Next Article in Journal
Impact of Diet on Gut Microbiota Composition and Microbiota-Associated Functions in Heart Failure: A Systematic Review of In Vivo Animal Studies
Next Article in Special Issue
Effects of Carbohydrase Supplementation on Growth Performance, Intestinal Digestive Enzymes and Flora, Glucose Metabolism Enzymes, and glut2 Gene Expression of Hybrid Grouper (Epinephelus fuscoguttatus♀ × E. lanceolatus♂) Fed Different CHO/L Ratio Diets
Previous Article in Journal
In Vitro, In Silico and Network Pharmacology Mechanistic Approach to Investigate the α-Glucosidase Inhibitors Identified by Q-ToF-LCMS from Phaleria macrocarpa Fruit Subcritical CO2 Extract
Previous Article in Special Issue
Comparative Study of the Gut Microbiota Community between the Farmed and Wild Mastacembelus armatus (Zig-Zag Eel)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Metabolites
Volume 12
Issue 12
10.3390/metabo12121268
metabolites-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Glycerol Monolaurate Alleviates Oxidative Stress and Intestinal Flora Imbalance Caused by Salinity Changes for Juvenile Grouper

by
Xuehe Li
1,2,
Dongwenjun Zhu
1,2,
Minling Mao
1,2,
Jianwei Wu
1,2,
Qihui Yang
1,2,3,*,
Beiping Tan
1,2 and
Shuyan Chi
1,2
1
College of Fisheries, Guangdong Ocean University, Zhanjiang 524088, China
2
Aquatic Animals Precision Nutrition and High Efficiency Feed Engineering Research Center of Guangdong Province, Zhanjiang 524088, China
3
Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy Culture, Zhanjiang 524088, China
*
Author to whom correspondence should be addressed.
Metabolites 2022, 12(12), 1268; https://doi.org/10.3390/metabo12121268
Submission received: 29 November 2022 / Revised: 12 December 2022 / Accepted: 14 December 2022 / Published: 15 December 2022
(This article belongs to the Special Issue Nutrient Metabolism and Intestinal Health Studies in Aquatic Animals)
Browse Figures
Versions Notes

Abstract

:
Groupers with an initial body weight of 9.10 ± 0.03 g were selected to investigate whether dietary addition of 0 (G0) and 1800 mg/kg glycerol monolaurate (GML, G1800) could alleviate the oxidative stress response and intestinal flora imbalance after 0, 6, 12, and 24 h of salinity change in grouper. Experimental results show that the dietary addition of GML significantly reduced the liver MDA content and increased the SOD activity of grouper. The gene expression of CAT and SOD increased and then decreased with time after adding 1800 mg/kg GML, and the highest values were significantly higher than those of the control group. Salinity change had a slight effect on the top four intestinal flora composition of grouper at 0, 12, and 24 h, with changes occurring only at 6 h when Cyanobacteria replaced Actinobacteria. The addition of dietary GML slowed down the intestinal flora disorder, inhibited the colonization of harmful bacterium Vibrio, and promoted the abundance of beneficial bacterium Bacillus. In conclusion, dietary GML significantly reduced the oxidative damage caused by sudden changes in salinity, improved the antioxidant capacity, and alleviated the intestinal flora imbalance in juvenile grouper.

1. Introduction

With the development of intensive aquaculture, aquatic animals are subjected to increasing stress factors, such as excessive density, water pollution, shock, and sudden changes in salinity and temperature. Environmental stresses may induce excessive production or accumulation of reactive oxygen radicals (ROS) in aquatic animals. They could affect the antioxidant protection capacity of aquatic animals, thus causing oxidative stress in fish and even leading to various disease outbreaks [1,2,3].
Previous studies have shown that a variety of essential nutrients (e.g., proteins, amino acids, fatty acids, carbohydrates, and vitamins) and additives (e.g., enzymes and immunopolysaccharides) could modulate the immune system of aquatic animals and alleviate the stress experienced by them in the environment. This modulation is one of the effective means of enhancing stress resistance, and it could be a stress management strategy to improve the overall performance of aquatic animals [4,5,6]. Functional feed additives, as one of the antistress strategies, could play an indirect role in promoting growth by improving immune function, reducing oxidative stress, and enhancing disease resistance rather than directly providing additional nutrients necessary for growth [7].
Glycerol monolaurate (GML) is a natural compound composed of glycerol and lauric acid, a derivative of fatty acids, with remarkable antibacterial, antiviral, and anti-inflammatory properties [8]. Although the beneficial effects of GML are gradually being recognized, most of them are limited to livestock and poultry animals. The applications of GML in aquaculture is relatively few, and the studies have been mainly focused on Danio rerio [9], Larimichthys crocea [10], Lateolabrax maculatus [11], Litopenaeus vannamei [12], and Pelodiscus sinensis [13]. The above experimental results show that GML can significantly improve growth performance, digestive capacity, immune index, antioxidant activity, muscle quality, and lipid metabolism. Moreover, studies on whether GML supplementation could reduce oxidative stress and decrease changes in intestinal flora in aquatic organisms are not sufficient.
Hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) has become one of the most important breeding species along the southeast coast of China because of its fast growth rate, high nutritional value, and disease resistance [14]. The annual production of grouper reached 204,200 tons in 2021 [15]. In recent years, the continuous expansion of grouper culture scale and increasing culture density, coupled with the influence of water environment changes and other factors, has caused oxidative stress of grouper and frequent occurrence of various diseases, bringing serious economic losses to its culture industry [1,16]. The hybrid grouper was chosen as the subject of this study, which aimed to investigate whether adding GML to the diet could improve the antioxidant capacity of grouper, mitigate oxidative stress, and protect intestinal health.

2. Materials and Methods

2.1. Diets Preparation

Two experimental diets were prepared by adding 1800 mg/kg GML (G1800) to the basal diet (G0) (Table 1). Firstly, all powdered ingredients were passed through a 60-mesh screen and mixed using a uniform V-mixer (M-256, South China University of Technology, Guangzhou, China). Secondly, all liquid lipid sources were mixed and added and rubbed well until no visible lipid particles were present. Finally, 30% distilled water was added, and the feed was extruded into round strips using an expander (G-90A, Beijing Modern Yanggong Machinery Technology Development Co., Ltd., Beijing, China) and cut into small uniform pellets. The prepared feeds were dried in a ventilated place and stored at −20 °C. Finally, the prepared feed pellets were dried in the shaded area and stored in a sealed container at −20 °C before the experiment [17].

2.2. Experimental Design

Juvenile groupers were sourced from the Yongsheng Fish Hatchery (Zhanjiang, Guangdong, China). All groupers were placed in many fiberglass tanks (2 m3) for two weeks before the start of the experiment to adapt to the new environment and meet the experimental requirements. Feeding was stopped 24 h before the start of the experiment t [14]. Two hundred and forty evenly sized groupers with an initial weight of 9.10 ± 0.03 g were selected and randomly divided into 8 tanks with 30 fish in each tank for 2 groups to perform the 8-week feeding trial. During the experimental period, water was changed daily to keep the water fresh, and fish were fed twice a day (7:30 and 17:30).
At the end of the culture experiment, all groupers were fasted for 24 h. Fifteen fish per tank were selected to start the salinity stress experiment in water with a salinity of 10‰.

2.3. Sample Collection

Five groupers were selected from each tank at each sampling time (0, 6, 12, and 24 h). Livers were extracted for antioxidant index and gene expression, and intestines were taken for intestinal flora determination.

2.4. Liver Antioxidant Index

The content of malondialdehyde (MDA) and activity of superoxide dismutase (SOD) were determined by commercial ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China).

2.5. Real-Time Quantitative RT-PCR Analysis of Gene Expression

All mRNA expression in total RNA was extracted from the liver using RNA Extraction Kit (TansGen Biotech, Co., Ltd., Beijing, China), and the RNA concentration was determined by nuclear acid protein analyzer (Guangzhou Yitao Scientific Instrument Corporation, Guangzhou, China). Complementary DNA (cDNA) was synthesized by Evo M-MLV RT kit (Accurate Biotechnology (Hunan) Co., Ltd., Hunan, China). All gene expressions of interleukin-6 (IL6), catalase (CAT) and SOD were performed on Roche Light Cycler 480II (Switzerland) using an SYBR® Green Pro Taq HS Premix II kit (Accurate Biotechnology (Hunan) Co., Ltd., Hunan, China). Primer sequences were designed using Primer 5 following the cDNA sequences found in NCBI (Table 2). The results of real-time qPCR were analyzed by the 2−ΔΔCT method [18].

2.6. Intestinal Flora Analysis

2.6.1. Extraction of Genomic DNA

The DNA from intestinal sample was extracted by Guangzhou Gene Denovo Ltd. using the E.Z.N.A fecal DNA Kit (Omega Bio-Tek, Norcross, GA, USA).

2.6.2. PCR Amplification of Target Regions

After extraction of genomic DNA from the samples, the V3 + V4 region of the 16S rDNA was amplified using specific primers with barcodes. The primer sequences were: 341F: CCTACGGGGNGGCWGCAG; 806R: GGACTACHVGGGTATCTAAT. PCR reaction conditions were set according to the description of the previous study.

2.6.3. PCR Product Purification, Library Construction and Sequencing

PCR products were first examined by 2% agarose gel electrophoresis then purified with AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Co., Ltd., Beijing, China) following the instructions. The purified amplification products were ligated to sequencing ligations, and sequencing libraries were constructed and sequenced on Illumina.

2.6.4. Data Analysis and Functional Prediction

After sequencing the raw reads, the low-quality reads and tags were first filtered using the Usearch software, and the resulting data are called Clean Tag. Secondly, clustering was conducted by applying the Usearch software to access OTU abundance and OTU representative sequences according to Clean Tag. Finally, functional predictions such as species composition analysis, indicator species analysis, and alpha diversity analysis were performed on the basis of OTU sequences and abundance data.

2.7. Statistical Analysis

Before the application of ANOVA, the homogeneity of variance was analyzed. Data from this experiment were statistically analyzed using SPSS 17.0 software. One-way ANOVA was used to analyze the data, and if there were significant differences (p < 0.05), Duncan’s multiple comparisons were adopted. The experimental data were expressed as mean ± standard deviation (X ± SD).

3. Results

3.1. Effects of GML on Antioxidant Enzyme Activities Caused by Salinity Changes for Grouper

As seen from Figure 1A, the MDA content of the G1800 group was significantly lower than that of the G0 group during the salinity change experiment (p < 0.05). The MDA content of the G0 and G1800 groups as a whole increased first and then decreased, and it had the highest value at 12 h. As shown in Figure 1B, the SOD activity in the G1800 group at 0, 6, and 12 h was significantly higher than that in the G0 group (p < 0.05).

3.2. Effects of GML on Gene Expression Caused by Salinity Changes in Grouper

The expressions of CAT, SOD, and IL6 in the G1800 group all increased and then decreased with time. The expression of CAT reached its highest value at 6 h (p < 0.05, Figure 2A) and SOD at 12 h (p < 0.05, Figure 2B), both of which were significantly higher than that of the G0 group. The expression of IL6 reached its highest value at 6 h (p < 0.05) and was significantly lower than that of the G0 group at 0, 12, and 24 h (p < 0.05, Figure 2C).

3.3. Effects of GML on Intestinal Flora Caused by Salinity Changes in Grouper

3.3.1. Effects of GML on Relative Abundance at the Phylum Level Caused by Salinity Changes in Grouper

At 0, 12, and 24 h, the intestinal flora of grouper was mainly composed of Proteobacteria, Firmicutes, Bacteroidetes, and Actinobacteria (Figure 3A,C,D).
By contrast, the intestinal flora composition of grouper changed when the stress time reached 6 h, and the top four flora changed to Proteobacteria, Firmicutes, Bacteroidetes, and Cyanobacteria (Figure 3B). The specific relative abundance values of each group are supplemented in Table 3.

3.3.2. Effects of GML on Relative Abundance at the Genus Level Caused by Salinity Changes in Grouper

The top four genus with the highest relative abundance at 0, 6, and 12 h were Photobacterium, Acinetobacter, Bacillus, and Vibrio, but the order was different; while Acinetobacter and Vibrio were still the top four at 24 h, the relative abundance of Bacillus and Photobacterium was significantly reduced and replaced by Proteus and Morganella.
At 0 h, the top four groups with relative abundance in each group were Photobacterium, Acinetobacter, Bacillus, and Vibrio (Figure 4A). At 6 h, the top four groups with relative abundance in each group were Vibrio, Acinetobacter, Bacillus, and Photobacterium (Figure 4B). At 12 h, the top four groups with relative abundance in each group were Vibrio, Bacillus, Acinetobacter, and Photobacterium (Figure 4C). At 24 h, the top four groups with relative abundance in each group were Acinetobacter, Vibrio, Proteus, and Morganella (Figure 4D).

3.3.3. Effects of GML on Indicator Species Caused by Salinity Changes in Grouper

The relative abundance of Photobacterium in the G0 and G1800 groups decreased significantly (p < 0.05) with increasing time throughout the salinity change period. At 0 h, the abundance in the G0 group was significantly higher than that in the G1800 group. At 6, 12, and 24 h, the abundance in the G1800 group was significantly higher than that in the G0 group (p < 0.05, Figure 5A).
The relative abundance of Vibrio in the G0 and G1800 groups increased with time and demonstrated the highest value at 12 h (p < 0.05). The Vibrio in the G1800 group was significantly lower than that in the G0 group, except for 24 h (p < 0.05). The relative abundance of Bacillus in the G0 group increased with time and exhibited the highest value at 12 h (p < 0.05). Meanwhile, the Bacillus in the G1800 group showed no significant difference at 0, 6, and 24 h, but it increased significantly at 12 h (p < 0.05).

4. Discussion

The antioxidant system in aquatic animals consists of an enzymatic system (SOD and CAT) and a non-enzymatic system (oxidation products such as MDA and other non-enzymatic antioxidants). SOD is the first line of defense against oxidative stress, scanning excess oxygen radicals (ROS), and increasing the antioxidant level in fish, which, in turn, protects cells from ROS damage [19]. ROS could react with phospholipids, enzymes, and other macromolecules on biological membranes to form lipid peroxidation products, which expose cells to oxidative damage. MDA is one of the lipid peroxides, and it reflects the degree of oxidative damage in the organism [20]. The addition of 2000 mg/kg GML to the diet of Eriocheir sinensis significantly increased the SOD activity and decreased the MDA content in the hepatopancreas [21]. Wang et al. [12] experimentally demonstrated that adding 350 mg/kg GML significantly increased the SOD activity of Litopenaeus vannamei. In the present study, compared with the control group, supplementation of 1800 mg/kg GML significantly increased the SOD activity of grouper, improved the antioxidant capacity, and enhanced the ability to remove ROS, while significantly reducing the MDA content, decreasing lipid peroxidation, alleviating oxidative stress, and reducing damage in grouper.
CAT belongs to one of the antioxidant enzymes, which could coordinate with SOD to scavenge ROS and prevent or repair oxidative damage [22]. Wang et al. [12] showed that the addition of 350 mg/kg GML to the diet significantly increased the SOD and CAT activities of Litopenaeus vannamei. In the salinity stress experiment, the expression levels of CAT and SOD in the G1800 group increased and then decreased, and they had the highest values at 6 and 12 h, respectively, both of which were significantly higher than those in the G0 group. This finding indicated that the peroxidation level was alleviated by the addition of GML, which regulated the delicate balance between oxidants and antioxidants, enhanced the antioxidant capacity of grouper, and reduced oxidative stress. IL6 is one of a family of pro-inflammatory factors that could significantly promote pathological inflammation [23]. Studies have shown that IL6 expression tends to decrease after adding 750 mg/kg GML to Danio rerio diets [9]. Zhao et al. [24] showed that adding 600 mg/kg GML reduced the serum IL6 concentration and decreased the inflammatory response in high-fat-fed mice. The results of the present work show that supplementation of GML significantly reduced the expression of IL6 in the liver of grouper, except for 6 h during the salinity stress experiment, similar to the results of previous studies. Oxidative stress could activate multiple transcription factors, leading to differential expression of genes related to inflammatory pathways. The inflammation caused by oxidative stress is the etiology of many chronic diseases [25,26]. Inflammatory diseases could reduce animal production performance, reproductive performance, and disease resistance. They not only cause huge economic losses to farmers but also endanger the health of consumers [27,28]. The present study demonstrated that dietary addition of GML could alleviate the increase in MDA content caused by sudden change in salinity and remove the accumulated ROS in the body by increasing the expression of SOD and CAT, reduce the systemic inflammatory response, and attenuate the stress response.
The intestinal flora is a complex ecosystem with dynamic diversity. A close relationship exists between the intestinal flora and the immune system, playing an important role in maintaining normal intestinal function and the immune function of the body [29,30]. Diet is one of the main environmental factors that shape the intestinal flora, and the composition of the intestinal flora could be altered in response to changes in diet [30]. The intestinal flora of grouper consisted mainly of Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes, similar to the results of previous studies [17]. The present study showed that the Firmicutes in the intestinal flora of grouper significantly increased after GML supplementation. The main metabolite of Firmicutes is butyric acid (BA) [31]. BA is a major source of energy for intestinal epithelial cells and may promote intestinal health by increasing epithelial absorptive cells [32]. The addition of GML can significantly increase the abundance of Firmicutes, improve BA content, and promote intestinal health. The sudden change in salinity had minimal effect on the relative abundance of Proteobacteria, Firmicutes, and Bacteroidetes. Only a minor change occurred at 6 h, when the relative abundance of cyanobacteria increased, replacing the actinomycete bacteria as the fourth. Photobacterium species are pathogenic in a wide range of marine animals, including fish, crustaceans, and mollusks [33]. Photobacterium is a Gram-negative bacterium that prefers salinity environments of 2–4%, and it could produce large amounts of histamine in high-salinity environments [34]. Long-term ingestion of diets containing high levels of histamine will lead to excessive production and metabolic imbalance of oxygen radicals in carnivorous fish, reduce the activity of liver antioxidant enzymes, and cause liver oxidative stress and apoptosis of normal hepatocytes, thereby resulting in growth inhibition [35,36]. The abundance of Photobacterium was significantly reduced by the addition of GML. The sudden drop in salinity caused the death of Photobacterium by water uptake rupture in the G0 and G1800 groups, but the death rate in the G1800 group was significantly lower than that in the G0 group. The reason may be that lauric acid (LA), the hydrolysis product of GML, could enter the liver directly through the portal system in free form to participate in organism metabolism. In the absence of apolipoproteins, LA could also enter the mitochondria for oxidation and rapid energy production for the organism [37]. Osmoregulation is an active transport process that requires adenosine triphosphate (ATP), and GML could rapidly supply energy to provide the ATP needed for osmoregulation, thus increasing osmoregulation capacity and slowly decreasing Photobacterium abundance. Vibrio is a salt-loving bacteria, a common pathogen of aquatic creatures, and known as the “scourge” of marine fish [38]. The reduction in salinity levels is generally recognized as one of the factors that promote the abundance of Vibrio [39]. The generation time of pathogenic Vibrio could be as low as 20–30 min, thus allowing a rapid response to changing environmental conditions [40]. Oberbeckmann et al. [41] showed that an abrupt drop in salinity and a peak in algae caused an extremely high abundance of Vibrio of γ-Proteobacteria at 24%. The relative abundance of Vibrio vulnificus was generally negatively correlated with salinity, and a high abundance of it was observed at 5–10‰ salinity, regardless of temperature [42]. The addition of GML to the diet significantly reduced Vibrio abundance. The abundance of Vibrio in the G0 and G1800 groups increased and then decreased over time after salinity change, but the Vibrio abundance in the G1800 group was consistently significantly lower than that in the G10 group. This finding indicated that GML significantly inhibited the multiplication of pathogenic V. vulnificus after a sudden drop in salinity and improved the stress resistance of grouper. Bacillus is widely used as a probiotic in aquaculture. Many experiments have shown that Bacillus could enhance the activity of antioxidant enzymes, increase the expression of immune-related genes and stress-resistant-related genes, and improve the ability of fish to resist pathogenic microorganisms [43,44,45,46]. The results of the present study showed that adding GML significantly increased the abundance of Bacillus. After 12 h, the abundance of Bacillus in the G1800 group was significantly higher than that in the G0 group. It slowed down the changes in intestinal flora caused by sudden changes in salinity, increased the abundance of beneficial bacteria, and improved the ability of the organism to resist stress response.

5. Conclusions

The supplementation of GML in grouper diet significantly reduced the oxidative damage represented by salinity stress, improved antioxidant capacity, slowed down intestinal flora imbalance, promoted the abundance of beneficial bacteria, and enhanced resistance to oxidative stress. The findings of the present study can add value to the current existing knowledge of beneficial effects of GML in aquaculture. We will make more efforts to produce more research results of GML in aquatic animals.

Author Contributions

Investigation, conceptualization, software, and writing—original draft, X.L.; supervision and validation, D.Z., M.M. and J.W.; supervision and software, Q.Y.; investigation, methodology, and resources, B.T. and S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation (31802316); Correspondent for science and technology of Guangdong Province (GDKTP2021048400); National Key Research and Development Program (2019YFD0900200); Postgraduate Education Innovation Project of Guangdong Ocean University (202247).

Institutional Review Board Statement

This study has been reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the College of Aquatic Sciences, Guangdong Ocean University. The approval code is GDOU-IACUC-2021-A2092, and the approval date is 20 June 2021.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The data are not publicly available due to privacy.

Conflicts of Interest

The authors confirm that there was no conflict of interest with this experiment.

References

  1. Guo, Z.X.; Zeng, Z.Q.; Huang, J.S.; Wang, W.Z.; Li, H.J.; Chen, G. Effects of acute hypoxia on oxidative stress, energy utilization and carbohydrate metabolism in liver of large-sized juvenile cobia (Rachycentron canadum). J. Guangdong Ocean. Univ. 2020, 40, 134–140. [Google Scholar]
  2. Hou, S.; Jin, Z.; Jiang, W.; Chi, L.; Xia, B.; Chen, J. Physiological and immunological responses of sea cucumber Apostichopus japonicus during desiccation and subsequent resubmersion. PeerJ 2019, 7, e7427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Tuerxun, M.; Muhda, A.; Yin, L. The molecular mechanisms of signal pathway activating effect of E2F-1/NF-kappaB/GSK-3beta on cognitive dysfunction of alzheimer rats. Bioengineered 2021, 12, 10000–10008. [Google Scholar] [CrossRef]
  4. Famurewa, A.C.; Aja, P.M.; Maduagwuna, E.K.; Ekeleme-Egedigwe, C.A.; Ufebe, O.G.; Azubuike-Osu, S.O. Antioxidant and anti-inflammatory effects of virgin coconut oil supplementation abrogate acute chemotherapy oxidative nephrotoxicity induced by anticancer drug methotrexate in rats. Biomed. Pharmacother. 2017, 96, 905–911. [Google Scholar] [CrossRef] [PubMed]
  5. Liu, B.; Zhou, Q.L.; Liang, H.L.; Sun, C.X.; Zheng, X.C.; Lin, Y.; Ren, M.C.; Zhu, L.; Ge, X.P. Advances in aquatic animal nutrition and immunity research. J. Fish. China 2022, 46, 1761–1775. [Google Scholar]
  6. Zhang, C.; Zhang, Q.; Song, X.; Pang, Y.; Song, Y.; Cheng, Y.; Yang, X. Dietary L-tryptophan modulates the hematological immune and antibacterial ability of the chinese mitten crab, Eriocheir sinensis, under cheliped autotomy stress. Front. Immunol. 2018, 9, 2744. [Google Scholar] [CrossRef]
  7. Higgs, D.A.; McBride, J.R.; Markert, J.R.; Dosanjh, B.S.; Plotnikoff, M.D.; Clarke, W.C. Evaluation of tower and candle rapeseed (canola) meal and bronowski rapeseed protein concentrate as protein supplements in practical dry diets for juvenile chinook salmon (Oncorhynchus tshawytscha). Aquaculture 1982, 29, 1–31. [Google Scholar] [CrossRef]
  8. Kong, L.; Wang, Z.; Xiao, C.; Zhu, Q.; Song, Z. Glycerol monolaurate attenuated immunological stress and intestinal mucosal injury by regulating the gut microbiota and activating AMPK/Nrf2 signaling pathway in lipopolysaccharide-challenged broilers. Anim. Nutr. 2022, 10, 347–359. [Google Scholar] [CrossRef]
  9. Wang, Y.; Abdullah; Zhong, H.; Wang, J.; Feng, F. Dietary glycerol monolaurate improved the growth, activity of digestive enzymes and gut microbiota in zebrafish (Danio rerio). Aquacult. Rep. 2021, 20, 100670. [Google Scholar] [CrossRef]
  10. Wang, J.; Jiang, H.; Alhamoud, Y.; Chen, Y.; Zhuang, J.; Liu, T.; Cai, L.; Shen, W.; Wu, X.; Zheng, W.; et al. Integrated metabolomic and gene expression analyses to study the effects of glycerol monolaurate on flesh quality in large yellow croaker (Larimichthys crocea). Food Chem. 2022, 367, 130749. [Google Scholar] [CrossRef]
  11. Sun, C.Y.; Dong, H.B.; Wang, W.H.; Gu, Q.H.; Duan, Y.F.; Zhang, J.S.; Xu, X.D. Effects of glycerol monolaurate on lipid metabolism of Lateolabrax maculatus. South China Fish. Sci. 2021, 17, 67–75. [Google Scholar]
  12. Wang, Y.; Abdullah; Zhang, C.; Li, Y.; Feng, F. Effects of dietary glycerol monolaurate on the growth performance, digestive enzymes, body composition and non-specific immune response of white shrimp (Litopenaeus vannamei). Aquacult. Rep. 2020, 18, 100535. [Google Scholar] [CrossRef]
  13. Wang, Y.C.; Du, J.; Li, Y.; Zhang, H.; Feng, F.Q. Effects of glycerol monolaurate on growth, health and nutritional quality of Chinese soft-shelled turtle ( Pelodiscus sinensis). Chin. J. Anim. Nutr. 2019, 31, 428–436. [Google Scholar]
  14. Yan, X.; Li, Z.; Dong, X.; Tan, B.; Pan, S.; Li, T.; Long, S.; Huang, W.; Suo, X.; Yang, Y. Degradation of Muscle Quality in Hybrid Grouper (female symbol Epinephelus fuscoguttatus x male symbol Epinephelus lanceolatus) due to oxidative damage caused by ingestion of oxidized fish oil. Front. Nutr. 2022, 9, 840535. [Google Scholar] [CrossRef] [PubMed]
  15. Ministry of Agriculture and Rural Affairs of the Peoples Republic of China; National Fisheries Technology Extension Center; Chinese Society of Fisheries. China Fisheries Statistical Yearbook; China Agricultural Publishing House: Beijing, China, 2022; p. 42. [Google Scholar]
  16. Wang., D.P.; Cao., Z.W.; Xie., D.X.; Gan., X. Research progress in Epinephelus industry. J. South. Agric. 2018, 43, 1058–1065. [Google Scholar]
  17. He, Y.; Guo, X.; Tan, B.; Dong, X.; Yang, Q.; Liu, H.; Zhang, S.; Chi, S. Replacing fish meal with fermented rice protein in diets for hybrid groupers (Epinephelus fuscoguttatus♀× Epinephelus lanceolatus♂): Effects on growth, digestive and absorption capacities, inflammatory-related gene expression, and intestinal microbiota. Aquacult. Rep. 2021, 19, 100603. [Google Scholar] [CrossRef]
  18. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  19. Chen, F.J.; Fu, Y.S.; Ling, X.D.; Chang, L.; Li, X.Y. Effects of hypoxia stress on activities of mitochondrial respiratory chain complexes and antioxidant enzyme in muscle of lake Qinghai Scaleless Carp. J. Guangdong Ocean. Univ. 2021, 41, 118–124. [Google Scholar]
  20. He, G.; Dong, C.; Luan, Z.; McAllan, B.M.; Xu, T.; Zhao, L.; Qiao, J. Oxygen free radical involvement in acute lung injury induced by H5N1 virus in mice. Influenza Other Respir. Viruses 2013, 7, 945–953. [Google Scholar] [CrossRef] [Green Version]
  21. Fu, C.; Cui, Z.; Shi, X.; Liu, J.; Jiang, Y.; Zhang, R. Effects of dietary glyceryl monolaurate supplementation on growth performance, non-specific immunity, antioxidant status and intestinal microflora of Chinese mitten crabs. Fish Shellfish Immunol. 2022, 125, 65–73. [Google Scholar] [CrossRef]
  22. Lin, H.Z.; Gao, J.L.; Liang, Z.Y.; Fan, X.P.; Lin, H.S.; Cao, W.H.; Huang, Y.P.; Qin, X.M. Effect of cold stress methods on antioxidant and energy metabolism of Crassostrea gigas in water-free live storage period. J. Guangdong Ocean. Univ. 2022, 42, 95–103. [Google Scholar]
  23. Jiang, K.; Cao, S.; Cui, J.Z.; Matsubara, J.A. Immuno-modulatory Effect of IFN-gamma in AMD and its role as a possible target for therapy. J. Clin. Exp. Ophthalmol. 2013, Suppl. 2, 0071–0076. [Google Scholar] [CrossRef] [Green Version]
  24. Zhao, M.; Jiang, Z.; Cai, H.; Li, Y.; Feng, F. Modulation of the gut microbiota during high-dose glycerol monolaurate-mediated mmelioration of obesity in mice fed a high-fat Diet. mBio 2020, 11, e00190-20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Fan, H.; Li, D.; Guan, X.; Yang, Y.; Yan, J.; Shi, J.; Ma, R.; Shu, Q. MsrA suppresses inflammatory ictivation of microglia and oxidative stress to prevent demyelination via inhibition of the NOX2-MAPKs/NF-kappaB signaling pathway. Drug Des. Dev. Ther. 2020, 14, 1377–1389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Zhao, Y.; Tang, Z.; Nan, X.; Sun, F.; Xiong, B. Effects of Lonicera japonica extract on performance, blood biomarkers of inflammation and oxidative stress during perinatal period in dairy cows. Asian-Australas. J. Anim. Sci. 2019, 33, 1096. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Federico, A.; Morgillo, F.; Tuccillo, C.; Ciardiello, F.; Loguercio, C. Chronic inflammation and oxidative stress in human carcinogenesis. Int. J. Cancer 2010, 121, 2381–2386. [Google Scholar] [CrossRef] [PubMed]
  28. Rajkumar, K.; Bhattacharya, A.; David, S.; Balaji, S.H.; Hariharan, R.; Jayakumar, M.; Balaji, N. Socio-demographic study on extent of knowledge, awareness, attitude, and risks of zoonotic diseases among livestock owners in Puducherry region. Vet. World 2016, 9, 1018–1024. [Google Scholar] [CrossRef] [PubMed]
  29. Luo, X.; Zheng, Y.; Wen, R.; Deng, X.; Zhou, L.; Liao, H. Effects of ceftriaxone induced intestinal dysbacteriosis on lymphocytes in different tissues in mice. Immunobiology 2016, 221, 994–1000. [Google Scholar] [CrossRef]
  30. Tilocca, B.; Burbach, K.; Heyer, C.M.E.; Hoelzle, L.E.; Mosenthin, R.; Stefanski, V.; Camarinha-Silva, A.; Seifert, J. Dietary changes in nutritional studies shape the structural and functional composition of the pigs’ fecal microbiome-from days to weeks. Microbiome 2017, 5, 144. [Google Scholar] [CrossRef] [Green Version]
  31. Alkushi, A.G.; Abdelfattah-Hassan, A.; Eldoumani, H.; Elazab, S.T.; Mohamed, S.A.M.; Metwally, A.S.; El-Shetry, E.S.; Saleh, A.A.; ElSawy, N.A.; Ibrahim, D. Probiotics-loaded nanoparticles attenuated colon inflammation, oxidative stress, and apoptosis in colitis. Sci. Rep. 2022, 12, 5116. [Google Scholar] [CrossRef]
  32. Deng, Y.; Zhang, Y.; Chen, H.; Xu, L.; Wang, Q.; Feng, J. Gut-liver immune response and gut microbiota profiling reveal the pathogenic mechanisms of vibrio harveyi in pearl gentian grouper (Epinephelus lanceolatusmale symbol x E. fuscoguttatus female symbol). Front. Immunol. 2020, 11, 607754. [Google Scholar] [CrossRef] [PubMed]
  33. Kolba, N.; Zarei, A.; Cheng, J.; Agarwal, N.; Dadmohammadi, Y.; Khazdooz, L.; Abbaspourrad, A.; Tako, E. Alterations in intestinal brush border membrane functionality and bacterial populations following intra-amniotic administration (Gallus gallus) of nicotinamide riboside and its derivatives. Nutrients 2022, 14, 3130. [Google Scholar] [CrossRef] [PubMed]
  34. Kaszab, E.; Farkas, M.; Rado, J.; Micsinai, A.; Nyiro-Fekete, B.; Szabo, I.; Kriszt, B.; Urbanyi, B.; Szoboszlay, S. Novel members of bacterial community during a short-term chilled storage of common carp (Cyprinus carpio). Folia Microbiol. 2022, 67, 299–310. [Google Scholar] [CrossRef] [PubMed]
  35. Hu, L.; Yun, B.; Xue, M.; Wang, J.; Wu, X.; Zheng, Y.; Han, F. Effects of fish meal quality and fish meal substitution by animal protein blend on growth performance, flesh quality and liver histology of Japanese seabass (Lateolabrax japonicus). Aquaculture 2013, 372, 52–61. [Google Scholar] [CrossRef]
  36. Li, W.; Pan, X.; Cheng, W.; Cheng, Y.; Yin, Y.; Chen, J.; Xu, G.; Xie, L. Serum biochemistry, histology and transcriptomic profile analysis reflect liver inflammation and damage following dietary histamine supplementation in yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol. 2018, 77, 83–90. [Google Scholar] [CrossRef] [PubMed]
  37. Li, Q.; Estes, J.D.; Schlievert, P.M.; Duan, L.; Brosnahan, A.J.; Southern, P.J.; Reilly, C.S.; Peterson, M.L.; Schultz-Darken, N.; Brunner, K.G.; et al. Glycerol monolaurate prevents mucosal SIV transmission. Nature 2009, 458, 1034–1038. [Google Scholar] [CrossRef] [Green Version]
  38. Kalatzis, P.G.; Castillo, D.; Katharios, P.; Middelboe, M. Bacteriophage Interactions with Marine Pathogenic Vibrios: Implications for Phage Therapy. Antibiotics 2018, 7, 15. [Google Scholar] [CrossRef]
  39. Takemura, A.F.; Chien, D.M.; Polz, M.F. Associations and dynamics of Vibrionaceae in the environment, from the genus to the population level. Front. Microbiol. 2014, 5, 38. [Google Scholar] [CrossRef] [Green Version]
  40. Froelich, B.; Bowen, J.; Gonzalez, R.; Snedeker, A.; Noble, R. Mechanistic and statistical models of total Vibrio abundance in the Neuse River Estuary. Water Res. 2013, 47, 5783–5793. [Google Scholar] [CrossRef]
  41. Oberbeckmann, S.; Fuchs, B.M.; Meiners, M.; Wichels, A.; Wiltshire, K.H.; Gerdts, G. Seasonal dynamics and modeling of a Vibrio community in coastal waters of the North Sea. Microb. Ecol. 2012, 63, 543–551. [Google Scholar] [CrossRef]
  42. Randa, M.A.; Polz, M.F.; Lim, E. Effects of temperature and salinity on Vibrio vulnificus population dynamics as assessed by quantitative PCR. Appl. Environ. Microbiol. 2004, 70, 5469–5476. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Buruiană, C.T.; Profir, A.G.; Vizireanu, C. Effects of probiotic Bacillus species in aquaculture—An overview. Food Technol. 2014, 38, 9–17. [Google Scholar]
  44. Cha, J.; Rahimnejad, S.; Yang, S.; Kim, K.; Lee, K. Evaluations of Bacillus spp. as dietary additives on growth performance, innate immunity and disease resistance of olive flounder (Paralichthys olivaceus) against Streptococcus iniae and as water additives. Aquaculture 2013, 402, 50–57. [Google Scholar] [CrossRef]
  45. Kuebutornye, F.K.A.; Abarike, E.D.; Lu, Y. A review on the application of Bacillus as probiotics in aquaculture. Fish Shellfish Immunol. 2019, 87, 820–828. [Google Scholar] [CrossRef]
  46. Nayak, S.K. Probiotics and immunity: A fish perspective. Fish Shellfish Immunol. 2010, 29, 2–14. [Google Scholar] [CrossRef]
Metabolites 12 01268 g001 550
Figure 1. Effect of dietary GML supplementation on MDA content (A) and SOD activity (B) of grouper under salinity stress. Data represent means of three tanks in each group; error bar indicates S. D. Values with different letters are significantly different (p < 0.05). “a, b” represents the significance between the same group at different times; “A, B” represents the significance between different groups at the same time period. The same as below. MDA: malondialdehyde; SOD: superoxide dismutase.
Figure 1. Effect of dietary GML supplementation on MDA content (A) and SOD activity (B) of grouper under salinity stress. Data represent means of three tanks in each group; error bar indicates S. D. Values with different letters are significantly different (p < 0.05). “a, b” represents the significance between the same group at different times; “A, B” represents the significance between different groups at the same time period. The same as below. MDA: malondialdehyde; SOD: superoxide dismutase.
Metabolites 12 01268 g001
Metabolites 12 01268 g002 550
Figure 2. Effect of dietary GML supplementation on the expression of CAT (A), SOD (B), and IL6 (C) in grouper under salinity stress. Data represent means of three tanks in each group; error bar indicates S. D. Values with different letters are significantly different (p < 0.05). “a, b, c” represents the significance between the same group at different times; “A, B” represents the significance between different groups at the same time period. CAT: superoxide dismutase; SOD: superoxide dismutase; IL6: interleukin 6.
Figure 2. Effect of dietary GML supplementation on the expression of CAT (A), SOD (B), and IL6 (C) in grouper under salinity stress. Data represent means of three tanks in each group; error bar indicates S. D. Values with different letters are significantly different (p < 0.05). “a, b, c” represents the significance between the same group at different times; “A, B” represents the significance between different groups at the same time period. CAT: superoxide dismutase; SOD: superoxide dismutase; IL6: interleukin 6.
Metabolites 12 01268 g002
Metabolites 12 01268 g003 550
Figure 3. Effect of dietary GML supplementation on the relative abundance of Phylum in grouper intestinal flora under salinity stress. (A), (B), (C), and (D) represent the relative abundance of Phylum level of G0 group and G1800 group at 0 h, 6 h, 12 h, and 24 h, respectively.
Figure 3. Effect of dietary GML supplementation on the relative abundance of Phylum in grouper intestinal flora under salinity stress. (A), (B), (C), and (D) represent the relative abundance of Phylum level of G0 group and G1800 group at 0 h, 6 h, 12 h, and 24 h, respectively.
Metabolites 12 01268 g003
Metabolites 12 01268 g004 550
Figure 4. Effect of dietary GML supplementation on the relative abundance of Genus in grouper intestinal flora under salinity stress. (A), (B), (C), and (D) represent the relative abundance of Genus level of G0 group and G1800 group at 0 h, 6 h, 12 h, and 24 h, respectively.
Figure 4. Effect of dietary GML supplementation on the relative abundance of Genus in grouper intestinal flora under salinity stress. (A), (B), (C), and (D) represent the relative abundance of Genus level of G0 group and G1800 group at 0 h, 6 h, 12 h, and 24 h, respectively.
Metabolites 12 01268 g004
Metabolites 12 01268 g005 550
Figure 5. The effect of adding GML to diet on the indicator species of Photobacterium (A), Vibrio (B), and Bacillus (C) in grouper intestinal flora under salinity stress. Data represent means of three tanks in each group; error bar indicates S. D. Values with different letters are significantly different (p < 0.05). “a, b, c” represents the significance between the same group at different times; “A, B” represents the significance between different groups at the same time period.
Figure 5. The effect of adding GML to diet on the indicator species of Photobacterium (A), Vibrio (B), and Bacillus (C) in grouper intestinal flora under salinity stress. Data represent means of three tanks in each group; error bar indicates S. D. Values with different letters are significantly different (p < 0.05). “a, b, c” represents the significance between the same group at different times; “A, B” represents the significance between different groups at the same time period.
Metabolites 12 01268 g005
Table
Table 1. Ingredients and chemical compositions of experimental diets (% DM basis).
Table 1. Ingredients and chemical compositions of experimental diets (% DM basis).
IngredientsG0G1800
Brown fish meal30.0030.00
Soybean meal18.0018.00
Corn gluten meal9.509.50
Peanut meal10.0010.00
Chicken powder6.006.00
Wheat flour18.5918.59
Fish oil2.002.00
Soybean oil2.002.00
Soybean lecithin1.001.00
Ca(H2PO4)21.001.00
Premix1.001.00
Choline chloride0.500.50
Vitamin C0.050.05
Microcrystalline cellulose0.360.18
GML0.000.18
Total100.00100.00
Nutrient levels
Crude protein49.7449.66
Crude lipid9.429.37
Premix (g/kg premix): vitamin A 675,000 IU, vitamin D3 180,000 IU, vitamin E 6000 mg, vitamin K3 1200 mg, vitamin B1 900 mg, vitamin B2 1350 mg, vitamin B6 1050 mg and vitamin B12 7.5 mg, calcium pantothenate 4500 mg, nicotinic acid 6750 mg, folic acid 375 mg, biotin 15 mg, vitamin C phosphate 42,860 mg, inositol 10,000 mg, FeSO4·H2O 64,286 mg, ZnSO4·H2O 26,283 mg, MnSO4·H2O 19,688 mg, Ca (IO3) 2·H2O 128.6 mg, CoCl2·6H2O 323 mg, CuSO4·5H2O 2357 mg, and Na2SeO3 87.6 mg.
Table
Table 2. Primers pair sequences for real-time qPCR.
Table 2. Primers pair sequences for real-time qPCR.
GenesNucleotide Sequence (5′-3)Genbank Accession No.
β-actinF: GATCTGGCATCACACCTTCT
R: CATCTTCTCCCTGTTGGCTT		AY510710.2
SODF: GTTGGAGACCTGGGAAATGTGACTG
R: CCATTGAGGGTGAGCATCTTGTCC		AY735008.1
CATF:GCTCTATCCGCTCCTCTTCTCCTC
R: GTAGTTCCTGACGACGGTGATGTG		KT884509.1
IL6F: CAATCCCAGCACCTTCCAC
R: CCTGACAGCCAGACTTCCTCT		AFE62919.1
SOD: superoxide dismutase; CAT: catalase; IL6: interleukin 6.
Table
Table 3. Relative abundance values at the phylum level for all groups.
Table 3. Relative abundance values at the phylum level for all groups.
ItmesG0-0G0-1800G6-0G6-1800G12-0G12-1800G24-0G24-1800
Proteobacteria99.07287.60887.83277.37580.99870.04494.66697.028
Firmicutes0.79412.20511.68322.51318.84129.8363.5242.908
Actinobacteria0.0500.1330.0040.0030.0110.0090.0150.011
Bacteroidetes0.0520.0290.4030.0830.1120.0861.7490.027
Cyanobacteria0.0110.0040.0560.0000.0050.0020.0100.000
Others0.0200.0190.0070.0080.0000.0000.0010.000
Unclassified0.0020.0020.0160.0170.0330.0220.0350.026
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Li, X.; Zhu, D.; Mao, M.; Wu, J.; Yang, Q.; Tan, B.; Chi, S. Glycerol Monolaurate Alleviates Oxidative Stress and Intestinal Flora Imbalance Caused by Salinity Changes for Juvenile Grouper. Metabolites 2022, 12, 1268. https://doi.org/10.3390/metabo12121268

AMA Style

Li X, Zhu D, Mao M, Wu J, Yang Q, Tan B, Chi S. Glycerol Monolaurate Alleviates Oxidative Stress and Intestinal Flora Imbalance Caused by Salinity Changes for Juvenile Grouper. Metabolites. 2022; 12(12):1268. https://doi.org/10.3390/metabo12121268

Chicago/Turabian Style

Li, Xuehe, Dongwenjun Zhu, Minling Mao, Jianwei Wu, Qihui Yang, Beiping Tan, and Shuyan Chi. 2022. "Glycerol Monolaurate Alleviates Oxidative Stress and Intestinal Flora Imbalance Caused by Salinity Changes for Juvenile Grouper" Metabolites 12, no. 12: 1268. https://doi.org/10.3390/metabo12121268

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop