Response of Human Gingival Fibroblasts and Porphyromonas gingivalis to UVC-Activated Titanium Surfaces
Abstract
:1. Introduction
2. Materials and Methods
2.1. Specimen Preparation
2.2. Surface Characterization
2.3. Response of Human Gingival Fibroblasts
2.3.1. Cell Culture and Seeding
2.3.2. Initial Cell Adhesion and Cell Proliferation
2.3.3. Cell Spreading with Focal Adhesion
2.3.4. Adhesion-Related Gene Expression
2.4. Response of Porphyromonas gingivalis
2.4.1. Preparation of Porphyromonas gingivalis
2.4.2. Bacterial Viability and Biofilm Formation
2.5. Co-Culture of Human Gingival Fibroblasts and Porphyromonas gingivalis
2.6. Statistical Analysis
3. Results
3.1. Surface Characterization
3.2. Response of Human Gingival Fibroblasts
3.2.1. Initial Cell Adhesion and Cell Proliferation
3.2.2. Cell Spreading with Distribution of Focal Adhesion
3.2.3. Adhesion-Related Gene Expression
3.3. Response of Porphyromonas gingivalis
3.4. Co-Culture of Human Gingival Fibroblasts and Porphyromonas gingivalis
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Haugen, H.J.; Chen, H. Is There a Better Biomaterial for Dental Implants than Titanium?—A Review and Meta-Study Analysis. J. Funct. Biomater. 2022, 13, 46. [Google Scholar] [CrossRef]
- Hanawa, T. Zirconia versus titanium in dentistry: A review. Dent. Mater. J. 2020, 39, 24–36. [Google Scholar] [CrossRef] [Green Version]
- Chackartchi, T.; Romanos, G.E.; Sculean, A. Soft tissue-related complications and management around dental implants. Periodontology 2019, 81, 124–138. [Google Scholar] [CrossRef]
- Narimatsu, I.; Atsuta, I.; Ayukawa, Y.; Oshiro, W.; Yasunami, N.; Furuhashi, A.; Koyano, K. Epithelial and Connective Tissue Sealing around Titanium Implants with Various Typical Surface Finishes. ACS Biomater. Sci. Eng. 2019, 5, 4976–4984. [Google Scholar] [CrossRef]
- Guo, T.; Gulati, K.; Arora, H.; Han, P.; Fournier, B.; Ivanovski, S. Race to invade: Understanding soft tissue integration at the transmucosal region of titanium dental implants. Dent. Mater. 2021, 37, 816–831. [Google Scholar] [CrossRef]
- Yu, J.; Zhou, M.; Zhang, L.; Wei, H. Antibacterial Adhesion Strategy for Dental Titanium Implant Surfaces: From Mechanisms to Application. J. Funct. Biomater. 2022, 13, 169. [Google Scholar] [CrossRef]
- Canullo, L.; Menini, M.; Santori, G.; Rakic, M.; Sculean, A.; Pesce, P. Titanium abutment surface modifications and peri-implant tissue behavior: A systematic review and meta-analysis. Clin. Oral Investig. 2020, 24, 1113–1124. [Google Scholar] [CrossRef]
- Orapiriyakul, W.; Young, P.S.; Damiati, L.; Tsimbouri, P.M. Antibacterial surface modification of titanium implants in orthopaedics. J. Tissue Eng. 2018, 9, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Canullo, L.; Annunziata, M.; Pesce, P.; Tommasato, G.; Nastri, L.; Guida, L. Influence of abutment material and modifications on peri-implant soft-tissue attachment: A systematic review and meta-analysis of histological animal studies. J. Prosthet. Dent. 2021, 125, 426–436. [Google Scholar] [CrossRef]
- Li, T.; Gulati, K.; Wang, N.; Zhang, Z.; Ivanovski, S. Bridging the gap: Optimized fabrication of robust titania nanostructures on complex implant geometries towards clinical translation. J. Colloid Interface Sci. 2018, 529, 452–463. [Google Scholar] [CrossRef] [Green Version]
- Xu, R.; Hu, X.; Yu, X.; Wan, S.; Wu, F.; Ouyang, J.; Deng, F. Micro-/nano-topography of selective laser melting titanium enhances adhesion and proliferation and regulates adhesion-related gene expressions of human gingival fibroblasts and human gingival epithelial cells. Int. J. Nanomed. 2018, 13, 5045–5057. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Amoroso, P.F.; Adams, R.J.; Waters, M.G.; Williams, D.W. Titanium surface modification and its effect on the adherence of Porphyromonas gingivalis: An in vitro study. Clin. Oral Implant. Res. 2006, 17, 633–637. [Google Scholar] [CrossRef]
- Sousa, V.; Mardas, N.; Spratt, D.; Hassan, I.A.; Walters, N.J.; Beltran, V.; Donos, N. The Effect of Microcosm Biofilm Decontamination on Surface Topography, Chemistry, and Biocompatibility Dynamics of Implant Titanium Surfaces. Int. J. Mol. Sci. 2022, 23, 10033. [Google Scholar] [CrossRef] [PubMed]
- Ogawa, T. Ultraviolet photofunctionalization of titanium implants. Int. J. Oral Maxillofac. Implant. 2014, 29, 95–102. [Google Scholar] [CrossRef] [Green Version]
- Okubo, T.; Ikeda, T.; Saruta, J.; Tsukimura, N.; Hirota, M.; Ogawa, T. Compromised Epithelial Cell Attachment after Polishing Titanium Surface and Its Restoration by UV Treatment. Materials 2020, 13, 3946. [Google Scholar] [CrossRef]
- Dini, C.; Nagay, B.E.; Magno, M.B.; Maia, L.C.; Barao, V.A.R. Photofunctionalization as a suitable approach to improve the osseointegration of implants in animal models-A systematic review and meta-analysis. Clin. Oral Implant. Res. 2020, 31, 785–802. [Google Scholar] [CrossRef]
- Marasini, S.; Leanse, L.G.; Dai, T. Can microorganisms develop resistance against light based anti-infective agents? Adv. Drug Deliv. Rev. 2021, 175, 113822. [Google Scholar] [CrossRef]
- Yamamura, K.; Miura, T.; Kou, I.; Muramatsu, T.; Furusawa, M.; Yoshinari, M. Influence of various superhydrophilic treatments of titanium on the initial attachment, proliferation, and differentiation of osteoblast-like cells. Dent. Mater. J. 2015, 34, 120–127. [Google Scholar] [CrossRef] [Green Version]
- Huang, Y.; Zhang, H.; Chen, Z.; Wang, Y.; Yang, X.; Yu, H. Improvement in Osseointegration of Titanium Dental Implants After Exposure to Ultraviolet-C Light for Varied Durations: An Experimental Study in Beagle Dogs. J. Oral Maxillofac. Surg. 2022, 80, 1389–1397. [Google Scholar] [CrossRef]
- Aita, H.; Att, W.; Ueno, T.; Yamada, M.; Hori, N.; Iwasa, F.; Tsukimura, N.; Ogawa, T. Ultraviolet light-mediated photofunctionalization of titanium to promote human mesenchymal stem cell migration, attachment, proliferation and differentiation. Acta Biomater. 2009, 5, 3247–3257. [Google Scholar] [CrossRef]
- Aita, H.; Hori, N.; Takeuchi, M.; Suzuki, T.; Yamada, M.; Anpo, M.; Ogawa, T. The effect of ultraviolet functionalization of titanium on integration with bone. Biomaterials 2009, 30, 1015–1025. [Google Scholar] [CrossRef]
- Liang, L.C.; Krieg, P.; Rupp, F.; Kimmerle-Muller, E.; Spintzyk, S.; Richter, M.; Richter, G.; Killinger, A.; Geis-Gerstorfer, J.; Scheideler, L. Osteoblast Response to Different UVA-Activated Anatase Implant Coatings. Adv. Mater. Interfaces 2019, 6, 1801720. [Google Scholar] [CrossRef]
- Wu, J.; Zhou, L.; Ding, X.; Gao, Y.; Liu, X. Biological Effect of Ultraviolet Photocatalysis on Nanoscale Titanium with a Focus on Physicochemical Mechanism. Langmuir 2015, 31, 10037–10046. [Google Scholar] [CrossRef]
- Li, S.; Ni, J.; Liu, X.; Zhang, X.; Yin, S.; Rong, M.; Guo, Z.; Zhou, L. Surface characteristics and biocompatibility of sandblasted and acid-etched titanium surface modified by ultraviolet irradiation: An in vitro study. J. Biomed. Mater. Res. Part B Appl. Biomater. 2012, 100, 1587–1598. [Google Scholar] [CrossRef]
- Dini, C.; Nagay, B.E.; Cordeiro, J.M.; da Cruz, N.C.; Rangel, E.C.; Ricomini-Filho, A.P.; de Avila, E.D.; Barao, V.A.R. UV-photofunctionalization of a biomimetic coating for dental implants application. Mater. Sci. Eng. C Mater. Biol. Appl. 2020, 110, 110657. [Google Scholar] [CrossRef]
- Palkowitz, A.L.; Tuna, T.; Bishti, S.; Boke, F.; Steinke, N.; Muller-Newen, G.; Wolfart, S.; Fischer, H. Biofunctionalization of Dental Abutment Surfaces by Crosslinked ECM Proteins Strongly Enhances Adhesion and Proliferation of Gingival Fibroblasts. Adv. Healthc. Mater. 2021, 10, 2100132. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Green Version]
- Di Giulio, M.; Traini, T.; Sinjari, B.; Nostro, A.; Caputi, S.; Cellini, L. Porphyromonas gingivalis biofilm formation in different titanium surfaces, an in vitro study. Clin. Oral Implants Res. 2016, 27, 918–925. [Google Scholar] [CrossRef]
- Kamble, E.; Pardesi, K. Antibiotic Tolerance in Biofilm and Stationary-Phase Planktonic Cells of Staphylococcus aureus. Microb. Drug Resist. 2021, 27, 3–12. [Google Scholar] [CrossRef]
- Gao, Y.; Kang, K.; Luo, B.; Sun, X.; Lan, F.; He, J.; Wu, Y. Graphene oxide and mineralized collagen-functionalized dental implant abutment with effective soft tissue seal and romotely repeatable photodisinfection. Regen. Biomater. 2022, 9, 24. [Google Scholar] [CrossRef]
- Rupp, F.; Gittens, R.A.; Scheideler, L.; Marmur, A.; Boyan, B.D.; Schwartz, Z.; Geis-Gerstorfer, J. A review on the wettability of dental implant surfaces I: Theoretical and experimental aspects. Acta Biomater. 2014, 10, 2894–2906. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, H.J.; Wang, W.S.; Shi, L.X.; Song, W.L.; Wang, S.T. Superwettable Surface Engineering in Controlling Cell Adhesion for Emerging Bioapplications. Small Methods 2020, 4, 2000573. [Google Scholar] [CrossRef]
- Arroyo-Lamas, N.; Arteagoitia, I.; Ugalde, U. Surface Activation of Titanium Dental Implants by Using UVC-LED Irradiation. Int. J. Mol. Sci. 2021, 22, 2597. [Google Scholar] [CrossRef] [PubMed]
- Johnson, H.A.; Williamson, R.S.; Marquart, M.; Bumgardner, J.D.; Janorkar, A.V.; Roach, M.D. Photocatalytic activity and antibacterial efficacy of UVA-treated titanium oxides. J. Biomater. Appl. 2020, 35, 500–514. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B.; van der Mei, H.C.; Subbiahdoss, G.; de Vries, J.; Rustema-Abbing, M.; Kuijer, R.; Busscher, H.J.; Ren, Y. Soft tissue integration versus early biofilm formation on different dental implant materials. Dent. Mater. 2014, 30, 716–727. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Smeets, R.; Kluwe, L.; Hartjen, P.; Barbeck, M.; Cacaci, C.; Gosau, M.; Henningsen, A. Cytocompatibility of Titanium, Zirconia and Modified PEEK after Surface Treatment Using UV Light or Non-Thermal Plasma. Int. J. Mol. Sci. 2019, 20, 5596. [Google Scholar] [CrossRef] [Green Version]
- Yang, Y.; Zhang, H.; Komasa, S.; Morimoto, Y.; Sekino, T.; Kawazoe, T.; Okazaki, J. UV/ozone irradiation manipulates immune response for antibacterial activity and bone regeneration on titanium. Mater. Sci. Eng. C Mater. Biol. Appl. 2021, 129, 112377. [Google Scholar] [CrossRef]
- Jeon, C.; Oh, K.C.; Park, K.H.; Moon, H.S. Effects of ultraviolet treatment and alendronate immersion on osteoblast-like cells and human gingival fibroblasts cultured on titanium surfaces. Sci. Rep. 2019, 9, 2581. [Google Scholar] [CrossRef] [Green Version]
- Ikeda, T.; Ueno, T.; Saruta, J.; Hirota, M.; Park, W.; Ogawa, T. Ultraviolet Treatment of Titanium to Enhance Adhesion and Retention of Oral Mucosa Connective Tissue and Fibroblasts. Int. J. Mol. Sci. 2021, 22, 12396. [Google Scholar] [CrossRef]
- Gittens, R.A.; Scheideler, L.; Rupp, F.; Hyzy, S.L.; Geis-Gerstorfer, J.; Schwartz, Z.; Boyan, B.D. A review on the wettability of dental implant surfaces II: Biological and clinical aspects. Acta Biomater. 2014, 10, 2907–2918. [Google Scholar] [CrossRef] [Green Version]
- Katoh, K. FAK-Dependent Cell Motility and Cell Elongation. Cells 2020, 9, 192. [Google Scholar] [CrossRef] [Green Version]
- Sero, J.E.; Bakal, C. Multiparametric Analysis of Cell Shape Demonstrates that beta-PIX Directly Couples YAP Activation to Extracellular Matrix Adhesion. Cell Syst. 2017, 4, 84–96.e6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Woods, A.J.; Kantidakis, T.; Sabe, H.; Critchley, D.R.; Norman, J.C. Interaction of paxillin with poly(A)-binding protein 1 and its role in focal adhesion turnover and cell migration. Mol. Cell. Biol. 2005, 25, 3763–3773. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hatoko, M.; Komasa, S.; Zhang, H.; Sekino, T.; Okazaki, J. UV Treatment Improves the Biocompatibility and Antibacterial Properties of Crystallized Nanostructured Titanium Surface. Int. J. Mol. Sci. 2019, 20, 5991. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rupp, F.; Liang, L.; Geis-Gerstorfer, J.; Scheideler, L.; Huttig, F. Surface characteristics of dental implants: A review. Dent. Mater. 2018, 34, 40–57. [Google Scholar] [CrossRef]
- Stallard, C.P.; McDonnell, K.A.; Onayemi, O.D.; O’Gara, J.P.; Dowling, D.P. Evaluation of protein adsorption on atmospheric plasma deposited coatings exhibiting superhydrophilic to superhydrophobic properties. Biointerphases 2012, 7, 31. [Google Scholar] [CrossRef] [Green Version]
- Hierro-Oliva, M.; Gallardo-Moreno, A.M.; Gonzalez-Martin, M.L. Surface Characterisation of Human Serum Albumin Layers on Activated Ti6Al4V. Materials 2021, 14, 7416. [Google Scholar] [CrossRef]
- Firkowska-Boden, I.; Zhang, X.; Jandt, K.D. Controlling Protein Adsorption through Nanostructured Polymeric Surfaces. Adv. Healthc. Mater. 2018, 7, 1700995. [Google Scholar] [CrossRef]
- Shibli, J.A.; Melo, L.; Ferrari, D.S.; Figueiredo, L.C.; Faveri, M.; Feres, M. Composition of supra- and subgingival biofilm of subjects with healthy and diseased implants. Clin. Oral Implants Res. 2008, 19, 975–982. [Google Scholar] [CrossRef]
- de Avila, E.D.; Lima, B.P.; Sekiya, T.; Torii, Y.; Ogawa, T.; Shi, W.; Lux, R. Effect of UV-photofunctionalization on oral bacterial attachment and biofilm formation to titanium implant material. Biomaterials 2015, 67, 84–92. [Google Scholar] [CrossRef] [Green Version]
- Ishijima, M.; de Avila, E.D.; Nakhaei, K.; Shi, W.; Lux, R.; Ogawa, T. Ultraviolet Light Treatment of Titanium Suppresses Human Oral Bacterial Attachment and Biofilm Formation: A Short-Term In Vitro Study. Int. J. Oral Maxillofac. Implant. 2019, 34, 1105–1113. [Google Scholar] [CrossRef] [PubMed]
- Fan, H.; Guo, Z. Bioinspired surfaces with wettability: Biomolecule adhesion behaviors. Biomater. Sci. 2020, 8, 1502–1535. [Google Scholar] [CrossRef] [PubMed]
- Komine, C.; Uchibori, S.; Tsudukibashi, O.; Tsujimoto, Y. Application of Reactive Oxygen Species in Dental Treatment. J. Pers. Med. 2022, 12, 1531. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (3′-5′) |
---|---|---|
FAK | GCTTACCTTGACCCCAACTTG | ACGTTCCATACCAGTACCCAG |
Integrin β1 | CCTACTTCTGCACGATGTGATG | CCTTTGCTACGGTTGGTTACATT |
Vinculin | CGAATCCCAACCATAAGCAC | CGCACAGTCTCCTTCACAGA |
GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
Physiochemical Properties | Groups | ||||
S | S + UVC | N | N + UVC | ||
Nanotube diameter (nm) | - | - | 95.66 ± 9.52 | 94.52 ± 8.06 | |
Surface roughness (nm) | Sa | 13.85 ± 5.05 | 18.00 ± 6.20 | 27.10 ± 3.91 | 23.77 ± 7.02 |
Sq | 18.07 ± 6.85 | 23.60 ± 8.47 | 33.80 ± 4.55 | 30.13 ± 8.58 | |
EDS atomic percentage (%) | O | 16.11 ± 1.12 | 17.99 ± 0.88 | 47.99 ± 0.76 B | 50.62 ± 0.80 b |
C | 4.35 ± 0.26 | 3.81 ± 0.46 | 1.45 ± 0.03 | 1.55 ± 0.06 | |
Ti | 79.54 ± 1.35 | 78.20 ± 1.10 | 50.56 ± 0.78 B | 47.83 ± 0.85 b | |
XPS atomic percentage (%) | O 1s | 50.94 ± 0.38 A | 57.05 ± 1.19 a | 44.77 ± 0.25 | 46.23 ± 0.52 |
C 1s | 33.35 ± 1.63 A | 24.35 ± 0.34 a | 34.15 ± 0.99 | 33.57 ± 1.85 | |
Ti 2p | 16.76 ± 0.79 | 18.60 ± 1.34 | 20.09 ± 0.13 | 20.14 ± 0.36 | |
Water contact angle (°) | 103.20 ± 0.93 | ≈0 | 47.75 ± 0.38 | ≈0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wen, Y.; Dong, H.; Lin, J.; Zhuang, X.; Xian, R.; Li, P.; Li, S. Response of Human Gingival Fibroblasts and Porphyromonas gingivalis to UVC-Activated Titanium Surfaces. J. Funct. Biomater. 2023, 14, 137. https://doi.org/10.3390/jfb14030137
Wen Y, Dong H, Lin J, Zhuang X, Xian R, Li P, Li S. Response of Human Gingival Fibroblasts and Porphyromonas gingivalis to UVC-Activated Titanium Surfaces. Journal of Functional Biomaterials. 2023; 14(3):137. https://doi.org/10.3390/jfb14030137
Chicago/Turabian StyleWen, Yin, Hao Dong, Jiating Lin, Xianxian Zhuang, Ruoting Xian, Ping Li, and Shaobing Li. 2023. "Response of Human Gingival Fibroblasts and Porphyromonas gingivalis to UVC-Activated Titanium Surfaces" Journal of Functional Biomaterials 14, no. 3: 137. https://doi.org/10.3390/jfb14030137