Terracciano, Ilaria Piccialli, Giovanni Nicola Roviello and Giorgia Oliviero

Molecules 2022, 27(9), 2997; https://doi.org/10.3390/molecules27092997 - 07 May 2022

Cited by 9 | Viewed by 2168

Abstract

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the [...] Read more.

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations. Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Figure 1

Review

Jump to: Editorial, Research, Other

19 pages, 3941 KiB

Open AccessReview

Advances in the Structure of GGGGCC Repeat RNA Sequence and Its Interaction with Small Molecules and Protein Partners

by Xiaole Liu, Xinyue Zhao, Jinhan He, Sishi Wang, Xinfei Shen, Qingfeng Liu and Shenlin Wang

Molecules 2023, 28(15), 5801; https://doi.org/10.3390/molecules28155801 - 01 Aug 2023

Cited by 1 | Viewed by 1478

Abstract

The aberrant expansion of GGGGCC hexanucleotide repeats within the first intron of the C9orf72 gene represent the predominant genetic etiology underlying amyotrophic lateral sclerosis (ALS) and frontal temporal dementia (FTD). The transcribed r(GGGGCC)_n RNA repeats form RNA foci, which recruit RNA binding [...] Read more.

The aberrant expansion of GGGGCC hexanucleotide repeats within the first intron of the C9orf72 gene represent the predominant genetic etiology underlying amyotrophic lateral sclerosis (ALS) and frontal temporal dementia (FTD). The transcribed r(GGGGCC)_n RNA repeats form RNA foci, which recruit RNA binding proteins and impede their normal cellular functions, ultimately resulting in fatal neurodegenerative disorders. Furthermore, the non-canonical translation of the r(GGGGCC)_n sequence can generate dipeptide repeats, which have been postulated as pathological causes. Comprehensive structural analyses of r(GGGGCC)_n have unveiled its polymorphic nature, exhibiting the propensity to adopt dimeric, hairpin, or G-quadruplex conformations, all of which possess the capacity to interact with RNA binding proteins. Small molecules capable of binding to r(GGGGCC)_n have been discovered and proposed as potential lead compounds for the treatment of ALS and FTD. Some of these molecules function in preventing RNA–protein interactions or impeding the phase transition of r(GGGGCC)_n. In this review, we present a comprehensive summary of the recent advancements in the structural characterization of r(GGGGCC)_n, its propensity to form RNA foci, and its interactions with small molecules and proteins. Specifically, we emphasize the structural diversity of r(GGGGCC)_n and its influence on partner binding. Given the crucial role of r(GGGGCC)_n in the pathogenesis of ALS and FTD, the primary objective of this review is to facilitate the development of therapeutic interventions targeting r(GGGGCC)_n RNA. Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Figure 1

12 pages, 1654 KiB

Open AccessReview

Synthesis of Backbone-Modified Morpholino Oligonucleotides Using Phosphoramidite Chemistry

by Sibasish Paul and Marvin H. Caruthers

Molecules 2023, 28(14), 5380; https://doi.org/10.3390/molecules28145380 - 13 Jul 2023

Cited by 2 | Viewed by 1895

Abstract

Phosphorodiamidate morpholinos (PMOs) are known as premier gene knockdown tools in developmental biology. PMOs are usually 25 nucleo-base-long morpholino subunits with a neutral phosphorodiamidate linkage. PMOs work via a steric blocking mechanism and are stable towards nucleases’ inside cells. PMOs are usually synthesized [...] Read more.

Phosphorodiamidate morpholinos (PMOs) are known as premier gene knockdown tools in developmental biology. PMOs are usually 25 nucleo-base-long morpholino subunits with a neutral phosphorodiamidate linkage. PMOs work via a steric blocking mechanism and are stable towards nucleases’ inside cells. PMOs are usually synthesized using phosphoramidate P(V) chemistry. In this review, we will discuss the synthesis of PMOs, phosphoroamidate morpholinos (MO), and thiophosphoramidate morpholinos (TMO). Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Figure 1

14 pages, 1125 KiB

Open AccessReview

Non-G Base Tetrads

by Núria Escaja, Bartomeu Mir, Miguel Garavís and Carlos González

Molecules 2022, 27(16), 5287; https://doi.org/10.3390/molecules27165287 - 19 Aug 2022

Cited by 7 | Viewed by 1894

Abstract

Tetrads (or quartets) are arrangements of four nucleobases commonly involved in the stability of four-stranded nucleic acids structures. Four-stranded or quadruplex structures have attracted enormous attention in the last few years, being the most extensively studied guanine quadruplex (G-quadruplex). Consequently, the G-tetrad is [...] Read more.

Tetrads (or quartets) are arrangements of four nucleobases commonly involved in the stability of four-stranded nucleic acids structures. Four-stranded or quadruplex structures have attracted enormous attention in the last few years, being the most extensively studied guanine quadruplex (G-quadruplex). Consequently, the G-tetrad is the most common and well-known tetrad. However, this is not the only possible arrangement of four nucleobases. A number of tetrads formed by the different nucleobases have been observed in experimental structures. In most cases, these tetrads occur in the context of G-quadruplex structures, either inserted between G-quartets, or as capping elements at the sides of the G-quadruplex core. In other cases, however, non-G tetrads are found in more unusual four stranded structures, such as i-motifs, or different types of peculiar fold-back structures. In this report, we review the diversity of these non-canonical tetrads, and the structural context in which they have been found. Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures

Figure 1

Other

Jump to: Editorial, Research, Review

3 pages, 1391 KiB

Open AccessCorrection

Correction: Clua et al. Properties of Parallel Tetramolecular G-Quadruplex Carrying N-Acetylgalactosamine as Potential Enhancer for Oligonucleotide Delivery to Hepatocytes. Molecules 2022, 27, 3944

by Anna Clua, Santiago Grijalvo, Namrata Erande, Swati Gupta, Kristina Yucius, Raimundo Gargallo, Stefania Mazzini, Muthiah Manoharan and Ramon Eritja

Molecules 2023, 28(1), 98; https://doi.org/10.3390/molecules28010098 - 23 Dec 2022

Viewed by 931

Abstract

In the original article [...] Full article

(This article belongs to the Special Issue Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry)

► Show Figures