Next Article in Journal
The Structural and Functional Study of Efflux Pumps Belonging to the RND Transporters Family from Gram-Negative Bacteria
Next Article in Special Issue
Effectiveness of Educational Interventions for Health Workers on Antibiotic Prescribing in Outpatient Settings in China: A Systematic Review and Meta-Analysis
Previous Article in Journal
Antimicrobial Susceptibility Testing: A Comprehensive Review of Currently Used Methods
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 11
Issue 4
10.3390/antibiotics11040428
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Safety of Consuming Water Dropwort Used to Purify Livestock Wastewater Considering Accumulated Antibiotics and Antibiotic Resistance Genes

by
Dongrui Yao
1,†,
Yajun Chang
1,†,
Wei Wang
1,
Linhe Sun
1,
Jixiang Liu
1,
Huijun Zhao
2 and
Weiguo Zhang
3,*
1
Jiangsu Key Laboratory for the Research and Utilization of Plant Resources, Institute of Botany, Jiangsu Province and Chinese Academy of Sciences (Nanjing Botanical Garden Memorial Sun Yat-Sen), Nanjing 210014, China
2
College of Geography and Environmental Science, Northwest Normal University, Lanzhou 730070, China
3
Institute of Agricultural Resources and Environment, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Antibiotics 2022, 11(4), 428; https://doi.org/10.3390/antibiotics11040428
Submission received: 23 January 2022 / Revised: 17 March 2022 / Accepted: 19 March 2022 / Published: 23 March 2022
(This article belongs to the Special Issue Antibiotics Use and Stewardship in China)
Browse Figures
Versions Notes

Abstract

:
Research is lacking on the health risks of antibiotics and antibiotic resistance genes (ARGs) in water dropwort grown in livestock wastewater. Our results showed that antibiotics from livestock wastewater were absorbed and bioaccumulated by water dropwort. The concentration of antibiotics was higher in the roots than in the stems and leaves. The health-risk coefficients of antibiotics in water dropwort were below the threshold (<0.1), indicating that in this case study, the consumption of water dropwort used to purify livestock wastewater was safe for humans considering accumulated antibiotics. ARGs were closely correlated between livestock wastewater and water dropwort, with the results showing that all 13 ARGs detected in the livestock wastewater were also found in the water dropwort. Tetracycline resistance genes were more abundant than the other ARGs in both the livestock wastewater and water dropwort. The estimated daily intake of ARGs in water dropwort for humans ranged from 2.06 × 106 to 7.75 × 1012 copies g−1, suggesting the potential risk of intaking ARGs in water dropwort cannot be ignored. Although the safety of consuming water dropwort used to purify livestock wastewater, considering accumulated antibiotics and ARGs, was assessed in this study, more studies should be conducted to ensure we fully understand the health risks.

1. Introduction

As the world’s most populous country, China has a huge demand for high-quality meat, eggs, and milk [1]. Large-scale livestock and poultry farming has rapidly developed, resulting in the production of livestock waste of up to 200 million tons per year, which has massive potential to cause pollution [2,3]. Therefore, phytoremediation has been widely applied to livestock wastewater [4,5]. The misuse of antibiotics in livestock breeding has caused antibiotic pollution in livestock waste [6,7]. Antibiotic residues in the environment can bioaccumulate in vegetables and crops, posing a threat to human health [8,9,10,11]. Moreover, an environment contaminated by antibiotics can exert selective pressure and lead to the emergence and enrichment of antibiotic resistance genes (ARGs). ARGs can be disseminated among microorganisms through vertical and horizontal gene transfer [12,13]. One Health emphasizes the organic unity of human, animal, and environmental health. Antibiotics and ARGs can accumulate and disseminate in humans, animals, and the environment, posing a risk to One Health. A growing number of studies have detected ARGs in a variety of agricultural products [14,15,16,17]. The application of livestock waste can increase ARGs in vegetables, indicating that ARGs migrate from contaminated environments to vegetables. Once the vegetables contaminated with ARGs are ingested by consumers, clinical pathogens of human or animals might acquire resistance to antibiotics, making some diseases more difficult to cure.
Water dropwort (Oenanthe javanica (Bl.) DC.) is a plant that can efficiently remove nitrogen and phosphorus from livestock wastewater as well as tolerate freezing temperatures [18,19]. Moreover, water dropwort is an edible vegetable that is a favorite in southeast Asia and China [20,21]. Phytoremediation of livestock wastewater with water dropwort can provide considerable ecological and economic benefits. Therefore, water dropwort has often been planted to purify and recycle livestock wastewater in recent years [22]. However, when plants absorb nitrogen and phosphorus from livestock wastewater, antibiotics are gradually accumulated. The antibiotics accumulated in plants induce a selective pressure of ARGs on the endophytic bacteria, which can also acquire exogenous ARGs from the growth environment. If these plants are edible vegetables, they can pose a potential risk to consumer health. Therefore, it is urgent to assess the safety of consuming water dropwort used to purify livestock wastewater considering accumulated antibiotics and antibiotic resistance genes. This was the main objective of this study.

2. Materials and Methods

2.1. Experimental Design and Samples Collection

Livestock wastewater was collected from a cattle farm in Suqian City, Jiangsu Province, China (33°120′~34°250′ N, 117°60′~119°130′ E). The cattle farm where 1052 cows were fed covered 20.7 acres. Cattles Three’s cows were in a barn (5 × 4 m). The cows were fed mainly foraged grass supplemented by commercial feed. After flushing, cow manure was transferred to an ant-seepage pool (80 × 80 × 2 m). After wet and dry separation, the liquid part (wastewater) was placed into cement pools (10 × 5 × 1.6 m), where water dropwort was planted in floating beds (6 × 6 m) on 16 May 2021 and harvested on 25 July 2021. The sterilized nutrient solution was used to grow water dropwort seedlings. Before transplanting, the antibiotics and ARGs in water dropwort seedlings were detected to rule out the effects of self-carrying antibiotics and ARGs. The determination method is described in Section 2.2. Only water dropwort seedlings without these contaminants were used in this study. There was a total of 20 pools at the farm. Seventeen pools, with a floating bed in each pool, were used to grow water dropwort. The control group was the remaining 3 pools where no water dropwort was planted, and their role in this research was to provide the water samples. Three of the seventeen pools were randomly selected to collect water dropwort samples. Twenty water dropwort plants with similar growth characteristics were randomly collected from each pool. The size of each sample was determined by a ruler and a vernier caliper in order to screen for water dropwort plants with similar growth. Meanwhile, livestock water samples were collected from the pools without water dropwort growth (0–30 cm depth). In detail, three sites in each pool were set to collect livestock wastewater. The distance between the sites was at least 2 m. The livestock wastewater samples from the same pool were mixed together. After being placed into an icebox, the water and plant samples were transported to the laboratory. All the samples were immediately pretreated to prepare for the determination of antibiotics and DNA extraction. In general, the group of wastewater contained the water samples collected from 3 pools with 3 sampling sites each; the group of water dropwort (stem and root) contained the plants samples collected from 3 pools with the collection of 20 water dropwort plants each.

2.2. Determination Methods of Antibiotics

Water samples were simultaneously concentrated using solid-phase extraction (SPE, Oasis HLB cartridges, Waters, MA, USA) coupled with ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS). Detailed information about the procedures, including UHPLC-MS/MS parameters, was presented in a previously published method [23]. Plant tissue samples were freeze-dried and ground to fine particles, 0.5 g of which was used for the analysis of antibiotics. Antibiotics in samples were extracted first by liquid-solid extraction using acetonitrile and then by solid-phase extraction using Oasis HLB extraction cartridges (Waters, Milford, MA, USA), according to Yang et al. [24]. The extract was passed through a 0.22 µm membrane filter, and the concentration of antibiotics was analyzed using an ultra-performance liquid chromatography tandem mass spectrometer, according to Gros et al. [25].

2.3. DNA Extraction and Real-Time Fluorescent Quantitative Polymerase Chain Reaction (RT-qPCR)

DNA was extracted from 100 mL livestock wastewater samples using a FastDNA SPIN Kit (MP Bio, Santa Ana, CA, USA). Three water dropwort plants from the same pool were placed into a 1000 mL beaker containing 700 mL sterilized phosphate-buffered saline (0.01 M, pH 7.4) and sonicated for 10 min. Flasks were shaken for 0.5 h at 150 rpm and 30 ℃. After being washed, the roots were separated from stems and leaves with a sterilized blade. The methods for DNA extraction from roots, stems, and leaves followed those described by Mei et al. [14]. RT-qPCR was used to determine the abundance of ARGs. The detailed information of the 13 primer sets is provided in Table 1. PCR amplification was conducted using an ABI-7500 (Applied Biosystems, Inc., Carlsbad, CA, USA). The parameters of amplification and the analysis of results followed the protocol used by Su et al. [26]. The absolute abundance of ARGs was normalized to the number of 16S rRNA gene copies [27,28].

2.4. Potential Health Risk Assessment

The bioaccumulation factor (BAF) was used to quantify the antibiotic enrichment capacity of the roots and stems/leaves of the water dropwort compared to the livestock wastewater. The detailed calculation was described by Mei et al. [14].
BAF = Cplant/Cwastewater
where Cplant is the concentration of roots or stems/leaves and Cwastewater is the concentration of livestock wastewater.
The ratios of estimated daily intake (EDI) to acceptable daily intake (ADI) for each antibiotic were calculated to assess their respective potential risks to adults and children. At present, the hazard quotient (the ratio of EDI to ADI) is still used to evaluate the risk of antibiotics, and the value ≥ 0.1 was set as posing a threat to human health [29,30,31,32]. The detailed calculations of the potential health risks of antibiotics were described by Hanna et al. [32]. The estimated daily intake of ARGs (EIARGs) when consuming water dropwort was calculated following Mei et al. [14].
EIARGs = GCN/g × Wintake
where GCN/g is the gene copy number of ARGs per gram of water dropwort and Wintake is the weight of vegetable daily intake.

2.5. Statistical Analysis

Data were analyzed with the statistical software SPSS 26.0 (SPSS Inc., Chicago, IL, USA). The mean comparison was performed between wastewater, roots, and stems and leaves. To find the significant differences between wastewater, roots, and stems and leaves and to eliminate type I and type II error, a one-way analysis of variance (ANOVA) with Duncan’s test was used (p < 0.05). The heatmap was visualized in the R software environment with the pheatmap package [33]. The other figures were constructed in Origin 9.0 (OriginLab Corporation, Northampton, MA, USA).

3. Results and discussion

3.1. Bioaccumulation of Antibiotics in Water Dropwort and Potential Health Risks to Humans

China is the world’s largest producer and consumer of antibiotics, 46.1% of which are used in the animal feed industry [11]. Most of these antibiotics are discharged into the environment through livestock waste. Vegetables can absorb and bioaccumulate antibiotics from the environment, which threatens human health if consumed [8,9]. Most consumers in China like to eat the stems and leaves of water dropwort; however, a considerable number of consumers like to eat the roots, which are regarded as a traditional Chinese medicine to cure some chronic diseases such as hypertension, hyperlipidemia, insomnia, etc. [34,35]. Our results showed that both the roots and stems and leaves absorbed and accumulated the antibiotics from the livestock wastewater. The concentrations of tetracyclic antibiotics including oxytetracycline, doxycycline, tetracyclic, and chlortetracycline in roots and stems/leaves were 6.72 and 3.15, 10.39 and 2.89, 9.78 and 2.60, and 3.86 and 4.25 ng g−1, respectively. These concentrations were much higher than those of the other antibiotics. (Figure 1A, Table S1). The BAF was used to quantify the antibiotic enrichment capacity of the roots and stems and leaves of the water dropwort compared to that of the livestock wastewater. The BAF analysis showed that the antibiotic enrichment capacity of the roots was much stronger than that of the stems and leaves (Figure 1B, Table S2). Our results verified that the accumulation of antibiotics varied among plant organs [10]. Using the measured accumulation values, the potential health risk of water dropwort to human health was assessed. In this case study, the ratio of EDI to ADI was below the threshold (<0.1), indicating that consuming both the roots and the stems and leaves posed no antibiotic risk to human health (Figure 2). However, further case studies should be conducted to comprehensively evaluate the health risks of water dropwort used to purify livestock wastewater.

3.2. ARGs in Water Dropwort and Potential Risk to Human Health

A growing number of studies have detected ARGs in a variety of agricultural products [14,15,16,17]. The application of livestock waste can increase the ARGs in vegetables, indicating that ARGs migrate from contaminated environments to vegetables [14,36,37]. This migration mechanism might function via (1) environmental bacteria that colonize roots, migrating up and colonizing the interiors of stems, leaves, and fruits [38]; or (2) the antibiotic-resistant bacteria from water, soil, and air directly attaching to the exterior of vegetables and then colonizing [15,39,40]. Compared to the bulk environment, the micro-zones around the rhizosphere harbored higher abundances of ARGs in some plants, such as soybean, rice, lettuce, maize, and ryegrass [41]. All 13 ARGs, including tetA, tetG, tetO, tetQ, tetW, sul1, sul2, blaOXA-1, blaPSE, blaTEM, ermA, ermB, and ermF, detected in livestock wastewater were also found in water dropwort, verifying the close correlation of ARGs between the plants and their growth environments [14,16,42]. In this study, we found the abundance of tetracycline antibiotics was higher than that of the other antibiotics in both livestock wastewater and water dropwort. This would induce a stricter selective pressure on the emergence and enrichment of ARGs encoding resistance to tetracycline antibiotics in these environments. Therefore, compared to the other ARGs in this study, the abundance of ARGs encoding resistance to tetracycline antibiotics was higher, especially that of tetW with 6.85 × 1011, 2.81 × 1010, and 4.66 × 109 copies g−1 in livestock wastewater, roots, and stems and leaves, respectively (Figure 3). In this case study, the higher abundance of ARGs encoding resistance to tetracycline antibiotics than that of the other genes might be attributed to the higher residual concentration of tetracycline antibiotics, as well as the highly sensitive nature of bacteria in wastewater to tetracycline antibiotics. Twelve ARGs were more abundant in the livestock wastewater than in the water dropwort, except sul2, and the abundance of all thirteen ARGs was much higher in the roots than in the stems and leaves.
The EIARGs is used to assess the health risks of ARGs in agricultural products [14,43]. In this study, the EIARGs of roots for adults ranged from 2.57 × 108 to 7.75 × 1012 copies g−1, while the EIARGs of roots for children ranged from 2.12 × 108 to 6.40 × 1012 copies g−1. The EIARGs of stems and leaves for adults ranged from 2.50 × 106 to 1.29 × 1012 copies g−1, while the EIARGs of stems and leaves for children ranged from 2.06 × 106 to 1.06 × 1012 copies g−1. In general, the EIARGs values of roots were higher than those of stems and leaves (Figure 4). Although the exact effects and mechanisms of ingesting exogenous ARGs on human health are unclear, many studies have indicated that intestinal microbiota can acquire exogenous ARGs via horizontal gene transfer [14,15,16,17]. If exogenous ARGs are acquired by pathogenic bacteria, it would be detrimental to curing diseases. Therefore, our results suggested that the ARGs’ contamination of the water dropwort used to purify livestock wastewater should be paid more attention.

4. Conclusions

A case study was conducted to explore how antibiotics bioaccumulate and the abundance of ARGs change in water dropwort grown in livestock wastewater. Furthermore, their potential risks posed to human health were also assessed. Water dropwort absorbed and bioaccumulated considerable amounts of antibiotics from livestock wastewater. The concentrations of antibiotics varied among the organs of water dropwort and were higher in the roots than in the stems and leaves. The human health risk assessment showed that the ratios of EDI to ADI of the antibiotics in water dropwort were below the safety threshold. This case study indicated that the consumption of water dropwort would be safe when considering the intake of the antibiotics. However, further case studies should be conducted to provide more data to comprehensively evaluate the health risks of the water dropwort used to purify livestock wastewater. All 13 ARGs detected in the livestock wastewater were also found in the water dropwort, suggesting the close correlation of ARGs between livestock wastewater and water dropwort. Tetracycline resistance genes were much more abundant than the other ARGs in livestock wastewater and water dropwort. The estimated daily intake of ARGs for human was calculated with a wide range from 2.06 × 106 to 7.75 × 1012 copies g−1. Once exogenous ARGs are acquired by pathogenic bacteria, it would be detrimental to curing diseases. Our study provides a perspective to assess the safety of consuming water dropwort used to purify livestock wastewater considering accumulated antibiotics and antibiotic resistance genes.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/antibiotics11040428/s1, Table S1: The concentrations of antibiotics in livestock wastewater and water dropwort. Different letters indicate significant differences between livestock wastewater, roots, and stems and leaves (p < 0.05); Table S2: The antibiotic enrichment capacities of roots and stems/leaves. Different letters indicate significant differences between livestock wastewater, roots, and stems and leaves (p < 0.05). BAF = Cplant/Cwastewater, where Cplant is the concentration of roots or stems and leaves and Cwastewater is the concentration of livestock wastewater.

Author Contributions

Conceptualization, Y.C. and D.Y.; methodology, H.Z.; software, J.L.; validation, L.S. and W.W.; investigation, Y.C. and H.Z.; resources, W.Z.; data curation, W.Z.; writing—original draft preparation, Y.C. and W.Z.; writing—review and editing, W.Z.; supervision and project administration, D.Y.; funding acquisition, Y.C. and D.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Jiangsu Agriculture Science and Technology Innovation Fund (no. CX(21)2012), the Jiangsu Science and Technology Project—Dedicated Fund for Northern Jiangsu (no. HAQFM202004), the Water Conservancy Technology Project of Water Resources Department of Jiangsu Province (no. 2021051), Six Talent Peaks Project in Jiangsu Province (no. TD-JNHB-008), and the National Natural Science Foundation of China (no. 31700437).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All the data supporting this article are included in the main text.

Acknowledgments

The authors are grateful to all laboratory members for their useful suggestions, support, and encouragement.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Sun, Z.C.; Yu, Q.L.; Han, L. The environmental prospects of cultured meat in China. J. Integr. Agric. 2015, 14, 234–240. [Google Scholar] [CrossRef] [Green Version]
  2. Bai, Z.; Ma, W.; Ma, L.; Velthof, G.L.; Wei, Z.; Havlík, P.; Oenema, O.; Lee, M.R.; Zhang, F. China’s livestock transition: Driving forces, impacts, and consequences. Sci. Adv. 2018, 4, eaar8534. [Google Scholar] [CrossRef] [Green Version]
  3. Yang, T.L.; Li, F.M.; Du, M.; Wang, Y.X.; Sun, Z.N. Measuring pollutant emissions of cattle breeding and its spatial-temporal variation in China. J. Environ. Manag. 2021, 299, 113615. [Google Scholar] [CrossRef]
  4. Schiavon, M.; Pilon-Smits, E.A.H. Selenium biofortification and phytoremediation phytotechnologies: A review. J. Environ. Qual. 2016, 46, 10–19. [Google Scholar] [CrossRef] [Green Version]
  5. Hu, H.; Li, X.; Wu, S.H.; Yang, C.P. Sustainable livestock wastewater treatment via phytoremediation: Current status and future perspectives. Bioresour. Technol. 2020, 315, 123809. [Google Scholar] [CrossRef]
  6. Hong, P.Y.; Al-Jassim, N.; Ansari, M.I.; Mackie, R. Environmental and public health implications of water reuse: Antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes. Antibiotics 2013, 2, 367–399. [Google Scholar] [CrossRef] [Green Version]
  7. Gaballah, M.S.; Guo, J.; Sun, H.; Aboagye, D.; Sobhi, M.; Muhmood, A.; Dong, R. A review targeting veterinary antibiotics removal from livestock manure management systems and future outlook. Bioresour. Technol. 2021, 333, 125069. [Google Scholar] [CrossRef]
  8. Kang, D.H.; Gupta, S.; Rosen, C.; Fritz, V.; Singh, A.; Chander, Y.; Murray, H.; Rohwer, C. Antibiotic uptake by vegetable crops from manure-applied soils. J. Agric. Food. Chem. 2013, 61, 9992–10001. [Google Scholar] [CrossRef]
  9. Ahmed, M.B.M.; Rajapaksha, A.U.; Lim, J.E.; Vu, N.T.; Kim, I.S.; Kang, H.M.; Lee, S.S.; Ok, Y.S. Distribution and accumulative pattern of tetracyclines and sulfonamides in edible vegetables of cucumber, tomato, and lettuce. J. Agric. Food. Chem. 2014, 63, 398–405. [Google Scholar] [CrossRef]
  10. Yu, X.; Liu, H.; Pu, C.; Chen, J.; Sun, Y.; Hu, L. Determination of multiple antibiotics in leafy vegetables using QuEChERS-UHPLC-MS/MS. J. Sep. Sci. 2018, 41, 713–722. [Google Scholar] [CrossRef]
  11. Sun, Y.; Guo, Y.; Shi, M.; Qiu, T.; Gao, M.; Tian, S.; Wang, X. Effect of antibiotic type and vegetable species on antibiotic accumulation in soil-vegetable system, soil microbiota, and resistance genes. Chemosphere 2020, 263, 128099. [Google Scholar] [CrossRef]
  12. Gogarten, J.P.; Townsend, J.P. Horizontal gene transfer, genome innovation and evolution. Nat. Rev. Microbiol. 2005, 3, 679–687. [Google Scholar] [CrossRef]
  13. Gillings, M.R.; Gaze, W.H.; Pruden, A.; Smalla, K.; Tiedje, J.M.; Zhu, Y.G. Using the class 1 integron-integrase gene as a proxy for anthropogenic pollution. ISME J. 2015, 9, 1269–1279. [Google Scholar] [CrossRef]
  14. Mei, Z.; Xiang, L.; Wang, F.; Xu, M.; Fu, Y.; Wang, Z.; Hashsham, S.A.; Jiang, X.; Tiedje, J.M. Bioaccumulation of manure-borne antibiotic resistance genes in carrot and its exposure assessment. Environ. Int. 2021, 157, 106830. [Google Scholar] [CrossRef]
  15. Marti, R.; Scott, A.; Tien, Y.C.; Murray, R.; Sabourin, L.; Zhang, Y.; Topp, E. Impact of manure fertilization on the abundance of antibiotic-resistant bacteria and frequency of detection of antibiotic resistance genes in soil and on vegetables at harvest. Appl. Environ. Microbiol. 2013, 79, 5701–5709. [Google Scholar] [CrossRef] [Green Version]
  16. Zhu, B.; Chen, Q.; Chen, S.; Zhu, Y.G. Does organically produced lettuce harbor higher abundance of antibiotic resistance genes than conventionally produced? Environ. Int. 2017, 98, 152–159. [Google Scholar] [CrossRef] [PubMed]
  17. Zhu, D.; Giles, M.; Yang, X.R.; Daniell, T.; Neilson, R.; Zhu, Y.G. Phyllosphere of staple crops under pig manure fertilization, a reservoir of antibiotic resistance genes. Environ. Pollut. 2019, 252, 227–235. [Google Scholar] [CrossRef]
  18. Zhou, X.; Wang, G. Nutrient concentration variations during Oenanthe javanica growth and decay in the ecological floating bed system. J. Environ. Sci. 2010, 22, 1710–1717. [Google Scholar] [CrossRef]
  19. Song, S.; Wang, P.; Liu, Y.; Zhao, D.; Leng, X.; An, S. Effects of Oenanthe javanica on nitrogen removal in free-water surface constructed wetlands under low-temperature conditions. Int. J. Environ. Res. Public Health 2019, 16, 1420. [Google Scholar] [CrossRef] [Green Version]
  20. Jiang, Q.; Wang, F.; Tan, H.W.; Li, M.Y.; Xu, Z.S.; Tan, G.F.; Xiong, A.S. De novo transcriptome assembly, gene annotation, marker development, and miRNA potential target genes validation under abiotic stresses in Oenanthe javanica. Mol. Genet. Genom. 2015, 290, 671–683. [Google Scholar] [CrossRef] [PubMed]
  21. Feng, K.; Xu, Z.S.; Que, F.; Liu, J.X.; Wang, F.; Xiong, A.S. An R2R3-MYB transcription factor, OjMYB1, functions in anthocyanin biosynthesis in Oenanthe javanica. Planta 2018, 247, 301–315. [Google Scholar] [CrossRef] [PubMed]
  22. Sun, L.H.; Zhao, H.J.; Liu, J.X.; Li, B.; Chang, Y.J.; Yao, D.R. A new green model for the bioremediation and resource utilization of livestock wastewater. Int. J. Environ. Res. Public Health 2020, 18, 8634. [Google Scholar] [CrossRef] [PubMed]
  23. Hu, Y.; Jiang, L.; Zhang, T.; Jin, L.; Han, Q.; Zhang, D.; Lin, K.; Cui, C. Occurrence and removal of sulfonamide antibiotics and antibiotic resistance genes in conventional and advanced drinking water treatment processes. J. Hazard. Mater. 2018, 360, 364–372. [Google Scholar] [CrossRef] [PubMed]
  24. Yang, J.F.; Ying, G.G.; Zhao, J.L.; Tao, R.; Su, H.C.; Chen, F. Simultaneous determination of four classes of antibiotics in sediments of the pearl rivers using RRLC–MS/MS. Sci. Total Environ. 2010, 408, 3424–3432. [Google Scholar] [CrossRef] [PubMed]
  25. Gros, M.; Rodríguez-Mozaz, S.; Barceló, D. Rapid analysis of multiclass antibiotic residues and some of their metabolites in hospital, urban wastewater and river water by ultra-high-performance liquid chromatography coupled to quadrupole-linear ion trap tandem mass spectrometry. J. Chromatogr. A. 2013, 1292, 173–188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Su, J.Q.; Wei, B.; Ou-Yang, W.Y.; Huang, F.Y.; Zhao, Y.; Xu, H.J.; Zhu, Y.G. Antibiotic resistome and its association with bacterial communities during sewage sludge composting. Environ. Sci. Technol. 2015, 49, 7356–7363. [Google Scholar] [CrossRef]
  27. Looft, T.; Johnson, T.A.; Allen, H.K.; Bayles, D.O.; Alt, D.P.; Stedtfeld, R.D.; Sul, W.J.; Stedtfeld, T.M.; Chai, B.; Cole, J.R.; et al. In-feed antibiotic effects on the swine intestinal microbiome. Proc. Natl. Acad. Sci. USA 2012, 109, 1691–1696. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Wang, F.H.; Qiao, M.; Su, J.Q.; Chen, Z.; Zhou, X.; Zhu, Y.G. High throughput profiling of antibiotic resistance genes in urban park soils with reclaimed water irrigation. Environ. Sci. Technol. 2014, 48, 9079–9085. [Google Scholar] [CrossRef]
  29. SPN. Assessing exposure from pesticides in food. In A User’s Guide; Pest Management Regulatory Agency: Ottawa, ON, Canada, 2003. [Google Scholar]
  30. USFDA. Chapter 1-Food and Drug Administration, Department of Health and Human Services, Sub-chapter E-Animal Drugs, Feeds, and Related Products, Part 556-Tolerances for Residues of New Animal Drugs in Food-Sub-Part B-Specific Tolerance for Residues of New Animal Drugs-Section 556.286-Flunixin; United States Food and Drug Administration: Washington, DC, USA, 2022.
  31. WHO. Guidelines for Predicting Dietary Intake of Pesticide Residues; (WHO/FSF/FOS/97.7); WHO: Geneva, Switzerland, 1997.
  32. Hanna, N.; Sun, P.; Sun, Q.; Li, X.; Yang, X.; Ji, X.; Zou, H.; Ottoson, J.; Nilsson, L.E.; Berglund, B.; et al. Presence of antibiotic residues in various environmental compartments of Shandong province in eastern China: Its potential for resistance development and ecological and human risk. Environ. Int. 2018, 114, 131–142. [Google Scholar] [CrossRef]
  33. Zhang, W.G.; Wen, T.; Liu, L.Z.; Li, J.Y.; Gao, Y.; Zhu, D.; He, J.Z.; Zhu, Y.G. Agricultural land-use change and rotation system exert considerable influences on the soil antibiotic resistome in Lake Tai Basin. Sci. Total Environ. 2021, 771, 144848. [Google Scholar] [CrossRef]
  34. Xiang, X.; Zhou, L.; Ma, C.; Jiang, H.; Hou, J.; Zhou, X. Sedative and hypnotic effects of water dropwort extract. Acta Chin. Med. 2019, 34, 1244–1247. (In Chinese) [Google Scholar]
  35. Park, J.C.; Choi, J.W. Effects of methanol extract of Oenanthe javanica on the hepatic alcohol-metabolizing enzyme system and its bioactive component. Phytother. Res. 2015, 11, 260–262. [Google Scholar] [CrossRef]
  36. Duan, M.; Li, H.; Gu, J.; Tuo, X.; Sun, W.; Qian, X.; Wang, X. Effects of biochar on reducing the abundance of oxytetracycline, antibiotic resistance genes, and human pathogenic bacteria in soil and lettuce. Environ. Pollut. 2017, 224, 787–795. [Google Scholar] [CrossRef]
  37. Chen, Q.L.; Fan, X.T.; Zhu, D.; An, X.L.; Su, J.Q.; Cui, L. Effect of biochar amendment on the alleviation of antibiotic resistance in soil and phyllosphere of Brassica chinensis L. Soil Biol. Biochem. 2018, 119, 74–82. [Google Scholar] [CrossRef]
  38. Chi, F.; Shen, S.H.; Cheng, H.P.; Jing, Y.X.; Yanni, Y.G.; Dazzo, F.B. Ascending migration of endophytic rhizobia, from roots to leaves, inside rice plants and assessment of benefits to rice growth physiology. Appl. Environ. Microbiol. 2005, 71, 7271–7278. [Google Scholar] [CrossRef] [Green Version]
  39. Liu, H.; Carvalhais, L.C.; Crawford, M.; Singh, E.; Dennis, P.G.; Pieterse, C.M.; Schenk, P.M. Inner plant values: Diversity, colonization and benefits from endophytic bacteria. Front. Microbiol. 2017, 8, 2552. [Google Scholar] [CrossRef]
  40. Zhang, Y.J.; Hu, H.W.; Chen, Q.L.; Yan, H.; Wang, J.T.; Chen, D.; He, J.Z. Manure application did not enrich antibiotic resistance genes in root endophytic bacterial microbiota of cherry radish plants. Appl. Environ. Microbiol. 2020, 86, 12. [Google Scholar] [CrossRef]
  41. Song, M.; Peng, K.; Jiang, L.; Zhang, D.; Song, D.; Chen, G.; Xu, H.; Li, Y.; Luo, C. Alleviated antibiotic-resistant genes in the rhizosphere of agricultural soils with low antibiotic concentration. J. Agric. Food. Chem. 2020, 68, 2457–2466. [Google Scholar] [CrossRef]
  42. Du, S.; Shen, J.P.; Hu, H.W.; Wang, J.T.; Han, L.L.; Sheng, R.; Wei, W.X.; Fang, Y.T.; Zhu, Y.G.; Zhang, L.M.; et al. Large-scale patterns of soil antibiotic resistome in Chinese croplands. Sci. Total Environ. 2020, 712, 136418. [Google Scholar] [CrossRef]
  43. Ngweme, G.N.; Al Salah, D.M.M.; Laffite, A.; Sivalingam, P.; Grandjean, D.; Konde, J.N.; Mulaji, C.K.; Breider, F.; Poté, J. Occurrence of organic micropollutants and human health risk assessment based on consumption of Amaranthus viridis, Kinshasa in the Democratic Republic of the Congo. Sci. Total Environ. 2021, 754, 142175. [Google Scholar] [CrossRef]
Antibiotics 11 00428 g001 550
Figure 1. The concentrations of antibiotics in livestock wastewater and water dropwort (A). The antibiotic enrichment capacities of roots and stems and leaves (B). Different letters indicate significant differences between livestock wastewater, roots, and stems and leaves (p < 0.05). BAF = Cplant/Cwastewater, where Cplant is the concentration of roots or stems and leaves and Cwastewater is the concentration of livestock wastewater.
Figure 1. The concentrations of antibiotics in livestock wastewater and water dropwort (A). The antibiotic enrichment capacities of roots and stems and leaves (B). Different letters indicate significant differences between livestock wastewater, roots, and stems and leaves (p < 0.05). BAF = Cplant/Cwastewater, where Cplant is the concentration of roots or stems and leaves and Cwastewater is the concentration of livestock wastewater.
Antibiotics 11 00428 g001
Antibiotics 11 00428 g002 550
Figure 2. The ratios of estimated daily intake (EDI) to acceptable daily intake (ADI) for each antibiotic. A hazard quotient of ≥0.1 indicates it poses a threat to human health.
Figure 2. The ratios of estimated daily intake (EDI) to acceptable daily intake (ADI) for each antibiotic. A hazard quotient of ≥0.1 indicates it poses a threat to human health.
Antibiotics 11 00428 g002
Antibiotics 11 00428 g003 550
Figure 3. The abundance of antibiotic resistance genes (ARGs) in livestock wastewater and water dropwort. Different letters indicate significant differences between livestock wastewater, roots, and stems and leaves (p < 0.05).
Figure 3. The abundance of antibiotic resistance genes (ARGs) in livestock wastewater and water dropwort. Different letters indicate significant differences between livestock wastewater, roots, and stems and leaves (p < 0.05).
Antibiotics 11 00428 g003
Antibiotics 11 00428 g004 550
Figure 4. The estimated daily intake of ARGs (EIARGs) for adults and children from consuming contaminated water dropwort roots (A) or stems/leaves (B).
Figure 4. The estimated daily intake of ARGs (EIARGs) for adults and children from consuming contaminated water dropwort roots (A) or stems/leaves (B).
Antibiotics 11 00428 g004
Table
Table 1. Information of 14 genes’ primers.
Table 1. Information of 14 genes’ primers.
NumberGene NameForward PrimerReverse PrimerClassification
116S rRNAGGGTTGCGCTCGTTGCATGGYTGTCGTCAGCTCGTG
2blaOXA1CGGATGGTTTGAAGGGTTTATTATTCTTGGCTTTTATGCTTGATGTTAABeta-lactamase
3blaPSETTGTGACCTATTCCCCTGTAATAGAATGCGAAGCACGCATCATCBeta-lactamase
4blaTEMAGCATCTTACGGATGGCATGATCCTCCGATCGTTGTCAGAAGTBeta-lactamase
5ermATTGAGAAGGGATTTGCGAAAAGATATCCATCTCCACCATTAATAGTAAACCMLSB
6ermBTAAAGGGCATTTAACGACGAAACTTTTATACCTCTGTTTGTTAGGGAATTGAAMLSB
7ermFCAGCTTTGGTTGAACATTTACGAAAAATTCCTAAAATCACAACCGACAAMLSB
8sul1CAGCGCTATGCGCTCAAGATCCCGCTGCGCTGAGTSulfonamide
9sul2TCATCTGCCAAACTCGTCGTTAGTCAAAGAACGCCGCAATGTSulfonamide
10tetA-01GCTGTTTGTTCTGCCGGAAAGGTTAAGTTCCTTGAACGCAAACTTetracycline
11tetG-01TCAACCATTGCCGATTCGATGGCCCGGCAATCATGTetracycline
12tetO-01ATGTGGATACTACAACGCATGAGATTTGCCTCCACATGATATTTTTCCTTetracycline
13tetQCGCCTCAGAAGTAAGTTCATACACTAAGTCGTTCATGCGGATATTATCAGAATTetracycline
14tetWGAGAGCCTGCTATATGCCAGCGGGCGTATCCACAATGTTAACTetracycline
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yao, D.; Chang, Y.; Wang, W.; Sun, L.; Liu, J.; Zhao, H.; Zhang, W. The Safety of Consuming Water Dropwort Used to Purify Livestock Wastewater Considering Accumulated Antibiotics and Antibiotic Resistance Genes. Antibiotics 2022, 11, 428. https://doi.org/10.3390/antibiotics11040428

AMA Style

Yao D, Chang Y, Wang W, Sun L, Liu J, Zhao H, Zhang W. The Safety of Consuming Water Dropwort Used to Purify Livestock Wastewater Considering Accumulated Antibiotics and Antibiotic Resistance Genes. Antibiotics. 2022; 11(4):428. https://doi.org/10.3390/antibiotics11040428

Chicago/Turabian Style

Yao, Dongrui, Yajun Chang, Wei Wang, Linhe Sun, Jixiang Liu, Huijun Zhao, and Weiguo Zhang. 2022. "The Safety of Consuming Water Dropwort Used to Purify Livestock Wastewater Considering Accumulated Antibiotics and Antibiotic Resistance Genes" Antibiotics 11, no. 4: 428. https://doi.org/10.3390/antibiotics11040428

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop