Next Article in Journal
Coenzyme Q10-Loaded Albumin Nanoparticles Protect against Redox Imbalance and Inflammatory, Apoptotic, and Histopathological Alterations in Mercuric Chloride-Induced Hepatorenal Toxicity in Rats
Previous Article in Journal
Risk Factors and Cellular Differences in Heart Failure: The Key Role of Sex Hormones
Previous Article in Special Issue
Estimation of Cancellous Changes Using Fractal Analysis in Patients with Periodontitis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 11
Issue 11
10.3390/biomedicines11113053
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

The Analysis of Selected miRNAs and Target MDM2 Gene Expression in Oral Squamous Cell Carcinoma

by
Karolina Gołąbek
1,*,
Dorota Hudy
1,
Jadwiga Gaździcka
1,
Katarzyna Miśkiewicz-Orczyk
2,
Magdalena Nowak-Chmura
3,
Marek Asman
1,
Katarzyna Komosińska-Vassev
4,
Wojciech Ścierski
2,
Wojciech Golusiński
5,
Maciej Misiołek
2 and
Joanna Katarzyna Strzelczyk
1
1
Department of Medical and Molecular Biology, Faculty of Medical Sciences in Zabrze, Medical University of Silesia in Katowice, 19 Jordana St., 41-808 Zabrze, Poland
2
Department of Otorhinolaryngology and Oncological Laryngology, Faculty of Medical Sciences in Zabrze, Medical University of Silesia in Katowice, 10 C Skłodowska St., 41-800 Zabrze, Poland
3
Department of Invertebrate Zoology and Parasitology, Institute of Biology, Pedagogical University of Cracov, Podbrzezie 3 St., 31-054 Kraków, Poland
4
Department of Clinical Chemistry and Laboratory Diagnostics, Faculty of Pharmaceutical Sciences in Sosnowiec, Medical University of Silesia in Katowice, 8 Jedności St., 41-200 Sosnowiec, Poland
5
Department of Head and Neck Surgery, Poznan University of Medical Sciences, The Greater Poland Cancer Centre, 15 Garbary St., 61-866 Poznan, Poland
*
Author to whom correspondence should be addressed.
Biomedicines 2023, 11(11), 3053; https://doi.org/10.3390/biomedicines11113053
Submission received: 19 October 2023 / Revised: 10 November 2023 / Accepted: 13 November 2023 / Published: 14 November 2023
(This article belongs to the Special Issue Recent Advances in Oral Medicine)
Browse Figures
Review Reports Versions Notes

Abstract

:
MiRNAs could play an important role in tumorigenesis and progression. The oncoprotein MDM2 (murine double minute 2) was identified as a negative regulator of the tumour suppressor p53. This study aims to analyse the expression of the MDM2 target miRNA candidates (miR-3613-3p, miR-371b-5p and miR-3658) and the MDM2 gene in oral squamous cell carcinoma tumour and margin samples and their association with the selected socio-demographic and clinicopathological characteristics. The study group consisted of 50 patients. The miRNAs and MDM2 gene expression levels were assessed by qPCR. The expression analysis of the miRNAs showed the expression of only one of them, i.e., miR-3613-3p. We found no statistically significant differences in the miR-3613-3p expression in tumour samples compared to the margin samples. When analysing the effect of smoking on miR-3613-3p expression, we demonstrated a statistically significant difference between smokers and non-smokers. In addition, we showed an association between the miR-3613-3p expression level and some clinical parameters in tumour samples (T, N and G). Our study demonstrates that miR-3613-3p overexpression is involved in the tumour progression of OSCC. This indicates that miR-3613-3p possesses potential prognostic values.

1. Introduction

Oral squamous cell carcinoma (OSCC) refers to a group of malignancies affecting more than 370,000 men and women each year, accounting for an estimated 177,757 deaths in 2020 [1]. In addition, OSCC is a type of cancer with 5-year survival rates reaching only 45 to 50% [2,3]. Previous studies have shown that smoking and alcohol consumption are two well-known independent risk factors for OSCC [4,5]. In addition, genetic background, HPV (Human Papilloma Virus) infections, oral hygiene and diet are also considered risk factors [6,7,8]. Therefore, it seems important to better understand the genetic risk factors that could be crucial for developing effective diagnostic, prognostic and treatment strategies for OSCC.
MicroRNAs (miRNAs) are a class of small (about 18–22 nucleotides in length), non-coding RNAs that regulate gene expression at the post-transcriptional level by directly targeting the mRNA’s 3′ untranslated region (3′ UTR) [9,10]. These types of tissue-specific molecules could serve as oncogenes (OncomiRs) or tumour suppressors (oncosuppressor miRs) [11,12]. Accordingly, miRNAs could play an important role in tumorigenesis and progression by affecting different processes, such as cell differentiation, migration, proliferation and apoptosis [13]. miRNAs are promising key biomarkers for the diagnosis, prognosis and a possible therapeutic strategy of cancers [14].
The oncoprotein MDM2 (murine double minute 2) was identified as a negative regulator of the tumour suppressor p53. MDM2 is a protein that contains an N-terminal p53 interaction domain, central acidic domain, Zinc-finger domain and C-terminal RING domain [15]. This molecule is an E3 ubiquitin-protein ligase that binds to the tumour suppressor p53, causing its ubiquitination and subsequent proteasomal degradation [16]. The proto-oncogene MDM2 encoding this protein is located on the human chromosomes 12q14.3 to q15 [17].
Based on several studies, it can be assumed that miRNAs directly target the MDM2 gene to regulate tumour progression. It has also been shown that targeting the MDM2 gene significantly reduces the viability of cancer cells and improves chemosensitivity in a p53-dependent manner [18,19,20,21,22].
The present study aims to analyse the expression of the MDM2 target miRNA candidates (miR-3613-3p, miR-371b-5p and miR-3658) and the MDM2 gene in oral squamous cell carcinoma tumour and margin samples and their association with the selected socio-demographic and clinicopathological characteristics.

2. Materials and Methods

2.1. Patient and Samples

The characteristics of the study group were presented in the previous study [23]. The study group comprised 50 OSCC patients recruited at the Department of Otorhinolaryngology and Oncological Laryngology in Zabrze, Medical University of Silesia, in Katowice (Poland). The tissues (paired tumour and matching margin specimens) were obtained following surgical resection. The tumour stage was assessed according to the American Joint Committee on Cancer (AJCC, version 2007) [24,25] and the WHO Classification of Head and Neck Tumours [26]. The normal tissues (margins) were checked and classified as cancer-free by pathologists. The main inclusion criteria were as follows: written informed consent to participate in the study, age over 18 years, no metabolic diseases (e.g., diabetes and hypertension), or no chronic inflammatory diseases, primary tumours and no history of preoperative radio- or chemotherapy. The data on the patients (age, sex, medical history and the use of tobacco and alcohol) were collected using an ad hoc questionnaire. The study was approved by the Bioethics Committee of the Medical University of Silesia (approval no. KNW/022/KB1/49/16 and no. KNW/002/KB1/49/II/16/17) [23]. The clinical data of the OSCC group are presented in Table 1.

2.2. Expression Analysis of miRNAs and the MDM2 Gene

2.2.1. RNA and miRNA Extraction and Quantification

The methodology for the extraction was presented in previous studies [23,27]. All tissue samples were homogenized with the FastPrep®-24 homogenizer (MP Biomedicals, Solon, CA, USA) with Lysing Matrix D ceramic beads (MP Biomedicals, Solon, CA, USA). The RNA and miRNAs were extracted using the RNA isolation kit (catalogue number RIK 001, BioVendor, Brno, Czech Republic) to the standard instruction. The concentration and purity of the isolated RNA were determined using spectrophotometry in a NanoPhotometer Pearl UV/Vis Spectrophotometer (Implen, Munich, Germany) [23,27].

2.2.2. Complementary DNA (cDNA) Synthesis

The methodology for the cDNA synthesis was presented in previous studies [23,27].
The obtained RNA (5 ng) was reverse-transcribed using the TaqMan® Advanced miRNA cDNA Synthesis Kit (Applied Biosystems, Foster City, CA, USA) according to manufacturer’s protocol. The whole procedure consists of four reactions: poly(A) tailing reaction, the adaptor ligation reaction, the reverse transcription (RT) reaction and the miR-Amp reaction. Furthermore, the obtained RNA (5 ng) was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s protocol. The reactions were prepared in Mastercycler personal (Eppendorf, Hamburg, Germany) [23,27].

2.2.3. Analysis of miRNA and MDM2 Gene Expression

The methodology for the miRNA and MDM2 gene expression analysis was presented in previous studies [23,27]. The target miRNAs of the MDM2 gene were predicted by the miRCode (version 11) [28], miRDB (version 6.0) [29] and TargetScan (version 7.2) [30] online databases. The relative expression (RQ) of miR-3613-3p, miR-3658 and miR-371b-5p was assessed based on the guidelines using the TaqMan® Advanced miRNA Assays (Assay ID: 478434_mir for miR-3613-3p; Assay ID: 478853_mir for miR-371b-5p; Assay ID: 479696_mir for miR-3658; and Assay ID: 478056_mir for miR-361-5p; Applied Biosystems, Foster City, CA, USA). The kit was supplied with primers and fluorescently marked molecular probes. All reactions were performed in the QuantStudio 5 Real-Time PCR System and Analysis Software v1.5.1 (Applied Biosystems, Foster City, CA, USA). The housekeeping miR-361-5p was used for normalizing the expression. Five surgical margin samples were used as a calibrator. RQ was calculated using 2−∆∆Ct after normalization with the reference miRNA. Table 2 shows the sequences of the miRNAs.
The analysis of the relative MDM2 gene expression (RQ) was performed by real-time PCR (qPCR) using TaqMan® Gene Expression Assays (Assay ID: Hs01066930_m1 for MDM2; and Assay ID: Hs03929097_g1 for GAPDH), QuantStudio 5 Real-Time PCR System and Analysis Software v1.5.1 (Applied Biosystems, Foster City, CA, USA). The kit was supplied with primers and fluorescently marked molecular probes. The glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) was used as an endogenous control. Five surgical margin samples were used as a calibrator. The comparative threshold cycle (Ct) method 2−∆∆Ct was used to determine the RQ [23,27].

2.3. HPV 16 Detection

The methodology for HPV detection was presented in a previous study [23]. DNA was extracted from tissue samples using a Gene Matrix Tissue DNA Purification Kit (EURx, Gdansk, Poland), according to the manufacturer’s instructions. The concentration and purity of the isolated DNA were prepared using spectrophotometry in a NanoPhotometer Pearl UV/Vis Spectrophotometer (Implen, Munich, Germany). HPV was detected using an AmpliSens® HPV 16/18-FRT PCR kit (InterLabService, Moscow, Russia), according to the manufacturer’s protocol. All PCR reactions were performed using the QuantStudio 5 Real-Time PCR System (Applied Bio-systems, Foster City, CA, USA) [23].

2.4. Statistical Analyses

The Shapiro–Wilk test was used to evaluate the distribution of the variables. The median with interquartile range (25–75%) was used to describe expression of miRNAs and MDM2 gene expression. The Mann–Whitney U test was used to compare the sociodemographic and clinical characteristics, miRNAs and the MDM2 gene. Correlations between miRNAs and the MDM2 gene were calculated using the Spearman’s rank correlation analysis. The level of statistical significance was set at 0.05. The statistical software STATISTICA version 13 (TIBCO Software Inc., Palo Alto, CA, USA) was used to perform all the analyses.

3. Results

3.1. miRNA Expression and Correlations between the Expression of miRNAs and Socio-Demographic and Clinicopathological Features

The expression analysis of the miRNAs showed the expression of only one of them, i.e., miR-3613-3p. We found no statistically significant differences in the miR-3613-3p expression in tumour samples compared to margin samples (p-value = 0.738). The median miR-3613-3p expression was 0.853 (0.515–2.424) in the tumour samples and 0.818 (0.519–1.579) in the margin samples (Figure 1).
No association was found between the miR-3613-3p expression levels, age, gender, alcohol consumption, HPV status and 3-year survival rates. When analysing the effect of smoking on the miR-3613-3p expression, we demonstrated a statistically significant difference between smokers and non-smokers (0.568 vs. 1.7845, respectively; p-value = 0.006) in tumour samples. In addition, we showed an association between miR-3613-3p expression level and some clinical parameters in tumour samples. Patients with T2 had a significantly lower expression level of miR-3613-3p than those with T3 (0.568 vs. 1.412, respectively; p-value = 0.043). Furthermore, patients with N0 had a significantly lower expression level of miR-3613-3p than those with N2 (0.591 vs. 1.257, respectively; p-value = 0.047). Higher miR-3613-3p expression levels were also noted in patients with G2 compared to G1 (1.581 vs. 0.455, respectively; p-value = 0.012). The respective results are shown in Figure 2, Figure 3, Figure 4 and Figure 5.

3.2. MDM2 Gene Expression and Correlations between MDM2 Gene Expression and Socio-Demographic and Clinicopathological Features

We found no statistically significant differences in MDM2 gene expression levels in tumour samples compared to the margin samples (p-value = 0.075). The median MDM2 gene expression was 0.371 (0.165–0.705) in the tumour samples and 0.555 (0.274–0.989) in the margin samples (Figure 6).
Furthermore, no association was found between the MDM2 gene expression, age, gender, smoking, alcohol consumption, HPV status, clinical parameters (TNM and G) and 3-year survival rates in the analysed samples.

3.3. Correlation of the miR-3613-3p Expression and MDM2 Gene Expression

When analysing the effect of miR-3613-3p expression on MDM2 gene expression, we showed no statistically significant differences in the tumour or margin samples (Table 3).

4. Discussion

MiRNAs have become the aim of many cancer studies due to their role in regulating cellular processes and facilitating the diagnosis, prognosis and treatment strategies. Using the analysis of the databases, we demonstrated that miR-3613-3p, miR-371b-5p and miR-3658 could be adequate target miRNAs of the MDM2 gene. To the best of our knowledge, our study is the first that aimed to determine the importance of selected miRNAs and MDM2 gene expression in OSCC tumour and margin samples and their association with the selected socio-demographic and clinicopathological characteristics. The expression analysis of the miRNAs showed the expression of only one of them, i.e., miR-3613-3p. When analysing the effect of smoking on the miR-3613-3p expression, we demonstrated a statistically significant difference between smokers and non-smokers. The effect of smoking on miRNA expression in head and neck squamous cell carcinoma has been demonstrated by other studies. The tobacco-specific nitrosamine-NNK (4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone) has been identified as an important inducing factor for the upregulation of miR-21 and miR-155 and the downregulation of miR-422 [31]. Possibly, miR-3613-3p expression is also regulated by the chemical compound. In addition, we showed an association between miR-3613-3p expression level and some clinical parameters in tumour samples (T2 vs. T3, N0 vs. N2 and G1 vs. G2). Our results suggest that miRNA could be involved in the pathogenesis of OSCC. Other analyses showed the importance of miR-3613-3p in the tumorigenesis of other cancers. Chen et al. [32] reported that a frequent genomic deletion and changes in miR-3613-3p expression were found in breast cancer. The miR-3613-3p expression level was lower in the tumour tissues and serum of breast cancer patients [32]. Zhang et al. [33] demonstrated that miR-3613-3p could be an inhibitor of hepatoma cell proliferation [33]. In addition, it was discovered that miR-3613-3p was downregulated in colon cancer cell lines [34]. In their study, Pu et al. [35] found that miR-3675-3p was a promising biomarker of different stages of lung adenocarcinoma [35]. Other authors showed that miR-3613-3p regulates genes of the EGFR signalling pathway in the epithelial–mesenchymal progression of lung adenocarcinoma [36].
The roles of miR-371b-5p and miR-3658 in cancer pathogenesis have been analysed in other types of cancer (non-small cell lung cancer, hepatocellular carcinoma and bladder cancer and colorectal cancer) [37,38,39,40,41,42,43]. Luo et al. [37] found that miR-371b-5p was significantly upregulated in non-small cell lung cancer, which resulted in increased cell proliferation, migration and invasion [37]. The overexpression of this miRNA was also reported in cancers, such as hepatocellular carcinoma and bladder cancer [38,39]. On the other hand, miR-371-5p was notably downregulated in colorectal cancer and repressed the cell proliferation, invasion, metastasis and self-renewal of this cancer [40,41]. In turn, miR-3658 was upregulated in bladder cancer. Furthermore, a higher miR-3658 expression was significantly associated with lymph node invasion, distant metastasis, histological grade, TNM stage and tumour recurrence [42]. Of note, each type of cancer has a unique microRNA expression profile that could potentially distinguish it from normal tissues and other types of cancer [43].
The MDM2 protein is a key negative regulator of the tumour suppressor p53. This oncoprotein is involved in the pathogenesis of different types of cancer, such as breast cancer, cervical cancer, endometrial cancer, lung cancer, liver cancer, oesophagogastric cancer, colorectal cancer, sarcomas, osteosarcomas, gliomas, melanomas, hematopoietic malignancies, papillary thyroid cancer and ovarian cancer [16,44,45,46,47,48,49,50]. The overexpression of the MDM2 protein was also demonstrated in head and neck squamous cell carcinoma, laryngeal cancer and squamous cell carcinoma of the tonsillar region [51,52,53,54]. Friesland et al. [52] reported that changes in the level of MDM2 were also associated with a worse prognosis in the squamous cell carcinoma of the tonsil area [52]. Our analysis showed no statistically significant differences in the MDM2 gene expression level in the tumour samples compared to the margin samples. Moreover, the change in MDM2 gene expression was not associated with any socio-demographic or clinicopathological features.
Several miRNAs, such as miR-192, miR-194, miR-215, miR-221, miR-509-5p, miR-944, miR-1305, miR-585, miR-548b-3p, miR-219a-2-3p, miR-518, miR-143 and miR-3928, have been studied for their ability to target the MDM2 gene. These analyses concerned various malignancies, such as multiple myeloma, hepatocellular carcinoma, pancreatic cancer, colorectal cancer, non-small cell lung cancer, glioma, breast cancer, pituitary adenoma, gastric carcinoma and bladder cancer [15,55,56,57,58,59,60,61,62,63,64]. Our study found no evidence that miR-3613-3p, miR-371b-5p and miR-3658 regulated MDM2 gene expression in OSCC samples. Further studies on larger and more diverse groups are warranted to better understand the significance of the miRNA and its role in OSCC.

5. Conclusions

Our study demonstrated that miR-3613-3p overexpression is involved in the tumour progression of OSCC. This indicates that miR-3613-3p possesses potential prognostic values. Furthermore, our results reveal a differential miR-3613-3p expression in response to smoking. When analysing the effect of miR-3613-3p expression on MDM2 gene expression, we showed no statistically significant differences in the tumour or margin samples.

Author Contributions

Conceptualization, K.G.; methodology, K.G.; resources, K.M.-O. and W.Ś.; investigation, K.G., J.G., M.N.-C., M.A. and K.K.-V.; formal analysis, K.G. and D.H.; writing—original draft preparation, K.G.; supervision, W.G., M.M. and J.K.S.; project administration, K.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by a grant from the Medical University of Silesia (PCN-1-218/N/2/O).

Institutional Review Board Statement

The study was conducted in accordance with the Decla-ration of Helsinki and approved by the Bioethics Committee of the Medical University of Silesia (approval no. KNW/022/KB1/49/16 and no. KNW/002/KB1/49/II/16/17).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.

Acknowledgments

We would like to thank Krzysztof Biernacki, for help with HPV detection.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study, in the collection, analyses, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results.

References

  1. Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
  2. Golusinski, P.; Di Maio, P.; Pehlivan, B.; Colley, S.; Nankivell, P.; Kong, A.; Hartley, A.; Mehanna, H. Evidence for the approach to the diagnostic evaluation of squamous cell carcinoma occult primary tumors of the head and neck. Oral Oncol. 2019, 88, 145–152. [Google Scholar] [CrossRef]
  3. Aghiorghiesei, O.; Zanoaga, O.; Raduly, L.; Aghiorghiesei, A.I.; Chiroi, P.; Trif, A.; Buiga, R.; Budisan, L.; Lucaciu, O.; Pop, L.A.; et al. Dysregulation of miR-21-5p, miR-93-5p, miR-200c-3p and miR-205-5p in Oral Squamous Cell Carcinoma: A Potential Biomarkers Panel? Curr. Issues Mol. Biol. 2022, 44, 1754–1767. [Google Scholar] [CrossRef]
  4. Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2016. CA Cancer J. Clin. 2016, 66, 7–30. [Google Scholar] [CrossRef]
  5. Dioguardi, M.; Caloro, G.A.; Laino, L.; Alovisi, M.; Sovereto, D.; Crincoli, V.; Aiuto, R.; Coccia, E.; Troiano, G.; Lo Muzio, L. Circulating miR-21 as a Potential Biomarker for the Diagnosis of Oral Cancer: A Systematic Review with Meta-Analysis. Cancers 2020, 12, 936. [Google Scholar] [CrossRef] [PubMed]
  6. Esquivel-Chirino, C.; Bolaños-Carrillo, M.A.; Carmona-Ruiz, D.; Lopéz-Macay, A.; Hernández-Sánchez, F.; Montés-Sánchez, D.; Escuadra-Landeros, M.; Gaitán-Cepeda, L.A.; Maldonado-Frías, S.; Yáñez-Ocampo, B.R.; et al. The Protective Role of Cranberries and Blueberries in Oral Cancer. Plants 2023, 12, 2330. [Google Scholar] [CrossRef] [PubMed]
  7. Kaur, V.; Rooney, A.; Horton, B.J. Prognostic significance of extra-nodal extension and positive surgical margins in HPV positive oropharyngeal squamous cell carcinoma. Am. J. Otolaryngol. 2023, 44, 103877. [Google Scholar] [CrossRef]
  8. Yang, Z.; Sun, P.; Dahlstrom, K.R.; Gross, N.; Li, G. Joint effect of human papillomavirus exposure, smoking and alcohol on risk of oral squamous cell carcinoma. BMC Cancer 2023, 23, 457. [Google Scholar] [CrossRef] [PubMed]
  9. Kabzinski, J.; Maczynska, M.; Majsterek, I. MicroRNA as a Novel Biomarker in the Diagnosis of Head and Neck Cancer. Biomolecules 2021, 11, 844. [Google Scholar] [CrossRef]
  10. Thomaidou, A.C.; Batsaki, P.; Adamaki, M.; Goulielmaki, M.; Baxevanis, C.N.; Zoumpourlis, V.; Fortis, S.P. Promising Biomarkers in Head and Neck Cancer: The Most Clinically Important miRNAs. Int. J. Mol. Sci. 2022, 23, 8257. [Google Scholar] [CrossRef] [PubMed]
  11. Di Leva, G.; Garofalo, M.; Croce, C.M. MicroRNAs in cancer. Annu. Rev. Pathol. 2014, 9, 287–314. [Google Scholar] [CrossRef]
  12. Ali Syeda, Z.; Langden, S.S.S.; Munkhzul, C.; Lee, M.; Song, S.J. Regulatory Mechanism of MicroRNA Expression in Cancer. Int. J. Mol. Sci. 2020, 21, 1723. [Google Scholar] [CrossRef] [PubMed]
  13. Vannini, I.; Fanini, F.; Fabbri, M. Emerging roles of microRNAs in cancer. Curr. Opin. Genet. Dev. 2018, 48, 128–133. [Google Scholar] [CrossRef]
  14. Vos, P.D.; Leedman, P.J.; Filipovska, A.; Rackham, O. Modulation of miRNA function by natural and synthetic RNA-binding proteins in cancer. Cell Mol. Life Sci. 2019, 76, 3745–3752. [Google Scholar] [CrossRef] [PubMed]
  15. Cai, Y.; Hao, Y.; Ren, H.; Dang, Z.; Xu, H.; Xue, X.; Gao, Y. miR-1305 Inhibits The Progression Of Non-Small Cell Lung Cancer By Regulating MDM2. Cancer Manag. Res. 2019, 11, 9529–9540. [Google Scholar] [CrossRef] [PubMed]
  16. Hou, H.; Sun, D.; Zhang, X. The role of MDM2 amplification and overexpression in therapeutic resistance of malignant tumors. Cancer Cell Int. 2019, 19, 216. [Google Scholar] [CrossRef] [PubMed]
  17. Nguyen, D.; Liao, W.; Zeng, S.X.; Lu, H. Reviving the guardian of the genome: Small molecule activators of p53. Pharmacol. Ther. 2017, 178, 92–108. [Google Scholar] [CrossRef]
  18. Sheng, W.; Dong, M.; Chen, C.; Wang, Z.; Li, Y.; Wang, K.; Li, Y.; Zhou, J. Cooperation of Musashi-2, Numb, MDM2, and P53 in drug resistance and malignant biology of pancreatic cancer. FASEB J. 2017, 31, 2429–2438. [Google Scholar] [CrossRef]
  19. Tong, H.; Zhao, K.; Zhang, J.; Zhu, J.; Xiao, J. YB-1 modulates the drug resistance of glioma cells by activation of MDM2/p53 pathway. Drug Des. Devel. Ther. 2019, 13, 317–326. [Google Scholar] [CrossRef]
  20. Ahmad, S.M.; Nayak, D.; Mir, K.B.; Faheem, M.M.; Nawaz, S.; Yadav, G.; Goswami, A. Par-4 activation restrains EMT-induced chemoresistance in PDAC by attenuating MDM-2. Pancreatology 2020, 20, 1698–1710. [Google Scholar] [CrossRef]
  21. Wang, Q.S.; Zhou, J.; Li, X. LncRNA UCA1 protects cardiomyocytes against hypoxia/reoxygenation induced apoptosis through inhibiting miR-143/MDM2/p53 axis. Genomics 2020, 112, 574–580. [Google Scholar] [CrossRef] [PubMed]
  22. Ma, W.; Zhao, P.; Zang, L.; Zhang, K.; Liao, H.; Hu, Z. CircTP53 promotes the proliferation of thyroid cancer via targeting miR-1233-3p/MDM2 axis. J. Endocrinol. Investig. 2021, 44, 353–362. [Google Scholar] [CrossRef] [PubMed]
  23. Gołąbek, K.; Hudy, D.; Świętek, A.; Gaździcka, J.; Dąbrowska, N.; Miśkiewicz-Orczyk, K.; Zięba, N.; Misiołek, M.; Strzelczyk, J.K. miR-125b-5p, miR-155-3p, and miR-214-5p and Target E2F2 Gene in Oral Squamous Cell Carcinoma. Int. J. Mol. Sci. 2023, 24, 6320. [Google Scholar] [CrossRef] [PubMed]
  24. Brunner, M.; Ng, B.C.; Veness, M.J.; Clark, J.R. Comparison of the AJCC N staging system in mucosal and cutaneous squamous head and neck cancer. Laryngoscope 2014, 124, 1598–1602. [Google Scholar] [CrossRef]
  25. Rodrigues, P.C.; Miguel, M.C.; Bagordakis, E.; Fonseca, F.P.; de Aquino, S.N.; Santos-Silva, A.R.; Lopes, M.A.; Graner, E.; Salo, T.; Kowalski, L.P.; et al. Clinicopathological prognostic factors of oral tongue squamous cell carcinoma: A retrospective study of 202 cases. Int. J. Oral Maxillofac. Surg. 2014, 43, 795–801. [Google Scholar] [CrossRef]
  26. El-Naggar, A.K.; Chan, J.K.C.; Grandis, J.R.; Takata, T.; Slootweg, P.J. WHO Classification of Head and Neck Tumours International Agency for Research on Cancer (IARC), 4th ed.; IARC Publications: Lyon, France, 2017. [Google Scholar]
  27. Gołąbek, K.; Rączka, G.; Gaździcka, J.; Miśkiewicz-Orczyk, K.; Zięba, N.; Krakowczyk, Ł.; Misiołek, M.; Strzelczyk, J.K. Expression Profiles of CDKN2A, MDM2, E2F2 and LTF Genes in Oral Squamous Cell Carcinoma. Biomedicines 2022, 10, 3011. [Google Scholar] [CrossRef]
  28. miRCode. Available online: http://www.mircode.org (accessed on 14 September 2022).
  29. miRDB. Available online: http://mirdb.org (accessed on 14 September 2022).
  30. TargetScan. Available online: http://www.targetscan.org/vert_72/ (accessed on 14 September 2022).
  31. Doukas, S.G.; Vagelim, D.P.; Lazopoulos, G.; Spandidos, D.A.; Sasaki, C.T.; Tsatsakis, A. The Effect of NNK, A Tobacco Smoke Carcinogen, on the miRNA and Mismatch DNA Repair Expression Profiles in Lung and Head and Neck Squamous Cancer Cells. Cells 2020, 9, 1031. [Google Scholar] [CrossRef]
  32. Chen, C.; Pan, Y.; Bai, L.; Chen, H.; Duan, Z.; Si, Q.; Zhu, R.; Chuang, T.H.; Luo, Y. MicroRNA-3613-3p functions as a tumor suppressor and represents a novel therapeutic target in breast cancer. Breast Cancer Res. 2021, 23, 12. [Google Scholar] [CrossRef]
  33. Zhang, D.; Liu, E.; Kang, J.; Yang, X.; Liu, H. MiR-3613-3p affects cell proliferation and cell cycle in hepatocellular carcinoma. Oncotarget 2017, 8, 93014–93028. [Google Scholar] [CrossRef]
  34. Yan, W.; Yang, W.; Liu, Z.; Wu, G. Characterization of microRNA expression in primary human colon adenocarcinoma cells (SW480) and their lymph node metastatic derivatives (SW620). Onco Targets Ther. 2018, 11, 4701–4709. [Google Scholar] [CrossRef]
  35. Pu, Q.; Huang, Y.; Lu, Y.; Peng, Y.; Zhang, J.; Feng, G.; Wang, C.; Liu, L.; Dai, Y. Tissue-specific and plasma microRNA profiles could be promising biomarkers of histological classification and TNM stage in non-small cell lung cancer. Thorac. Cancer 2016, 7, 348–354. [Google Scholar] [CrossRef]
  36. Song, J.; Wang, W.; Wang, Y.; Qin, Y.; Wang, Y.; Zhou, J.; Wang, X.; Zhang, Y.; Wang, Q. Epithelial-mesenchymal transition markers screened in a cell-based model and validated in lung adenocarcinoma. BMC Cancer 2019, 19, 680. [Google Scholar] [CrossRef] [PubMed]
  37. Luo, X.; Zhang, X.; Peng, J.; Chen, Y.; Zhao, W.; Jiang, X.; Su, L.; Xie, M.; Lin, B. miR-371b-5p promotes cell proliferation, migration and invasion in non-small cell lung cancer via SCAI. Biosci. Rep. 2020, 40, BSR20200163. [Google Scholar] [CrossRef]
  38. Liu, R.Y.; Diao, C.F.; Zhang, Y.; Wu, N.; Wan, H.Y.; Nong, X.Y.; Liu, M.; Tang, H. miR-371-5p down-regulates pre mRNA processing factor 4 homolog B (PRPF4B) and facilitates the G1/S transition in human hepatocellular carcinoma cells. Cancer Lett. 2013, 335, 351–360. [Google Scholar] [CrossRef] [PubMed]
  39. Li, W.; Li, Y.; Ma, W.; Zhou, J.; Sun, Z.; Yan, X. Long noncoding RNA AC114812.8 promotes the progression of bladder cancer through miR-371b-5p/FUT4 axis. Biomed. Pharmacother. 2020, 121, 109605. [Google Scholar] [CrossRef] [PubMed]
  40. Li, Y.; Lv, Z.; He, G.; Wang, J.; Zhang, X.; Lu, G.; Ren, X.; Wang, F.; Zhu, X.; Ding, Y.; et al. The SOX17/miR-371-5p/SOX2 axis inhibits EMT, stem cell properties and metastasis in colorectal cancer. Oncotarget 2015, 6, 9099–9112. [Google Scholar] [CrossRef]
  41. Ullmann, P.; Rodriguez, F.; Schmitz, M.; Meurer, S.K.; Qureshi-Baig, K.; Felten, P.; Ginolhac, A.; Antunes, L.; Frasquilho, S.; Zügel, N.; et al. The miR-371~373 Cluster Represses Colon Cancer Initiation and Metastatic Colonization by Inhibiting the TGFBR2/ID1 Signaling Axis. Cancer Res. 2018, 78, 3793–3808. [Google Scholar] [CrossRef] [PubMed]
  42. Chen, Y.J.; Wang, H.F.; Liang, M.; Zou, R.C.; Tang, Z.R.; Wang, J.S. Upregulation of miR-3658 in bladder cancer and tumor progression. Genet. Mol. Res. 2016, 15, gmr15049048. [Google Scholar] [CrossRef]
  43. Goh, J.N.; Loo, S.Y.; Datta, A.; Siveen, K.S.; Yap, W.N.; Cai, W.; Shin, E.M.; Wang, C.; Kim, J.E.; Chan, M.; et al. microRNAs in breast cancer: Regulatory roles governing the hallmarks of cancer. Biol. Rev. Camb. Philos. Soc. 2016, 91, 409–428. [Google Scholar] [CrossRef]
  44. Jeczen, R.; Skomra, D.; Cybulski, M.; Schneider-Stock, R.; Szewczuk, W.; Roessner, A.; Rechberger, T.; Semczuk, A. P53/MDM2 overexpression in metastatic endometrial cancer: Correlation with clinicopathological features and patient outcome. Clin. Exp. Metastasis 2007, 24, 503–511. [Google Scholar] [CrossRef]
  45. Meng, X.; Franklin, D.A.; Dong, J.; Zhang, Y. MDM2-p53 pathway in hepatocellular carcinoma. Cancer Res. 2014, 74, 7161–7167. [Google Scholar] [CrossRef] [PubMed]
  46. Roszak, A.; Misztal, M.; Sowińska, A.; Jagodziński, P.P. Murine Double-Minute 2 Homolog Single Nucleotide Polymorphisms 285 and 309 in Cervical Carcinogenesis. Mol. Diagn. Ther. 2015, 19, 235–244. [Google Scholar] [CrossRef] [PubMed]
  47. Lu, X.; Yan, C.; Huang, Y.; Shi, D.; Fu, Z.; Qiu, J.; Yin, Y. Mouse double minute 2 (MDM2) upregulates Snail expression and induces epithelial-to-mesenchymal transition in breast cancer cells in vitro and in vivo. Oncotarget 2016, 7, 37177–37191. [Google Scholar] [CrossRef]
  48. Chen, Y.; Wang, D.D.; Wu, Y.P.; Su, D.; Zhou, T.Y.; Gai, R.H.; Fu, Y.Y.; Zheng, L.; He, Q.J.; Zhu, H.; et al. MDM2 promotes epithelial-mesenchymal transition and metastasis of ovarian cancer SKOV3 cells. Br. J. Cancer 2017, 117, 1192–1201. [Google Scholar] [CrossRef] [PubMed]
  49. Qiu, W.; Xia, X.; Qiu, Z.; Guo, M.; Yang, Z. RasGRP3 controls cell proliferation and migration in papillary thyroid cancer by regulating the Akt-MDM2 pathway. Gene 2017, 633, 35–41. [Google Scholar] [CrossRef]
  50. Liu, L.; Yang, L.; Chang, H.; Chen, Y.N.; Zhang, F.; Feng, S.; Peng, J.; Ren, C.C.; Zhang, X.A. CP-31398 attenuates endometrial cancer cell invasion, metastasis and resistance to apoptosis by downregulating MDM2 expression. Int. J. Oncol. 2019, 54, 942–954. [Google Scholar] [CrossRef]
  51. Carroll, P.E.; Okuda, M.; Horn, H.F.; Biddinger, P.; Stambrook, P.J.; Gleich, L.L.; Li, Y.Q.; Tarapore, P.; Fukasawa, K. Centrosome hyperamplification in human cancer: Chromosome instability induced by p53 mutation and/or Mdm2 overexpression. Oncogene 1999, 18, 1935–1944. [Google Scholar] [CrossRef]
  52. Friesland, S.; Kanter-Lewensohn, L.; Tell, R.; Munck-Wikland, E.; Lewensohn, R.; Nilsson, A. Expression of Ku86 confers favorable outcome of tonsillar carcinoma treated with radiotherapy. Head Neck 2003, 25, 313–321. [Google Scholar] [CrossRef]
  53. Valentin-Vega, Y.A.; Barboza, J.A.; Chau, G.P.; El-Naggar, A.K.; Lozano, G. High levels of the p53 inhibitor MDM4 in head and neck squamous carcinomas. Hum. Pathol. 2007, 38, 1553–1562. [Google Scholar] [CrossRef]
  54. Mastronikolis, N.; Ragos, V.; Fotiades, P.; Papanikolaou, V.; Kyrodimos, E.; Chrysovergis, A.; Mastronikolis, S.; Tsiambas, E. mdm2 oncogene in laryngeal squamous cell carcinoma. J. BUON 2020, 25, 594–596. [Google Scholar]
  55. Pichiorri, F.; Suh, S.S.; Rocci, A.; De Luca, L.; Taccioli, C.; Santhanam, R.; Zhou, W.; Benson, D.M., Jr.; Hofmainster, C.; Alder, H.; et al. Downregulation of p53-inducible microRNAs 192, 194, and 215 impairs the p53/MDM2 autoregulatory loop in multiple myeloma development. Cancer Cell 2010, 18, 367–381. [Google Scholar] [CrossRef] [PubMed]
  56. Giovannini, C.; Minguzzi, M.; Baglioni, M.; Fornari, F.; Giannone, F.; Ravaioli, M.; Cescon, M.; Chieco, P.; Bolondi, L.; Gramantieri, L. Suppression of p53 by Notch3 is mediated by Cyclin G1 and sustained by MDM2 and miR-221 axis in hepatocellular carcinoma. Oncotarget 2014, 5, 10607–10620. [Google Scholar] [CrossRef] [PubMed]
  57. Li, X.; Li, Y.; Wan, L.; Chen, R.; Chen, F. miR-509-5p inhibits cellular proliferation and migration via targeting MDM2 in pancreatic cancer cells. Oncol. Targets Ther. 2017, 10, 4455–4464. [Google Scholar] [CrossRef]
  58. Kim, Y.J.; Lee, J.H.; Jin, S.; Kim, J.H.; Kim, S.H. Primate-specific miR-944 activates p53-dependent tumor suppression in human colorectal cancers. Cancer Lett. 2019, 440–441, 168–179. [Google Scholar] [CrossRef] [PubMed]
  59. Chen, W.; Hong, L.; Hou, C.; Wang, Y.; Wang, F.; Zhang, J. MicroRNA-585 inhibits human glioma cell proliferation by directly targeting MDM2. Cancer Cell Int. 2020, 20, 469. [Google Scholar] [CrossRef]
  60. Sha, M.X.; Huang, X.W.; Yin, Q. MiR-548b-3p inhibits proliferation and migration of breast cancer cells by targeting MDM2. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 3105–3112. [Google Scholar]
  61. Wang, Y.; Zhao, J.; Zhang, C.; Wang, P.; Huang, C.; Peng, H. MiR-219a-2-3p suppresses cell proliferation and promotes apoptosis by targeting MDM2/p53 in pituitary adenomas cells. Biosci. Biotechnol. Biochem. 2020, 84, 911–918. [Google Scholar] [CrossRef]
  62. Weidle, U.H.; Birzele, F.; Auslaender, S.; Brinkmann, U. Down-regulated MicroRNAs in Gastric Carcinoma May Be Targets for Therapeutic Intervention and Replacement Therapy. Anticancer Res. 2021, 41, 4185–4202. [Google Scholar] [CrossRef]
  63. Asghariazar, V.; Kadkhodayi, M.; Mansoori, B.; Mohammadi, A.; Baradaran, B. Restoration of miR-143 reduces migration and proliferation of bladder cancer cells by regulating signaling pathways involved in EMT. Mol. Cell Probes. 2022, 61, 101794. [Google Scholar] [CrossRef]
  64. Mulcahy, E.Q.X.; Zhang, Y.; Colόn, R.R.; Cain, S.R.; Gibert, M.K., Jr.; Dube, C.J.; Hafner, M.; Abounader, R. MicroRNA 3928 Suppresses Glioblastoma through Downregulation of Several Oncogenes and Upregulation of p53. Int. J. Mol. Sci. 2022, 23, 3930. [Google Scholar] [CrossRef]
Biomedicines 11 03053 g001
Figure 1. The relative miR-3613-3p expression level in tumour and margin samples.
Figure 1. The relative miR-3613-3p expression level in tumour and margin samples.
Biomedicines 11 03053 g001
Biomedicines 11 03053 g002
Figure 2. The relative miR-3613-3p expression level in non-smokers and smokers.
Figure 2. The relative miR-3613-3p expression level in non-smokers and smokers.
Biomedicines 11 03053 g002
Biomedicines 11 03053 g003
Figure 3. The relative miR-3613-3p expression level in patients with T2 and T3.
Figure 3. The relative miR-3613-3p expression level in patients with T2 and T3.
Biomedicines 11 03053 g003
Biomedicines 11 03053 g004
Figure 4. The relative miR-3613-3p expression level in patients with N0 and N2.
Figure 4. The relative miR-3613-3p expression level in patients with N0 and N2.
Biomedicines 11 03053 g004
Biomedicines 11 03053 g005
Figure 5. The relative miR-3613-3p expression level in patients with G1 and G2.
Figure 5. The relative miR-3613-3p expression level in patients with G1 and G2.
Biomedicines 11 03053 g005
Biomedicines 11 03053 g006
Figure 6. The relative MDM2 gene expression level in the tumour and margin samples.
Figure 6. The relative MDM2 gene expression level in the tumour and margin samples.
Biomedicines 11 03053 g006
Table 1. Characteristics of the OSCC group.
Table 1. Characteristics of the OSCC group.
ParametersPatients, n (%)
Age (median): 62.5 (range: 27–87 years)
Gender
Men38 (76)
Women12 (24)
Smoking
Smokers28 (56)
Non-smokers22 (44)
Alcohol consumption
Drinker27 (54)
Non-drinker23 (46)
Both smokers and alcohol users17 (34)
HPV status
HPV-positive13 (26)
HPV-negative37 (74)
T classification
T110 (20)
T223 (46)
T316 (32)
T41 (2)
Nodal status
N024 (48)
N12 (4)
N220 (40)
N34 (8)
Histological grading
G19 (18)
G223 (46)
G318 (36)
Patient status at 3 years
Alive12 (24)
Dead38 (76)
Table 2. Sequences of analysed miRNAs.
Table 2. Sequences of analysed miRNAs.
miRNAMature miRNA Sequence
miR-3613-3pACAAAAAAAAAAGCCCAACCCUUC
miR-371b-5pACUCAAAAGAUGGCGGCACUUU
miR-3658UUUAAGAAAACACCAUGGAGAU
miR-361-5p
(Housekeeping control)		UUAUCAGAAUCUCCAGGGGUAC
Table 3. Correlation between the expressions of miR-3613-3p and MDM2 gene in tumour and margin samples.
Table 3. Correlation between the expressions of miR-3613-3p and MDM2 gene in tumour and margin samples.
TumourMargin
Spearman’s rank correlation coefficient
miR-3613-3p
MDM2 gene0.680.49
p-value
miR-3613-3p
MDM2 gene0.070.11
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gołąbek, K.; Hudy, D.; Gaździcka, J.; Miśkiewicz-Orczyk, K.; Nowak-Chmura, M.; Asman, M.; Komosińska-Vassev, K.; Ścierski, W.; Golusiński, W.; Misiołek, M.; et al. The Analysis of Selected miRNAs and Target MDM2 Gene Expression in Oral Squamous Cell Carcinoma. Biomedicines 2023, 11, 3053. https://doi.org/10.3390/biomedicines11113053

AMA Style

Gołąbek K, Hudy D, Gaździcka J, Miśkiewicz-Orczyk K, Nowak-Chmura M, Asman M, Komosińska-Vassev K, Ścierski W, Golusiński W, Misiołek M, et al. The Analysis of Selected miRNAs and Target MDM2 Gene Expression in Oral Squamous Cell Carcinoma. Biomedicines. 2023; 11(11):3053. https://doi.org/10.3390/biomedicines11113053

Chicago/Turabian Style

Gołąbek, Karolina, Dorota Hudy, Jadwiga Gaździcka, Katarzyna Miśkiewicz-Orczyk, Magdalena Nowak-Chmura, Marek Asman, Katarzyna Komosińska-Vassev, Wojciech Ścierski, Wojciech Golusiński, Maciej Misiołek, and et al. 2023. "The Analysis of Selected miRNAs and Target MDM2 Gene Expression in Oral Squamous Cell Carcinoma" Biomedicines 11, no. 11: 3053. https://doi.org/10.3390/biomedicines11113053

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop