Next Article in Journal
Transcriptional Regulation during Aberrant Activation of NF-κB Signalling in Cancer
Previous Article in Journal
Micrandilactone C, a Nortriterpenoid Isolated from Roots of Schisandra chinensis, Ameliorates Huntington’s Disease by Inhibiting Microglial STAT3 Pathways
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 12
Issue 5
10.3390/cells12050787
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Metabolic Disruption of Gold Nanospheres, Nanostars and Nanorods in Human Metastatic Prostate Cancer Cells

by
Sílvia Soares
1,2,3,4,5,6,
Cláudia Pereira
2,3,7,
André P. Sousa
2,3,
Ana Catarina Oliveira
2,3,
Maria Goreti Sales
1,5,8,
Miguel A. Correa-Duarte
9,10,
Susana G. Guerreiro
3,11,12,* and
Rúben Fernandes
2,3,7,*
1
BioMark@ISEP/CEB, Center of Biological Engineering of Minho University, School of Engineering, Polytechnic Institute of Porto, 4249-015 Porto, Portugal
2
FP-I3ID, Universidade Fernando Pessoa (UFP), 4249-004 Porto, Portugal
3
Instituto de Investigação e Inovação em Saúde (i3S), 4200-135 Porto, Portugal
4
Faculty of Chemistry, University of Vigo, 36310 Vigo, Spain
5
CEB—Centre of Biological Engineering of Minho University, 4710-057 Braga, Portugal
6
ICBAS—School of Medicine and Biomedical Sciences, University of Porto, 4050-313 Porto, Portugal
7
Faculty of Health Sciences (FCS) & Hosptal Escola Fernando Pessoa (HEFP), University Fernando Pessoa (UFP), 4249-004 Porto, Portugal
8
Biomark@UC/CEB, Centre of Biological Engineering of Minho University, Department of Chemical Engineering, Faculty of Sciences and Technology, Coimbra University, 3030-790 Coimbra, Portugal
9
CINBIO, University of Vigo, 36310 Vigo, Spain
10
Southern Galicia Institute of Health Research (IISGS), Biomedical Research Networking Center for Mental Health (CIBERSAM), 36310 Madrid, Spain
11
Institute of Molecular Pathology and Immunology of the University of Porto—IPATIMUP, 4200-465 Porto, Portugal
12
Department of Biomedicine, Biochemistry Unit, Faculty of Medicine, University of Porto, 4200-319 Porto, Portugal
 
add Show full affiliation list
 
remove Hide full affiliation list
*
Authors to whom correspondence should be addressed.
Cells 2023, 12(5), 787; https://doi.org/10.3390/cells12050787
Submission received: 13 January 2023 / Revised: 24 February 2023 / Accepted: 27 February 2023 / Published: 2 March 2023
(This article belongs to the Section Cellular Metabolism)
Browse Figures
Review Reports Versions Notes

Abstract

:
Nanomaterials offer a broad spectrum of applications in biomedicine. The shapes of gold nanoparticles could modulate tumor cell behavior. Spherical (AuNPsp), stars (AuNPst) and rods (AuNPr) shapes of polyethylene glycol coated-gold nanoparticles (AuNPs-PEG) were synthesized. Metabolic activity, cellular proliferation, and reactive oxygen species (ROS) were measured and the impact of AuNPs-PEG in metabolic enzymes function was evaluated by RT-qPCR in PC3, DU145, and LNCaP prostate cancer cells. All AuNPs were internalized, and the different morphologies of AuNPs showed to be an essential modulator of metabolic activity. For PC3 and DU145, the metabolic activity of AuNPs was found to rank in the following order from lowest to highest: AuNPsp-PEG, AuNPst-PEG, and AuNPr-PEG. Regarding LNCaP cells, the AuNPst-PEG were less toxic, followed by AuNPsp-PEG and AuNPr-PEG, but it seems not to be dose-dependent. The proliferation was lower in AuNPr-PEG in PC3 and DU145 cells but was stimulated around 10% in most conditions (0.001–0.1 mM) in LNCaP cells (not statistically significant). For 1 mM, LNCaP cells showed a significant decrease in proliferation only for AuNPr-PEG. The outcomes of the current study demonstrated that different AuNPs conformations influence cell behavior, and the correct size and shape must be chosen considering its final application in the field of nanomedicine.

1. Introduction

Nanomaterials have shown great promise in the fight against cancer, due to their unique properties and ability to interact with biological systems at the nanoscale [1]. In recent years, researchers have been exploring the use of nanomaterials in various cancer therapies and diagnostic tools, intending to improve the effectiveness and specificity of these treatments. Different nanoparticles can be used, including organic material (lipids, proteins, or polymers), hybrid (nanofoams) or inorganic material, such as metals or salts—gold, silver, magnetic. Although the use of gold for medical applications has a long history, there is an increasing interest in gold nanoparticles (AuNPs) in bioimaging and therapy of cancer [2]. Gold is the most stable noble metal, biocompatible, and its surface can be easily functionalized with various biomolecules [3,4]. Besides their unique chemical, optical and physical properties, AuNPs are easy to synthesize in different sizes (from 1 to 100 nm) and shapes (spheres, rods, stars, among others). The impact of AuNPs size has been extensively studied in the literature, but little is known about the AuNP shape effect in vitro. The spheres gold nanoparticles (AuNPsp) are the most known in the literature compared to rod gold nanoparticles (AuNPr) and star gold nanoparticles (AuNPst) or other shapes [2,5,6]. AuNPs have size- and shape-dependent physical and chemical properties [7]. In vitro studies have shown that AuNPs influence cellular uptake, cell-crosstalk, cell biodistribution, and optical properties [3,8,9]. However, their mechanism of action remains to be unveiled. Polyethylene glycol (PEG) was used as a surface coat of AuNPs to improve the monodispersity and their biocompatibility, to escape from the immune system surveillance [10].
Nanotechnology has been a trending area in medical applications, such as cancer. Chemotherapy and radiotherapy (RT) are two therapeutic approaches used against tumor cells but exhibited some constraints related to toxicity and treatment resistance [11]. Prostate cancer (PCa) is the most frequently diagnosed non-skin cancer and the leading cause of cancer death in men [12]. Consequently, patients with advanced or metastatic PCa do not have immediate and effective therapeutic interventions, presenting a 5-year survival rate of only 30% [13]. In addition, some patients do not respond to therapy protocols. Therefore, it is crucial further investigate new therapeutic strategies to target PCa.
So, to overcome the lack of knowledge regarding AuNPs in PCa, we used three different shapes of AuNPs-PEG (AuNPsp, AuNPst, and AuNPr) in three metastatic PCa cell lines with different origins (bone, brain, and lymph node). This study will enable us to understand the effects of AuNP shape in terms of their physical and biochemical characteristics in pathological conditions. To our knowledge, this study is the first to evaluate the effect of these three AuNPs in PCa metastatic cell behavior. The results will clarify which nanostructure(s) is the most suitable for metastatic PCa treatment.

2. Materials and Methods

2.1. Materials

Thiol-polyethylene glycol-amine (SH-PEG-NH2), molecular weight 2 kDa, trisodium citrate dehydrate (C6H5O7Na3·2H2O or NaCt), tetrachloroauric acid tetrahydrate (HAuCl4·4H2O, 99.99%), silver nitrate (AgNO4), sodium borohydride (NaBH4), hexadecyltrimethylammonium bromide (CTAB, ≥99%), L-ascorbic acid, ≥99%, fetal bovine serum (FBS), phosphate-buffered saline (PBS), trypsin-EDTA, and Antibiotic antimycotic solution from Sigma Aldrich®® LLC., St. Louis, MO, USA; Roswell Park Memorial Institute (RPMI-1640) and Minimum Essential Medium (MEM) media were purchased from Biowest (Nuaillé, France); cell proliferation ELISA, BrdU kit and PrestoBlue®® Cell Viability Reagent (PB) was obtained from Roche (Indianapolis, IN, USA) and Invitrogen Co. (San Diego, CA, USA) respectively. 2′,7′-Dichlorodihydrofluorescein diacetate (H2DCFDA) was acquired in Biotium (Hayward, CA, USA), QIAzol lysis reagent was purchased in QIAGEN Inc. (Valencia, CA, USA), EasyScript®® Reverse transcriptase in Transgen Biotech Co., LTD. (Beijing, China) and RT-qPCR NZYSpeedy qPCR probe kit in NZYTech (Lisbon, Portugal).

2.2. Synthesis of AuNP

2.2.1. Synthesis of AuNPsp-PEG

AuNPsp were prepared according to Turkevich method and co-workers’ protocol using a HAuCl4·4H2O solution that is reduced and stabilized by trisodium citrate (NaCt) as illustrated in Figure 1A [14].
One hundred mL of 0.5 mM of HAuCl4·4H2O solution was prepared with ultrapure water in a triple-neck round-bottom flask and heated under vigorous stirring at 100 °C. Subsequently, 10 mL of 1% NaCt (w/v) was mixed with HAuCl4·4H2O solution. The solution was maintained for 15 min under heat until the red-wine colour was obtained. After, turn off the temperature and allow the solution to cool. After cooling, 1 mg/mL SH-PEG-NH2 was added to the AuNPsp solution and incubated at 4 °C overnight. Then, AuNPsp-PEG were purified by centrifugation at 4500 rpm for 40 min, and the pellets were resuspended in ultrapure water and stored at 4 °C.

2.2.2. Synthesis of AuNPst-PEG

AuNPst were prepared according to the reported protocol of Tian and colleagues [15] as in Figure 1B. AuNPst were first synthesized using a seed solution obtained by adding 3 mL of 1% NaCt (w/v) to 100 mL of 1.0 mM HAuCL4. Then, 100 µL of seed solution was added to 10 mL of 0.25 mM HAuCl4 at room temperature. Forty µL of 0.01 M AgNO3 and 50 µL of 0.1 M L-ascorbic acid were added. To coat PEG on the AuNPst surfaces, 20 µL of SH-PWG-NH2 was added. The AuNPst-PEG were collated by centrifugation at 5200 rpm and redispersed in water.

2.2.3. Synthesis of AuNPr-PEG

First, AuNPr seeds were prepared by mixing 25 µL of 50 mM HAuCl4 with 4.7 mL of 0.1 M CTAB solution in a water bath at 27–30 °C (Figure 1C). Next, 300 µL of 10 mM NaBH4 solution was added to the previous solution under constant stirring. To synthesize AuNPs, a seed growth solution was prepared based on Scarabelli and co-workers [16]. Ten mL of 100 mM CTAB were incubated with 100 µL of 50 mM HAuCl4 under gentle stirring. Then, 75 µL of 100 mM L-ascorbic acid was added to the mixture for a few seconds. Eighty µL of 5 mM of AgNO3 was added to the growth solution for a few seconds. Finally, 120 µL of seeds solution was added to the previous mixture and left undisturbed at 27 °C for 30 min. To remove the excess solution reagents, AuNPr was centrifugated twice at 7500 rpm for 30 min. The next step was PEGylation by adding 0.2 mM of SH-PEG-NH2 to the AuNPr solution. After stirring for 24 h, the solution was washed twice at 7500 rpm for 30 min.

2.3. Characterization Methods of AuNPs

2.3.1. UV-Visible

The UV-Visible (UV-Vis) absorption spectra of different solutions were measured in a 1 mm quartz cuvette at room temperature using an Evolution 200 Series spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The absorption values were used to determine the concentration of particles in the solution.

2.3.2. Transmission Electron Microscopy

The size and morphology of the samples were investigated using transmission electron microscopy (TEM). Ten µL of each sample was mounted on Formvar/carbon film-coated mesh nickel grids (Electron Microscopy Sciences, Hatfield, PA, USA). For experiments with PEG, prepared samples were contrasted with 10 µL of phosphotungstic acid (PTA) and placed on the grid. After, grids were observed in a JEM 1400 TEM (JOEL Ltd., Tokyo, Japan) with an accelerating voltage of 80 kV. Images were digitally recorded using a CCD digital camera Orious 1100 W Tokyo, Japan, and analysed using ImageJ software to create a size histogram based on representative images obtained.

2.3.3. Scanning Electron Microscope

A scanning electron microscope (SEM) was used to confirm nanoparticle production and examine nanoparticle morphology. Ten µL of samples were deposited onto silicon wafers and left undisturbed until evaporating the solvent at room temperature. SEM images were acquired using a FEI Quanta 400 FEG ESEM/EDAX PEGASUS X4M equipment.

2.3.4. Dynamic Light Scattering and Zeta Potential

Also, nanoparticles’ hydrodynamic diameter and zeta potential were measured by dynamic light scattering (DLS) using a Zeta Sizer Malvern Nano series (Malvern Instruments Ltd., Malvern, UK). All average particle sizes reported here are based on scattered light intensity weighted averages. Five DLS measurements were made for each sample suspension with a fixed run time of 30 s. The scattering/detection angle was set at 173°.

2.4. AuNPs-Cells In Vitro Assays

2.4.1. Cell Culture

The PCa cell lines used in this study were PC3 (ATCC®® CRL-1435™), LNCaP (ATCC®® CRL-1740™), and DU145 (ATCC®® HTB-81™) cells. PC3 and LNCaP cells used RPMI-1640 medium, and DU145 cells used MEM medium. Culture media were supplemented with 10% FBS and 1% penicillin/streptomycin [17,18,19]. Cells were maintained in culture at 37 °C with 5% CO2. For these experiments, cells were used between 8 and 15 passages.
Cell lines were cultured and grown to ~80% confluence and sub-cultured for different assays. Cells (1 × 105 cells/well) were cultured in 96-well plates (VWR) for 24 h. Then, cells were washed with PBS and treated with AuNPs for 24 h at 37 °C with 5% CO2 in a humidified environment. Different concentrations of AuNPsp, AuNPst and AuNPr ranging from 0 to 1 mM were prepared in serum-free conditions.

2.4.2. Qualitative Analysis of the Cellular Uptake of AuNPs

To evaluate the cellular uptake of different concentrations of AuNPs using TEM images and flow cytometry. Cells were treated with different AuNPs solutions and incubated for 24 h. Then, the cells were washed, trypsinized and resuspended in TEM fix solution (2.5% glutaraldehyde and 2% paraformaldehyde in 0.1 M sodium cacodylate) for three days. After, the fix solution was removed, and cells were washed in 0.1 M sodium cacodylate buffer. Next, a post-fix solution (2% osmium tetroxide in 0.1 M sodium cacodylate) was added to the samples. After 2 h, the samples were washed and centrifuged three times in water. Then, they were incubated with 1% Uranyl acetate for 30 min. The pellet was then included in HistogelTM (Thermo Fisher Scientific, Waltham, MA, USA, HG-4000-012). Finally, the samples were dehydrated in a graded series of ethanol solutions (50%, 70%, 80%, and 100%) and treated with propylene oxide (3×). Ultrathin sections of the samples were cut and observed with a JEM 1400 TEM (JOEL Ltd., Tokyo, Japan) with a CCD digital camera Orious 1100 W Tokyo, Japan. Then, the intracellular location of the AuNPs was analysed.
Regarding flow cytometry, cells (1 × 106) were plated in 6-well and treated with each AuNPs solutions. The next day, the solution was removed, the cells were washed, and then the cells were collected using trypsin. Cells were examined using ATTUNE flow cytometer (Thermo Fisher Scientific, Waltham, MA, USA).

2.4.3. Cellular Viability

Viable cells can metabolize resazurin into resofurin on mitochondria [20]. Cells were incubated with AuNP treatments for 24 h. Afterwards, 10 µL of resazurin was added directly into 90 µL of culture medium. Upon incubation for 1 h at 37 °C, 100 μL/well was transferred to a new 96-well plate. The absorbance was measured using a Spectra Max Gemini XS (Molecular Devices, San Jose, CA, USA) at excitation and emission wavelengths of 550 and 600 nm, respectively.

2.4.4. Cellular Proliferation

After 24 h of treatment, the cells were incubated with BrdU solution at a fifinal concentration of 100 µM for 2 h. The cell proliferation assay was performed according to the manufacturer’s instructions [21]. The results were expressed as a percentage of control (100%) and tested in duplicates on two independent experiments.

2.4.5. Reactive Oxygen Species (ROS)

Molecular probe 2′,7′-Dichlorodihydrofluorescein diacetate (H2DCFDA) assay was dissolved in dimethyl sulfoxide (DMSO) at 10 mM stock solution. After plating cells, adherent cells were washed with buffer and stained with a 10 µM probe for 45 min at 37 °C in the dark. Next, cells were rewashed and were treated with AuNPs for 24 h. Cells were then analysed on a fluorescence plate reader (SpectraMax®® Gemini™ EM Microplate Reader, Molecular Devices, San Jose, CA, USA) at excitation/emission of 504/529 nm in endpoint mode.

2.4.6. RNA Isolation and Gene Expression

Cells (4–8 × 105 cells/well) were seeded in 6-well culture plates and grown overnight. Then, cells were treated with different concentrations of 0.1 mM of AuNPs for 24 h. Total RNA was isolated from different types of samples followed QIAzol (Qiagen, Crawley, UK). The amount of DNA and RNA was determined using a Thermo Scientific™ Multiskan SkyHigh Microplate spectrophotometer (Life Technologies Fisher Scientific, Waltham, MA, USA). The ratio of absorbance at 260 nm and 280 nm was used to assess the purity of DNA and RNA. RNA was reversely transcribed using EasyScript®® Reverse transcriptase (Transgen biotech, Beijing, China) and following manufacturer recommendations. RNA was subjected to RT-qPCR (NZYSpeedy qPCR probe kit, NZYTech, Lisbon, Portugal) using primer sets specific to hexokinase-2 (HK2), glucose-6-phosphatase (G6Pase), pyruvate kinase (PKM), pyruvate carboxylase (PCX), acyl-CoA dehydrogenase (ACADS) and mitochondrial fission 1 protein (FIS1, Table 1).
Threshold cycle (CT) values from each sample were plotted with two experimental replicates following the manufacturer’s procedure. The melting curve analysis was used to monitor the specificity of primers and probes. The expression level of each gene was normalized to the expression of the GAPDH housekeeping gene, and gene relative expression was employed by the ΔCT expression/ΔCT control ratio.

2.5. Statistical Analysis

All data are presented in mean ± standard deviation (SD) of experiments repeated at least three times. Data were analysed through Prism 8.0 (GraphPad Software, Boston, CA, USA). Differences between treatments were evaluated by two-way ANOVA with Sidak multiple comparisons test, according to the number of conditions and treatments. Results were considered significant when p < 0.05.

3. Results

3.1. Characterization of Different Shapes of AuNP

AuNPs with different conformations (AuNPsp, AuNPst, AuNPr) were used to compare their chemical, physical and biological effects. All AuNP conformations were functionalized with PEG to improve cellular uptake and overcome the immune system as described in the literature. AuNPs exhibited different surface plasmon resonance (SPR) bands in UV–Vis absorption spectra over 400–1000 nm, as shown in Figure 2D–F.
AuNPs’ size and shape were observed by TEM and SEM analyses, respectively—Figure 2G–L. The average size for AuNPsp-PEG was 18.4 ± 2.1 nm, and a SPR peak was about ~522.3 nm. For AuNPst-PEG, the average size was 80.7 ± 18.9 nm, and a broad plasmon band mainly ranging from 480 nm to 1000 nm with a maximum at ~906.3 nm was observed. AuNPr-PEG were synthesized using the seed-mediated method to obtain 45.4 ± 4.5 nm × 11.6 ± 1.2 nm (length × width) by TEM (with an aspect ratio of around 3.9:1) and exhibit a dominant longitudinal SPR peak of ~763.6 nm and a minor transverse peak at ~513.6 nm. From the UV-Vis spectra, TEM, and SEM images, AuNPsp-PEG, AuNPst-PEG, and AuNPr -PEG had spherical, star and rod structures matching their designs. Finally, a histogram size was created using TEM images where over 50 particles were counted—Figure 2M–O.
From DLS (Table 2), the average size for AuNPsp-PEG was about 47.31 ± 0.46 nm, AuNPst-PEG was 109.61 ± 1.27 nm, and AuNPr -PEG was 54.58 ± 0.34 nm.
These AuNPs hydrodynamic size values were different from the ones obtained in TEM analysis, because on DLS the PEG chains layer was hydrated on the surface of nanoparticles [22]. According to the polydispersity index (PDI) of AuNPs, the AuNPst-PEG exhibited more monodispersity than AuNPsp-PEG and AuNPr-PEG. In addition, the zeta potential measurement demonstrated that AuNPs were successfully conjugated with PEG and all nanostructures were positively charged. AuNPsp-PEG, AuNPst-PEG, and AuNPr-PEG indicated a zeta potential of 6.7 ± 7.9, 33.1 ± 12.0, and 11.0 ± 18.9 mV, respectively.

3.2. Qualitative Analysis of the Cellular Uptake of AuNPs-PEG

Cellular uptake of AuNPs-PEG involves highly regulated mechanisms with biomolecular interactions: shape, size, and capping dependents [23]. Also, AuNPs have multiple different cellular entry routes to cross the cell plasma membrane, including passive translocation across the cell membrane or through active endocytosis [23,24,25]. In the present study, cells were treated for 24 h with different structures of AuNPs at a concentration of 0.01 mM prior to TEM analysis to investigate cellular internalization. We performed a qualitative analysis of the cellular uptake of AuNPs using TEM images, and they revealed numerous high electron density-staining particles inside the cells incubated with AuNPs (Figure 3). AuNPs-PEG were not found in control groups (Figure 3A–C), whilst an interesting morphological phenomenon was found in treated groups.
The three metastatic cell lines internalized the AuNPsp-PEG, AuNPst-PEG and AuNPr-PEG. TEM images showed AuNPs clusters distributed across the cytoplasm. Most AuNPs-PEG are trapped inside the endosome’s vesicles, most of which are in the proximity of mitochondria and the endoplasmic reticulum. The cell nuclei do not seem to be affected by AuNPs-PEG. TEM data demonstrated the cellular uptake of AuNPs in the three cell lines. Qualitatively, AuNPst-PEG appears to be more extensively accumulated than AuNPsp-PEG and AuNPr-PEG.
Another complementary analysis was performed by flow cytometry using the forward-scattered light (FSC), proportional to the cell size and the side-scattered light (SSC) related to cell’s internal complexity. Results showed that after 24 h of incubation with AuNPs-PEG (Figure 4), the uptake was higher in case of AuNPsp-PEG following AuNPst-PEG and AuNPr-PEG in all cell lines.
However, for DU145 cells, only some minor changes were found in AuNPsp-PEG and AuNPst-PEG. For LNCaP, modifications on complexity were identified only for AuNPsp-PEG.

3.3. AuNPs Decrease Prostate Cancer Cells Viability

A broad spectrum of particle concentrations was tested to investigate the biological effect of AuNPs-PEG on cell viability of metastatic PCa cell lines—Figure 5A–C [26,27,28].
After 24 h treatments, all metastatic cell lines showed a reduction of cell viability compared to the control (cells without AuNP treatment). The results demonstrated that the cellular viability is independent of AuNPs concentration. PC3 and DU145 cells viability was between 50–100% compared to control upon treatment with 0.001 to 1 mM of AuNPsp-PEG or AuNPst-PEG. When treated with 0.001 to 0.1 mM of AuNPr-PEG, PC3 and DU145 cells viability was 70–80%. However, 1 mM AuNPr-PEG treatment revealed a higher decrease in cellular viability on PC3 and DU145 cell lines (52.5% and 52.9%, respectively for PC3 and DU145, p < 0.05). In the case of LNCaP, all treatments of AuNPs-PEG with different concentrations decreased the cellular viability.

3.4. AuNPs Modulate Prostate Cancer Cell Proliferation

The cellular proliferation was performed using the BrdU cell assay—Figure 5D–F. When PC3 and Du145 cells were treated with 0.001–0.1 mM AuNPs-PEG concentrations of each shape, cell proliferation rate decreased compared to controls. Contrariwise, on LNCaP cells, the same treatments of AuNPs-PEG did not reveal a statistically significant difference in cell proliferation after 1 mM of AuNPr-PEG treatment (p < 0.001).

3.5. Cellular Internalization of AuNPs

TEM analysis has shown that all shapes of AuNPs-PEG can be internalized by PC3, DU145 and LNCaP cells and created ultrastructure changes. An increase in vacuolization and numerous autophagic vacuoles in the three cell lines were observed by TEM (Figure 3).

3.6. Intracellular ROS Levels Depend on AuNPs-PEG Shape Treatment

Cells were treated with 0.1 mM of different shapes of AuNPs-PEG for 24 h, and then ROS levels were observed (Figure 6).
AuNPsp-PEG decrease ROS levels when compared to control group in PC3 and DU145 cells. Remarkably, treatment with 0.1 mM of AuNPr-PEG only decreased ROS levels on DU145 cells. In LNCaP cells, the treatments did not alter the ROS levels when compared to the control group (p > 0.05).

3.7. AuNPs-PEG Shape Affects Mitochondria Biogenesis and Metabolic Function

Changes in metabolic function can contribute to the growth and progression of PCa. Understanding these changes in metabolic function may provide new targets for the development of PCa therapies. So, the impact of different AuNPs-PEG in the expression of enzymes involved in metabolic pathways, such as HK2, G6Pase, PKM, PCX, and ACADS was evaluated (Figure 7 and Figure 8).
Besides, mitochondria are highly dynamic organelles in cancer biology and are a crucial player on the altered cancer energy metabolism. To investigate the effect of AuNPs-PEG treatment on cancer cell energy metabolism, FIS1 mRNA levels, a critical checkpoint for mitochondria division involved in the genetic regulation of several metabolic pathways, such us, glycolysis, gluconeogenesis, and beta-oxidation was determined (Figure 7 and Figure 8).
PC3 cells treated with AuNPsp-PEG and AuNPr-PEG presented an increase of mRNA expression of HK2 and a decrease of PKM, involved in the first and the last step of glycolysis, respectively. On the other hand, DU145 cells and LNCaP cells did not have statistically significant differences in these transcripts. Gluconeogenesis is another metabolic pathway that fully occurs in hepatocytes. All three cell lines express PCX and G5Pase mRNA, encoding the first and final gluconeogenesis step. PC3 cells treated with AuNPsp-PEG and AuNPr-PEG presented increased mRNA expression of these two mRNA enzymes. DU145 and LNCaP cells did not have statistically significant differences in gluconeogenesis mRNA expression genes upon ant treatment.
Fatty acids and glucose can be used by the cells as energy sources through beta-oxidation and glycolysis pathways, respectively, resulting in acetyl-CoA. If acetyl-CoA increases, FIS1 ubiquitination can occur, decreasing mitochondria fission. On PC3 cells treated with AuNPsp-PEG and AuNPr-PEG, an increase of ACADS and FIS1 mRNA expression was determined. DU145 cells did not show statistically significant differences regarding enzymes expression for any treatment. However, a tendency to increased FIS1 was observed after AuNPr-PEG treatment. AuNPsp-PEG and AuNPst-PEG treatment increased the expression of ACADS mRNA in LNCAPs. No statistically significant differences were observed for FIS1 gene expression.

4. Discussion

Distinct methods were used to characterize the mean size of AuNPs-PEG, like TEM and DLS. The shape of AuNPs were confirmed by UV-Vis spectra, TEM and SEM image analysis. Considering particle size, data obtained from DLS measurement are usually bigger than those obtained from TEM due to the presence of the PEG chain and the layer hydration around the AuNPs solution [29,30]. Our synthesis process is in accordance with the literature, by the applied synthesis methods [14,15,16]. In our case, it was possible to characterize the three AuNPs-PEG with DLS. Still, by applying other techniques, such as depolarized dynamic light scattering (DDLS), it is possible to obtain results for specific anisotropic nanoparticles more similar to TEM results [31]. Regarding AuNPr-PEG, DLS measurements can provide a reasonably hydrodynamic diameter, which can be related to the length of AuNPr-PEG [32].
Regarding the shape, AuNPsp-PEG presented only one peak, AuNPr-PEG showed two peaks, and AuNPst-PEG exhibited a broad absorption band, which can be derived from the high density of surface spikes [22]. So, UV-vis showed different absorption patterns depending on the geometries, which agrees with the literature [26,33]. Additionally, the different morphologies were confirmed by TEM and SEM images. The validation of AuNPs-PEG was confirmed by positive values in zeta potential, increasing the stability of nanostructures, mainly AuNPst-PEG. The surface of AuNPs can be modified with several materials. Still, PEG is one of the biocompatible polymers most used in biomedicine because it improves the stability, internalization, and absorption of the AuNPs inside the cell. Besides, PEG contributes to reduced immunogenicity and elimination by clearance of AuNPs, increasing their circulation time in blood [28,34]. Also, PEG reduced the toxicity of AuNPs and improved their accumulation in tumor cells via the enhanced permeability and retention (EPR) effect [35,36,37]. Furthermore, Fytianos, et al. demonstrated that the cellular uptake of AuNPs modified with PEG-NH2 was higher than other functionalized surfaces, such as carboxylic acid—PEG-COOH [38].
Only a few publications analyzed the shape of AuNPs-PEG as an essential modulator of cytotoxicity, although extensive knowledge about AuNP’s cytotoxicity has been gathered. Our study allows evaluating at the same time different shapes of AuNPs-PEG using a concentration range to treat three metastatic cell lines of PCa [39]. These cell lines, PC3, DU145 and LNCaP, originated from different metastases of PCa, bone, brain, and supraclavicular lymph node, respectively [40]. Also, the LNCaP cell line is responsive to androgen and produces prostate-specific antigens (PSA). DU145 and PC3 cell lines are androgen-independent and have moderate and high metastatic potential, respectively [41,42,43]. Thus, analyzing different cell lines with other features, such as aggressiveness and hormonal dependence, provide a holistic overview of a wide range of PCa [42].
The uptake of different conformations of AuNPs-PEG by these three cell lines was analysed. Cells were treated with 0.01 mM AuNPs-PEG for 24 h. TEM findings revealed that all shapes of AuNPs-PEG suffered endocytosis in PC3, DU145, and LNCaP cells. We confirmed that AuNPs-PEG might be internalized by endosomes and vesicular bodies into PCa cells, as previously described [33,44,45].
AuNPst-PEG is the more captured nanoparticles by cells, appearing in clusters in all cell lines studied. They were detected in vesicles after 24 h of incubation. Remarkably, AuNPsp-PEG and AuNPr-PEG were found in sections after 24 h of incubation in all cell lines, but in less amount than AuNPst-PEG. It was demonstrated that citrate AuNPsp has a better internalization capacity when compared with AuNPr stabilized by citric acid ligands because AuNPsp has less contact area with cell membrane receptors, increasing the number of NPs that can be internalized in Hela cells [9]. Similarly, Lee and co-workers compared chitosan-capped AuNPsp, AuNPst, and AuNPr synthesized using green tea extract and concluded that AuNPsp exhibited the fastest internalization rate than other shapes (AuNPsp > AuNPr > AuNPst) and lower toxicity in human hepatocyte carcinoma cells HepG2 [8]. However, to better understand the shape effect of the AuNPs on cell interaction, more studies should be developed to contribute to more efficient therapeutic nanosystems, reducing the therapeutic resistance related to conventional treatments.
In addition, our results showed a tendency to decrease the metabolic activity with increased concentration in AuNPsp-PEG, AuNPst-PEG, and AuNPr-PEG. Also, AuNPr-PEG showed a more significant decrease in metabolic activity than AuNPsp-PEG and AuNPst-PEG. The results are comparable to other outcomes of cytotoxicity in a similar range of concentrations, and the 0.1 mM concentration seems to be the safe dose of AuNPs-PEG [46,47]. LNCaP cells were not so sensitive, slightly reducing the viability and enhancing cell proliferation at the highest concentration compared to the other cell lines. This result can be due to their low growth rate observed by us and others [18]. In general, this study demonstrated that distinct morphologies have different cellular metabolic effects that can be caused by two factors—size or shape. Besides that, the results also suggest that AuNPs-PEG influence mitochondria functioning because using PrestoBlue®® assay showed their cytotoxicity.
Moreover, it is known that cell cytotoxicity of AuNPs depends on the concentration used and the duration of the treatment [33]. Our findings indicated that cells respond in different manners to AuNPs treatment.
Additionally, TEM images exhibited a loss of integrity of cellular membranes and morphological differences of mitochondria, showing a higher number of mitochondria and more condensed ones. Moreover, disruption of the cell membrane, oxidative stress, cytoskeleton destruction, autophagy, and lysosomal dysfunction are essential functions and potential explanations for the cytotoxicity of AuNPs [8]. More studies should be done to analyze the detailed mechanisms of the cytotoxicity effect. Ultimately, the decreased metabolic activity is likely related to the harmful effect of aggregates, as suggested by Connor et al. [48].
Based on the literature and as we mentioned before, metabolic activity can be influenced by several factors that difficult the comparison between studies, such as shape, size, physicochemical surface properties, concentration, exposure time, cell type, experimental design and implementation, and analytical methods, because of variety of bioapplication of AuNPs [43,49]. According to our knowledge, it is the first study comparing the cytotoxicity of different morphologies of AuNPs-PEG in three distinct metastatic PCa cell lines. Nevertheless, Favi et al. showed that AuNPsp (61.46 ± 4.28 nm) were more cytotoxic than AuNPst (33.69 ± 8.45 nm) in human skin fibroblasts and fat rat pad endothelial cells (RFPECs) [50]. Also, another study compared AuNPsp (~61.06 nm), and AuNPr (534 nm × 65 nm) negatively charged and concluded that AuNPsp presented more significant toxicity than AuNPr in fibroblast cells [51]. Tarantola and co-workers showed that AuNPsp (43 ± 4 nm) was more cytotoxic than AuNPr (38 ± 7 nm × 17 ± 3 nm) with identical surface functionalization with CTAB in MDCK II cells, and the authors related the cytotoxicity to a higher release of toxic CTAB upon intracellular aggregation [45]. Woźniak et al. compared different AuNPs size and shapes (AuNPsp, ~10 nm, nanoflowers, ~370 nm, AuNPr, ~41 nm, nanoprisms, ~160 nm, and AuNPst, ~240 nm) in both HeLa and human embryonic kidney cells (HEK293T) cell lines and showed that AuNPsp and AuNPr were more cytotoxic than nanoflowers, nanoprisms, and AuNPst [33]. One more time, the authors suggested that the tiny size of AuNPs and the aggregation process can influence the cytotoxicity of AuNPsp and AuNPr. More recently, Steckiewicz et al. compared the cytotoxicity of AuNPr (~39 nm × 18 nm), AuNst (~215 nm), and AuNPsp (~6.3 nm) in human fetal osteoblast (hFOB 1.19), osteosarcoma (143B, MG63) and pancreatic duct cell (hTERT-HPNE) lines. They showed that the cytotoxicity of AuNPs was shape-dependent, and AuNPst were the most cytotoxic against human cells, followed by AuNPr and AuNPsp [44].
Besides the biosafety and toxicity of AuNPs, there is a gap regarding the molecular mechanisms and factors that influence nanomaterial toxicity. Researchers have found that AuNPs could affect the expression of intracellular metabolites and consequently change the expression of the functional genome, transcriptome, and proteome [52,53,54]. Thus, metabolic reprogramming of tumor cells has emerged as a new therapeutic strategy. After the Warburg effect, where oxidative phosphorylation in proliferative cells was switched to glycolysis even in aerobic conditions, the metabolic changes in tumor cells began to be explored [55]. The sensitivity of tumor cells reveals different sensitivities to various molecules related to gluconeogenesis, glycolysis, or fatty acid synthesis pathway [56]. Although some studies explored the effect of AuNPs on tumor cell metabolism, is still a lot to uncover [57,58,59].
PC3 cells treated with AuNPsp-PEG and AuNPr-PEG presented increased gene expression involved in cell replication (Figure 7 and Figure 8). AuNPst-PEG triggers a global reduction in cellular metabolism and activity. DU145 cells treated with AuNPsp-PEG and AuNPst-PEG inactivate the whole central cell metabolism, as reflected in the decrease in cell viability, glycolytic pathways, oxidation of fatty acids and mitochondrial replication. Cells treated with AuNPr-PEG also showed increased mRNA expression of most enzymes implicated in energy metabolism. In LNCaP cells, AuNPsp-PEG prompted the reduction of gluconeogenesis enzymes and glycolytic enzyme HK2. However, there is an increased expression of beta-oxidation ACADS enzyme and an increase in PKM expression, resulting in increased acetyl-CoA concentrations that enter the TCA cycle. There was also a reduction in FIS1 mRNA, implying mitochondrial metabolic activity reduction. Treatment with AuNPst-PEG resulted in the upregulation of enzymes involved in glycolysis, beta-oxidation, and gluconeogenesis, suggesting the induction of energy metabolism and anabolic pathways required for proliferative cell activity. Furthermore, treatment with AuNPr-PEG led to FIS1 gene downregulation. Given that FIS1 is involved in mitochondrial replication, these findings led to the assumption that AuNPr-PEG induces cell metabolism inactivation. Additionally, AuNPr-PEG presented a slight stimulation of the first step of glycolysis and an inhibition of beta-oxidation. In general, AuNPsp-PEG and AuNPr-PEG tend to increase the expression of enzymes involved in glycolysis, such as HK2 and PKM in PC3 and LNCaP cells, suggesting they play a role in supporting cancer cell survival. Also, AuNPs slightly increased G6Pase in the PC3 cell line. It can be hypothesized that AuNPs may promote NADPH production, which plays a role in reductive synthesis (e.g., lipogenesis and cholesterol) and is a key regulator of the antioxidant defense. Overall, the effect of AuNPs on the expression of metabolic enzymes is complex and context dependent. While AuNPs may disrupt the energy production and biosynthesis pathways in cancer cells, they may also promote the production of NADPH and support cancer cells’ survival. Further studies are needed to fully understand the mechanisms behind the effects of AuNPs on metabolic enzymes and their potential implications for cancer therapy.

5. Conclusions

Clinical development of treatments or therapeutic agents is essential to support an optimal management strategy for this challenging disease, the PCa.
Until now, this was the first study to compare the cytotoxicity of different morphologies of AuNPs and to evaluate the effect of different AuNPs-PEG on cellular metabolic enzyme levels in three distinct metastatic PCa cell lines. The analysis of cellular metabolism should be considered to ensure safety is preserved whenever AuNPs are applied in the clinic. This study demonstrated that distinct morphologies of AuNPs influenced the metabolic activity in these three cell lines evaluated, being a potential modulator of cell viability, proliferation, and metabolic enzymes. Also, our study showed that AuNPs are concentration-dependent and cell-type-dependent. For PC3 and DU145, AuNPsp-PEG were less toxic, followed by AuNPst-PEG and AuNPr-PEG. We observed that for LNCaP cells, the AuNPst-PEG were the less toxic, followed by AuNPr-PEG and AuNPsp-PEG. In general, the AuNPr seem to be dose-dependent and the most efficient shape to destroy these two types of tumour cells with statistically significant results. Additional studies must be performed to properly quantify the cellular uptake efficiency of AuNPs and understand the effect of size and shape singly. After evaluating the effect of AuNPs on cell metabolism, AuNPsp showed opposite results between PC3 and DU145. We believe that the surface markers activated in each cell line differ due to the different membrane compositions.
Regarding the effect of AuNPst-PEG and AuNPr-PEG, they seem to cause similar responses in more aggressive lines (PC3 and DU145) and to inactivate cell metabolism in more sensitive lines, such as LNCaP. So, this diverse response observed may be related to the different cell line characteristics, namely expressed markers on the membrane, and androgen receptor dependence, among others. However, more studies should be done to understand the mechanisms behind these differences.

Author Contributions

Conceptualization, S.S., S.G.G. and R.F.; Methodology, S.S., A.P.S., A.C.O. and S.G.G.; Software, S.S., A.P.S., A.C.O. and S.G.G.; Investigation, S.S., A.P.S., A.C.O., S.G.G. and R.F.; Interpretation, S.S., A.P.S., S.G.G. and R.F. Writing, original and final draft—S.S.; writing—review and editing, S.S., S.G.G., C.P., M.G.S., M.A.C.-D. and R.F.; Visualization, S.S., S.G.G. and R.F.; Supervision, S.S., S.G.G., M.G.S., M.A.C.-D. and R.F.; Funding, C.P. All authors have read and agreed to the published version of the manuscript.

Funding

The author is grateful for the financial support of Foundation for Science and Technology (FCT) through project reference—2022.09032.PTDC and also to FCT through COMPETE to the project NORTE-01-0145-FEDER-024325.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data supporting this study’s findings are available within the article or from the corresponding authors upon reasonable request.

Acknowledgments

We gratefully acknowledge Cancer Biology and Epigenetics Group—Research Centre (Portuguese Oncology Institute of Porto—Porto, Portugal) for kindly providing the human prostate cell lines (PC3, DU145 and LNCaP). SS is grateful for the financial support of the Foundation for Science and Technology (grant reference: SFRH/BD/138271/2018).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Khalid, K.; Tan, X.; Mohd Zaid, H.F.; Tao, Y.; Lye Chew, C.; Chu, D.-T.; Lam, M.K.; Ho, Y.-C.; Lim, J.W.; Chin Wei, L. Advanced in developmental organic and inorganic nanomaterial: A review. Bioengineered 2020, 11, 328–355. [Google Scholar] [CrossRef] [Green Version]
  2. Singh, P.; Pandit, S.; Mokkapati, V.; Garg, A.; Ravikumar, V.; Mijakovic, I. Gold Nanoparticles in Diagnostics and Therapeutics for Human Cancer. Int. J. Mol. Sci. 2018, 19, 1979. [Google Scholar] [CrossRef] [PubMed]
  3. Artiga, Á.; Serrano-Sevilla, I.; Matteis, L.D.; Mitchell, S.G.; Fuente, J.M.d.l. Current status and future perspectives of gold nanoparticle vectors for siRNA delivery. J. Mater. Chem. B 2019, 7, 876–896. [Google Scholar] [CrossRef]
  4. Hu, X.; Zhang, Y.; Ding, T.; Liu, J.; Zhao, H. Multifunctional Gold Nanoparticles: A Novel Nanomaterial for Various Medical Applications and Biological Activities. Front. Bioeng. Biotechnol. 2020, 8, 990. [Google Scholar] [CrossRef] [PubMed]
  5. Kawamura, G.; Nogami, M.; Matsuda, A. Shape-controlled metal nanoparticles and their assemblies with optical functionalities. J. Nanomater. 2013, 2013, 2. [Google Scholar] [CrossRef] [Green Version]
  6. Grzelczak, M.; Perez-Juste, J.; Mulvaney, P.; Liz-Marzan, L.M. Shape control in gold nanoparticle synthesis. Chem. Soc. Rev. 2008, 37, 1783–1791. [Google Scholar] [CrossRef] [PubMed]
  7. Langille, M.R.; Personick, M.L.; Zhang, J.; Mirkin, C.A. Defining Rules for the Shape Evolution of Gold Nanoparticles. J. Am. Chem. Soc. 2012, 134, 14542–14554. [Google Scholar] [CrossRef] [PubMed]
  8. Lee, Y.J.; Ahn, E.-Y.; Park, Y. Shape-dependent cytotoxicity and cellular uptake of gold nanoparticles synthesized using green tea extract. Nanoscale Res. Lett. 2019, 14, 129. [Google Scholar] [CrossRef] [Green Version]
  9. Chithrani, B.D.; Ghazani, A.A.; Chan, W.C. Determining the size and shape dependence of gold nanoparticle uptake into mammalian cells. Nano Lett. 2006, 6, 662–668. [Google Scholar] [CrossRef]
  10. Guerrini, L.; Alvarez-Puebla, R.A.; Pazos-Perez, N. Surface Modifications of Nanoparticles for Stability in Biological Fluids. Mater. 2018, 11, 1154. [Google Scholar] [CrossRef] [Green Version]
  11. Nakazawa, M.; Paller, C.; Kyprianou, N. Mechanisms of Therapeutic Resistance in Prostate Cancer. Curr. Oncol. Rep. 2017, 19, 13. [Google Scholar] [CrossRef] [Green Version]
  12. Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
  13. Powers, E.; Karachaliou, G.S.; Kao, C.; Harrison, M.R.; Hoimes, C.J.; George, D.J.; Armstrong, A.J.; Zhang, T. Novel therapies are changing treatment paradigms in metastatic prostate cancer. J. Hematol. Oncol. 2020, 13, 144. [Google Scholar] [CrossRef]
  14. Turkevich, J.; Stevenson, P.C.; Hillier, J. A study of the nucleation and growth processes in the synthesis of colloidal gold. Discuss. Faraday Soc. 1951, 11, 55–75. [Google Scholar] [CrossRef]
  15. Tian, Y.; Luo, S.; Yan, H.; Teng, Z.; Pan, Y.; Zeng, L.; Wu, J.; Li, Y.; Liu, Y.; Wang, S.; et al. Gold nanostars functionalized with amine-terminated PEG for X-ray/CT imaging and photothermal therapy. J. Mater. Chem. B 2015, 3, 4330–4337. [Google Scholar] [CrossRef]
  16. Scarabelli, L.; Sánchez-Iglesias, A.; Pérez-Juste, J.; Liz-Marzán, L.M. A “Tips and Tricks” Practical Guide to the Synthesis of Gold Nanorods. J. Phys. Chem. Lett. 2015, 6, 4270–4279. [Google Scholar] [CrossRef] [Green Version]
  17. ATCC. PC-3—CRL-1435|ATCC. 2022. Available online: https://www.atcc.org/products/crl-1435 (accessed on 11 January 2023).
  18. ATCC. A.T.C.C. LNCaP Clone FGC, ATCC® CRL-1740. Available online: https://www.atcc.org/products/crl-1740 (accessed on 11 January 2023).
  19. ATCC. DU 145—HTB-81|ATCC. 2022. Available online: https://www.atcc.org/products/htb-81 (accessed on 11 January 2023).
  20. Lall, N.; Henley-Smith, C.J.; De Canha, M.N.; Oosthuizen, C.B.; Berrington, D. Viability Reagent, PrestoBlue, in Comparison with Other Available Reagents, Utilized in Cytotoxicity and Antimicrobial Assays. Int. J. Microbiol. 2013, 2013, 420601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Sigma-Aldrich. Cell Proliferation ELISA BrdU (Colorimetric) Roche. Available online: http://www.sigmaaldrich.com/ (accessed on 11 January 2023).
  22. Ma, N.; Wu, F.-G.; Zhang, X.; Jiang, Y.-W.; Jia, H.-R.; Wang, H.-Y.; Li, Y.-H.; Liu, P.; Gu, N.; Chen, Z. Shape-Dependent Radiosensitization Effect of Gold Nanostructures in Cancer Radiotherapy: Comparison of Gold Nanoparticles, Nanospikes, and Nanorods. ACS Appl. Mater. Interfaces 2017, 9, 13037–13048. [Google Scholar] [CrossRef] [PubMed]
  23. Malugin, A.; Ghandehari, H. Cellular uptake and toxicity of gold nanoparticles in prostate cancer cells: A comparative study of rods and spheres. J. Appl. Toxicol. 2010, 30, 212–217. [Google Scholar] [CrossRef] [PubMed]
  24. Enea, M.; Pereira, E.; Costa, J.; Soares, M.E.; Dias da Silva, D.; Bastos, M.d.L.; Carmo, H.F. Cellular uptake and toxicity of gold nanoparticles on two distinct hepatic cell models. Toxicol. Vitr. 2021, 70, 105046. [Google Scholar] [CrossRef]
  25. Donahue, N.D.; Acar, H.; Wilhelm, S. Concepts of nanoparticle cellular uptake, intracellular trafficking, and kinetics in nanomedicine. Adv. Drug Deliv. Rev. 2019, 143, 68–96. [Google Scholar] [CrossRef] [PubMed]
  26. Amendola, V.; Meneghetti, M. Size Evaluation of Gold Nanoparticles by UV−vis Spectroscopy. J. Phys. Chem. C 2009, 113, 4277–4285. [Google Scholar] [CrossRef]
  27. Shard, A.G.; Wright, L.; Minelli, C. Robust and accurate measurements of gold nanoparticle concentrations using UV-visible spectrophotometry. Biointerphases 2018, 13, 061002. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Fang, C.; Zhang, M. Nanoparticle-based theragnostics: Integrating diagnostic and therapeutic potentials in nanomedicine. J. Control. Release 2010, 146, 2–5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Rahman, A.; Rahman, A.; Ghann, W.; Kang, H.-G.; Uddin, J. Terahertz multispectral imaging for the analysis of gold nanoparticles’ size and the number of unit cells in comparison with other techniques. Int. J. Biosens. Bioelectron. 2018, 4, 159–164. [Google Scholar] [CrossRef] [Green Version]
  30. Eaton, P.; Quaresma, P.; Soares, C.; Neves, C.; de Almeida, M.P.; Pereira, E.; West, P. A direct comparison of experimental methods to measure dimensions of synthetic nanoparticles. Ultramicroscopy 2017, 182, 179–190. [Google Scholar] [CrossRef]
  31. Cui, Z.; Huang, L.; Sun, M.; Gao, S.-t.; Cai, J.-h.; Li, W.; Shi, Y.-s.; Li, Q. Precise measurement of gold nanorods by using depolarized dynamic light scattering apparatus. Optoelectron. Lett. 2021, 17, 170–175. [Google Scholar] [CrossRef]
  32. Naha, P.C.; Chhour, P.; Cormode, D.P. Systematic in vitro toxicological screening of gold nanoparticles designed for nanomedicine applications. Toxicol. Vitr. 2015, 29, 1445–1453. [Google Scholar] [CrossRef] [Green Version]
  33. Woźniak, A.; Malankowska, A.; Nowaczyk, G.; Grześkowiak, B.F.; Tuśnio, K.; Słomski, R.; Zaleska-Medynska, A.; Jurga, S. Size and shape-dependent cytotoxicity profile of gold nanoparticles for biomedical applications. Journal of Materials Science. J. Mater. Sci. Mater. Med. 2017, 28, 92. [Google Scholar] [CrossRef]
  34. Hoang Thi, T.T.; Pilkington, E.H.; Nguyen, D.H.; Lee, J.S.; Park, K.D.; Truong, N.P. The Importance of Poly(ethylene glycol) Alternatives for Overcoming PEG Immunogenicity in Drug Delivery and Bioconjugation. Polymers 2020, 12, 298. [Google Scholar] [CrossRef] [Green Version]
  35. Arvizo, R.; Bhattacharya, R.; Mukherjee, P. Gold nanoparticles: Opportunities and Challenges in Nanomedicine. Expert Opin. Drug Deliv. 2010, 7, 753–763. [Google Scholar] [CrossRef] [Green Version]
  36. Jia, Y.-P.; Ma, B.-Y.; Wei, X.-W.; Qian, Z.-Y. The in vitro and in vivo toxicity of gold nanoparticles. Chin. Chem. Lett. 2017, 28, 691–702. [Google Scholar] [CrossRef]
  37. Ye, H.; Shen, Z.; Yu, L.; Wei, M.; Li, Y. Manipulating nanoparticle transport within blood flow through external forces: An exemplar of mechanics in nanomedicine. Proc. Math. Phys. Eng. Sci. 2018, 474, 20170845. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Fytianos, K.; Rodriguez-Lorenzo, L.; Clift, M.J.D.; Blank, F.; Vanhecke, D.; Garnier, C.v.; Petri-Fink, A.; Rothen-Rutishauser, B.; Martin, C. Uptake efficiency of surface modified gold nanoparticles does not correlate with functional changes and cytokine secretion in human dendritic cells in vitro. Nanomed. Nanotechnol. Biol. Med. 2015, 11, 633–644. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Parsons, B.L. Many different tumor types have polyclonal tumor origin: Evidence and implications. Mutat. Res. 2008, 659, 232–247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Lima, A.R.; Araújo, A.M.; Pinto, J.; Jerónimo, C.; Henrique, R.; Bastos, M.d.L.; Carvalho, M.; Guedes de Pinho, P. Discrimination between the human prostate normal and cancer cell exometabolome by GC-MS. Sci. Rep. 2018, 8, 5539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Sampson, N.; Neuwirt, H.; Puhr, M.; Klocker, H.; Eder, I.E. In vitro model systems to study androgen receptor signaling in prostate cancer. Endocr. Relat. Cancer 2013, 20, R49–R64. [Google Scholar] [CrossRef] [Green Version]
  42. Ravenna, L.; Principessa, L.; Verdina, A.; Salvatori, L.; Russo, M.A.; Petrangeli, E. Distinct phenotypes of human prostate cancer cells associate with different adaptation to hypoxia and pro-inflammatory gene expression. PLoS ONE 2014, 9, e96250. [Google Scholar] [CrossRef]
  43. Mironava, T.; Hadjiargyrou, M.; Simon, M.; Jurukovski, V.; Rafailovich, M.H. Gold nanoparticles cellular toxicity and recovery: Effect of size, concentration and exposure time. Nanotoxicology 2010, 4, 120–137. [Google Scholar] [CrossRef]
  44. Steckiewicz, K.P.; Barcinska, E.; Malankowska, A.; Zauszkiewicz–Pawlak, A.; Nowaczyk, G.; Zaleska-Medynska, A.; Inkielewicz-Stepniak, I. Impact of gold nanoparticles shape on their cytotoxicity against human osteoblast and osteosarcoma in in vitro model. Evaluation of the safety of use and anti-cancer potential. J. Mater. Sci. Mater. Med. 2019, 30, 22. [Google Scholar] [CrossRef] [Green Version]
  45. Tarantola, M.; Pietuch, A.; Schneider, D.; Rother, J.; Sunnick, E.; Rosman, C.; Pierrat, S.; Sönnichsen, C.; Wegener, J.; Janshoff, A. Toxicity of gold-nanoparticles: Synergistic effects of shape and surface functionalization on micromotility of epithelial cells. Nanotoxicology 2010, 5, 254–268. [Google Scholar] [CrossRef] [PubMed]
  46. Zhang, X.D.; Wu, D.; Shen, X.; Chen, J.; Sun, Y.M.; Liu, P.X.; Liang, X.J. Size-dependent radiosensitization of PEG-coated gold nanoparticles for cancer radiation therapy. Biomaterials 2012, 33, 6408–6419. [Google Scholar] [CrossRef] [Green Version]
  47. Shahhoseini, E.; Feltis, B.N.; Nakayama, M.; Piva, T.J.; Pouniotis, D.; Alghamdi, S.S.; Geso, M. Combined Effects of Gold Nanoparticles and Ionizing Radiation on Human Prostate and Lung Cancer Cell Migration. Int. J. Mol. Sci. 2019, 20, 4488. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Connor, E.E.; Mwamuka, J.; Gole, A.; Murphy, C.J.; Wyatt, M.D. Gold nanoparticles are taken up by human cells but do not cause acute cytotoxicity. Small 2005, 1, 325–327. [Google Scholar] [CrossRef] [PubMed]
  49. Chuang, S.M.; Lee, Y.H.; Liang, R.Y.; Roam, G.D.; Zeng, Z.M.; Tu, H.F.; Wang, S.K.; Chueh, P.J. Extensive evaluations of the cytotoxic effects of gold nanoparticles. Biochim. Biophys. Acta 2013, 1830, 4960–4973. [Google Scholar] [CrossRef]
  50. Favi, P.M.; Gao, M.; Johana Sepúlveda Arango, L.; Ospina, S.P.; Morales, M.; Pavon, J.J.; Webster, T.J. Shape and surface effects on the cytotoxicity of nanoparticles: Gold nanospheres versus gold nanostars. J. Biomed. Mater. Res. A 2015, 103, 3449–3462. [Google Scholar] [CrossRef]
  51. Favi, P.M.; Valencia, M.M.; Elliott, P.R.; Restrepo, A.; Gao, M.; Huang, H.; Pavon, J.J.; Webster, T.J. Shape and surface chemistry effects on the cytotoxicity and cellular uptake of metallic nanorods and nanospheres. J. Biomed. Mater. Res. A 2015, 103, 3940–3955. [Google Scholar] [CrossRef]
  52. Oliveira, A.B.; de Moraes, F.R.; Candido, N.M.; Sampaio, I.; Paula, A.S.; de Vasconcellos, A.; Silva, T.C.; Miller, A.H.; Rahal, P.; Nery, J.G.; et al. Metabolic Effects of Cobalt Ferrite Nanoparticles on Cervical Carcinoma Cells and Nontumorigenic Keratinocytes. J. Proteome Res. 2016, 15, 4337–4348. [Google Scholar] [CrossRef]
  53. Bo, Y.; Jin, C.; Liu, Y.; Yu, W.; Kang, H. Metabolomic analysis on the toxicological effects of TiO2 nanoparticles in mouse fibroblast cells: From the perspective of perturbations in amino acid metabolism. Toxicol. Mech. Methods 2014, 24, 461–469. [Google Scholar] [CrossRef]
  54. Garcia-Contreras, R.; Sugimoto, M.; Umemura, N.; Kaneko, M.; Hatakeyama, Y.; Soga, T.; Tomita, M.; Scougall-Vilchis, R.J.; Contreras-Bulnes, R.; Nakajima, H.; et al. Alteration of metabolomic profiles by titanium dioxide nanoparticles in human gingivitis model. Biomaterials 2015, 57, 33–40. [Google Scholar] [CrossRef]
  55. Warburg, O.; Wind, F.; Negelein, E. The Metabolism of Tumors in the Body. J. Gen. Physiol 1927, 8, 519–530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Daemen, A.; Peterson, D.; Sahu, N.; McCord, R.; Du, X.; Liu, B.; Kowanetz, K.; Hong, R.; Moffat, J.; Gao, M.; et al. Metabolite profiling stratifies pancreatic ductal adenocarcinomas into subtypes with distinct sensitivities to metabolic inhibitors. Proc. Natl. Acad. Sci. USA 2015, 112, E4410–E4417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Lee, M.J.; Lee, S.J.; Yun, S.J.; Jang, J.Y.; Kang, H.; Kim, K.; Choi, I.H.; Park, S. Silver nanoparticles affect glucose metabolism in hepatoma cells through production of reactive oxygen species. Int. J. Nanomed. 2016, 11, 55–68. [Google Scholar] [CrossRef] [Green Version]
  58. Filippi, C.; Pryde, A.; Cowan, P.; Lee, T.; Hayes, P.; Donaldson, K.; Plevris, J.; Stone, V. Toxicology of ZnO and TiO2 nanoparticles on hepatocytes: Impact on metabolism and bioenergetics. Nanotoxicology 2015, 9, 126–134. [Google Scholar] [CrossRef] [PubMed]
  59. Huang, Y.; Lü, X.; Chen, R.; Chen, Y. Comparative study of the effects of gold and silver nanoparticles on the metabolism of human dermal fibroblasts. Regen. Biomater. 2020, 7, 221–232. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Cells 12 00787 g001 550
Figure 1. Schematic diagram of the synthesis process of pegylated gold nanoparticles: (A) spherical gold nanoparticles (AuNPsp); (B) gold nanostars (AuNPst), and (C) gold nanorods (AuNPr). HAuCl4·4H2O, tetrachloroauric acid tetrahydrate (99.99%); NaCt, trisodium citrate dehydrate; SH-PEG-NH2, thiol-polyethylene glycol-amine; AgNO4, silver nitrate; NaBH4, sodium borohydride; CTAB, hexadecyltrimethylammonium bromide ≥99%; L-ascorbic acid, ≥99%.
Figure 1. Schematic diagram of the synthesis process of pegylated gold nanoparticles: (A) spherical gold nanoparticles (AuNPsp); (B) gold nanostars (AuNPst), and (C) gold nanorods (AuNPr). HAuCl4·4H2O, tetrachloroauric acid tetrahydrate (99.99%); NaCt, trisodium citrate dehydrate; SH-PEG-NH2, thiol-polyethylene glycol-amine; AgNO4, silver nitrate; NaBH4, sodium borohydride; CTAB, hexadecyltrimethylammonium bromide ≥99%; L-ascorbic acid, ≥99%.
Cells 12 00787 g001
Cells 12 00787 g002 550
Figure 2. Characterization of PEG-coated AuNPs with different conformations of gold nanoparticles. Representative illustration of PEG-coated spherical gold nanoparticles (AuNPsp-PEG, (A); PEG-coated star gold nanoparticles (AuNPst-PEG, (B) and PEG-coated rod gold nanoparticles (AuNPr-PEG, (C). Characterization by UV-Vis spectra, results of AuNPsp (D), AuNPst (E) and AuNPr (F). The dash line means PEG-coated AuNPs, and solid line means AuNPs without PEG. Characterization by SEM of AuNPsp-PEG image scale of 100 nm (G), AuNPst-PEG scale of 500 nm (H) and AuNPr-PEG scale of 500 nm (I). Characterization by TEM of AuNPsp-PEG (J), AuNPst-PEG (K) and AuNPr-PEG (L) with PEG staining with phosphotungstic acid, image scale 100 nm. Histogram size based on TEM images of AuNPsp-PEG (M), AuNPst-PEG (N) and AuNPr-PEG (O), the scale of 100 nm. The histogram size was obtained by counting over 50 particles.
Figure 2. Characterization of PEG-coated AuNPs with different conformations of gold nanoparticles. Representative illustration of PEG-coated spherical gold nanoparticles (AuNPsp-PEG, (A); PEG-coated star gold nanoparticles (AuNPst-PEG, (B) and PEG-coated rod gold nanoparticles (AuNPr-PEG, (C). Characterization by UV-Vis spectra, results of AuNPsp (D), AuNPst (E) and AuNPr (F). The dash line means PEG-coated AuNPs, and solid line means AuNPs without PEG. Characterization by SEM of AuNPsp-PEG image scale of 100 nm (G), AuNPst-PEG scale of 500 nm (H) and AuNPr-PEG scale of 500 nm (I). Characterization by TEM of AuNPsp-PEG (J), AuNPst-PEG (K) and AuNPr-PEG (L) with PEG staining with phosphotungstic acid, image scale 100 nm. Histogram size based on TEM images of AuNPsp-PEG (M), AuNPst-PEG (N) and AuNPr-PEG (O), the scale of 100 nm. The histogram size was obtained by counting over 50 particles.
Cells 12 00787 g002
Cells 12 00787 g003 550
Figure 3. Results of AuNPs-PEG uptake by prostate cancer cell lines (PC3, DU145 and LNCaP) treated with 0.01 mM AuNPs for 24 h. Representative TEM images of ultrathin sections. Red arrows, indicate the presence of AuNPs inside all cell lines. Images of cells without AuNPs-PEG treatment (control, (A–C)). Cells treated with AuNPsp-PEG (D–F); cells treated with AuNPst-PEG (G–I); and cells treated with AuNPr-PEG (J–L). TEM magnification image 12,000× (A–C) and 50,000× (D–L). SEM scale bar is 1 µm to control cells and 200 nm for treated cells.
Figure 3. Results of AuNPs-PEG uptake by prostate cancer cell lines (PC3, DU145 and LNCaP) treated with 0.01 mM AuNPs for 24 h. Representative TEM images of ultrathin sections. Red arrows, indicate the presence of AuNPs inside all cell lines. Images of cells without AuNPs-PEG treatment (control, (A–C)). Cells treated with AuNPsp-PEG (D–F); cells treated with AuNPst-PEG (G–I); and cells treated with AuNPr-PEG (J–L). TEM magnification image 12,000× (A–C) and 50,000× (D–L). SEM scale bar is 1 µm to control cells and 200 nm for treated cells.
Cells 12 00787 g003
Cells 12 00787 g004 550
Figure 4. Cellular complexity of PC3, DU145 and LNCaP cells treated with 0.1 mM AuNPs (AuNPsp-PEG, AuNPst-PEG and AuNPr-PEG) during 24 h. The control were cells without treatment. The data was obtained with the CytExpert 2.3 software, and shown as the mean ± SD.
Figure 4. Cellular complexity of PC3, DU145 and LNCaP cells treated with 0.1 mM AuNPs (AuNPsp-PEG, AuNPst-PEG and AuNPr-PEG) during 24 h. The control were cells without treatment. The data was obtained with the CytExpert 2.3 software, and shown as the mean ± SD.
Cells 12 00787 g004
Cells 12 00787 g005 550
Figure 5. Metabolic activity in PC3 cell line (A); DU145 cell line (B), and LNCaP (C) cell lines. The proliferation of PC3 cell line (D); DU145 cell line (E), and LNCaP cell line(F). (A–F) Cells were treated with AuNPsp-PEG, AuNPst-PEG and AuNPr-PEG at 0.001, 0.01, 0.1, and 1 mM concentration for 24 h. The results were expressed as a percentage of the control (cells without treatment). Results were presented as mean ± standard deviation; n = 9. Statistical significance was considered as (*) p < 0.05, (**) p < 0.01, (***) p < 0.001, and (****) p < 0.0001 when compared to the control.
Figure 5. Metabolic activity in PC3 cell line (A); DU145 cell line (B), and LNCaP (C) cell lines. The proliferation of PC3 cell line (D); DU145 cell line (E), and LNCaP cell line(F). (A–F) Cells were treated with AuNPsp-PEG, AuNPst-PEG and AuNPr-PEG at 0.001, 0.01, 0.1, and 1 mM concentration for 24 h. The results were expressed as a percentage of the control (cells without treatment). Results were presented as mean ± standard deviation; n = 9. Statistical significance was considered as (*) p < 0.05, (**) p < 0.01, (***) p < 0.001, and (****) p < 0.0001 when compared to the control.
Cells 12 00787 g005
Cells 12 00787 g006 550
Figure 6. Different types of AuNPs-PEG in PC3 (A), DU145 (B), And LNCaP (C) in ROS levels. Cells were pretreated with 10 µM H2DCFDA for 45 min, then cells were treated with 0.1 mM AuNPs-PEG of different shapes during 24 h. Results represent the mean of DCF fluorescence (mean ± SD) from six independent replicates (n = 6).
Figure 6. Different types of AuNPs-PEG in PC3 (A), DU145 (B), And LNCaP (C) in ROS levels. Cells were pretreated with 10 µM H2DCFDA for 45 min, then cells were treated with 0.1 mM AuNPs-PEG of different shapes during 24 h. Results represent the mean of DCF fluorescence (mean ± SD) from six independent replicates (n = 6).
Cells 12 00787 g006
Cells 12 00787 g007 550
Figure 7. RT-qPCR analysis of genes transcripts involved in different metabolic pathways—hexokinase-2 (HK2) and pyruvate kinase (PKM) on glycolysis, glucose-6-phosphatase (G6Pase) and pyruvate carboxylase (PCX) on gluconeogenesis, acyl-CoA dehydrogenase (ACADS) on beta-oxidation and mitochondrial fission 1 protein (FIS1) after AuNPs-PEG treatment. PC3 (A), DU145 (B) and LNCaP (C). The mRNA expression level of each enzyme was normalized to GAPDH housekeeping gene. Gene relative expression was employed by the ΔCT expression/ΔCT control ratio. (n = 2). Data are shown as means ± SD. Statistical significance was considered as (***) p < 0.001, and (****) p < 0.0001.
Figure 7. RT-qPCR analysis of genes transcripts involved in different metabolic pathways—hexokinase-2 (HK2) and pyruvate kinase (PKM) on glycolysis, glucose-6-phosphatase (G6Pase) and pyruvate carboxylase (PCX) on gluconeogenesis, acyl-CoA dehydrogenase (ACADS) on beta-oxidation and mitochondrial fission 1 protein (FIS1) after AuNPs-PEG treatment. PC3 (A), DU145 (B) and LNCaP (C). The mRNA expression level of each enzyme was normalized to GAPDH housekeeping gene. Gene relative expression was employed by the ΔCT expression/ΔCT control ratio. (n = 2). Data are shown as means ± SD. Statistical significance was considered as (***) p < 0.001, and (****) p < 0.0001.
Cells 12 00787 g007
Cells 12 00787 g008 550
Figure 8. Effect of different types of gold nanoparticles (AuNPs) in several prostate cancer cell metabolic pathways, including glycolysis, gluconeogenesis, and beta-oxidation after internalization. Prostate cancer cells exhibit increased lipid metabolism, which results in citrate synthesis at the tricarboxylic acid (TCA) cycle that is not only an energy source but also for other biomolecules synthesis. Additionally, certain steps of gluconeogenesis seem to be activated to maintain normal glucose levels which can then be used for anabolic purposes. Hexokinase-2, pyruvate kinase, glucose-6-phosphatase, pyruvate carboxylase, acyl-CoA dehydrogenase and mitochondrial fission 1 protein were evaluated by RT-qPCR. The influence of AuNPs-PEG in the expression of metabolic enzymes assessed using +, − or = symbols (+++ > ++ > + and −−− > −− > −). (*) p < 0.05.
Figure 8. Effect of different types of gold nanoparticles (AuNPs) in several prostate cancer cell metabolic pathways, including glycolysis, gluconeogenesis, and beta-oxidation after internalization. Prostate cancer cells exhibit increased lipid metabolism, which results in citrate synthesis at the tricarboxylic acid (TCA) cycle that is not only an energy source but also for other biomolecules synthesis. Additionally, certain steps of gluconeogenesis seem to be activated to maintain normal glucose levels which can then be used for anabolic purposes. Hexokinase-2, pyruvate kinase, glucose-6-phosphatase, pyruvate carboxylase, acyl-CoA dehydrogenase and mitochondrial fission 1 protein were evaluated by RT-qPCR. The influence of AuNPs-PEG in the expression of metabolic enzymes assessed using +, − or = symbols (+++ > ++ > + and −−− > −− > −). (*) p < 0.05.
Cells 12 00787 g008
Table
Table 1. Set of primer sequences for the one-step multiplex RT-qPCR.
Table 1. Set of primer sequences for the one-step multiplex RT-qPCR.
GenePrimer ForwardPrimer Reverse
HK2GGCAATGAAACCAAAGCCAGCAAACTAAAAACTCCCCCTTCC
G6PaseCTCCTCTATCACATTACATCATCCGAAACATACAAAAGCACCACC
PKMATTCACCACCCATCACAGCCCAGACGAGCCACATTCATTCC
PCXCATCCCCAACATCCCTTTCCCCACTTCACAGAACTTGAAGAC
ACADSAGTGTCAACAACTCTCTCTACCAAGCAGCCAATTTTGTCACC
FIS1TGTCCTTTCCCTGTTCTCCAGCCCCGTTTTATTTACACTC
GAPDHTCAAGATCATCAGCAATGCCTGAGTCCTTCCACGATACC
Table
Table 2. Hydrodynamic diameters and zeta potential of AuNPsp-PEG, AuNPst-PEG and AuNPr-PEG.
Table 2. Hydrodynamic diameters and zeta potential of AuNPsp-PEG, AuNPst-PEG and AuNPr-PEG.
SampleHydrodynamic Diameter (nm)Polydispersity Index (PDI)Zeta Potential
(mV)
AuNPsp-PEG47.31 ± 0.460.3 ± 0.016.7 ± 7.9
AuNPst-PEG109.61 ± 1.270.14± 0.0133.1 ± 12.0
AuNPr-PEG54.58 ± 0.340.45 ± 0.0111.0 ± 18.9
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Soares, S.; Pereira, C.; Sousa, A.P.; Oliveira, A.C.; Sales, M.G.; Correa-Duarte, M.A.; Guerreiro, S.G.; Fernandes, R. Metabolic Disruption of Gold Nanospheres, Nanostars and Nanorods in Human Metastatic Prostate Cancer Cells. Cells 2023, 12, 787. https://doi.org/10.3390/cells12050787

AMA Style

Soares S, Pereira C, Sousa AP, Oliveira AC, Sales MG, Correa-Duarte MA, Guerreiro SG, Fernandes R. Metabolic Disruption of Gold Nanospheres, Nanostars and Nanorods in Human Metastatic Prostate Cancer Cells. Cells. 2023; 12(5):787. https://doi.org/10.3390/cells12050787

Chicago/Turabian Style

Soares, Sílvia, Cláudia Pereira, André P. Sousa, Ana Catarina Oliveira, Maria Goreti Sales, Miguel A. Correa-Duarte, Susana G. Guerreiro, and Rúben Fernandes. 2023. "Metabolic Disruption of Gold Nanospheres, Nanostars and Nanorods in Human Metastatic Prostate Cancer Cells" Cells 12, no. 5: 787. https://doi.org/10.3390/cells12050787

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop