Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673

Chen, Jia; Ran, Fei; Shi, Jinqiao; Chen, Tingting; Zhao, Zhibo; Zhang, Zhuzhu; He, Linan; Li, Wenzhi; Wang, Bingce; Chen, Xuetang; Wang, Weizhen; Long, Youhua

doi:10.3390/pathogens12111327

Open AccessCorrection

Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673

by

Jia Chen

¹,

Fei Ran

¹,

Jinqiao Shi

¹,

Tingting Chen

¹

,

Zhibo Zhao

¹,

Zhuzhu Zhang

¹,

Linan He

¹,

Wenzhi Li

¹,

Bingce Wang

¹,

Xuetang Chen

¹,

Weizhen Wang

¹ and

Youhua Long

^1,2,*

¹

Research Center for Engineering Technology of Kiwifruit, Institute of Crop Protection, College of Agriculture, Guizhou University, Guiyang 550025, China

²

Teaching Experimental Field of Guizhou University, Guizhou University, Guiyang 550025, China

^*

Author to whom correspondence should be addressed.

Pathogens 2023, 12(11), 1327; https://doi.org/10.3390/pathogens12111327

Submission received: 26 October 2023 / Accepted: 30 October 2023 / Published: 8 November 2023

(This article belongs to the Special Issue Current Research on Fusarium)

Download

Browse Figure

Versions Notes

Error in Figure/Table

In the original publication [1], there was a mistake in Figure 4A and Table 3 as published. The original Figure 4A incorrectly included two identical plates. The corrected Figure 4 is shown below. The reference numbers in the original Table 3 are not correct. The correct reference numbers should be [49–52], instead of [26–29]. The corrected Table 3 is shown below.

The authors apologize for any inconvenience caused and state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.

Reference

Chen, J.; Ran, F.; Shi, J.; Chen, T.; Zhao, Z.; Zhang, Z.; He, L.; Li, W.; Wang, B.; Chen, X.; et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. [Google Scholar] [CrossRef]

Figure 4. (A) Mycelial growth inhibition of Fusarium graminearum isolate CY2 after the application of different active ingredients of biological fungicides under a series of concentrations, with fungicide free plates (CK) as the control. (B) EC₅₀ value of different fungicides applied to isolate CY2. The error bar indicates standard deviations (SD), each value is the mean ± SD of three replicates, and different lower-case letters represent significant differences at the 5% level (p < 0.05).

Table 3. Primers used in the present study.

Target Region/Gene	Description	Primer	Sequence 5′→3′	Reference
ITS	Region with ribosomal RNA genes and two internal transcribed spacers	ITS1	TCCGTAGGTGAACCTGCGG	[49]
ITS		ITS4	TCCTCCGCTTATTGATATGC	[49]
TEF-1α	Translation elongation factor 1-α gene	EF1-728F	CATCGAGAAGTTCGAGAAGG	[50]
TEF-1α	Translation elongation factor 1-α gene	EF1-986R	TACTTGAAGGAACCCTTACC	[50]
RPB2	Second largest subunit of RNA polymerase II	fRPB2-7cR	CCCATRGCTTGTYYRCCCAT	[51]
RPB2	Second largest subunit of RNA polymerase II	RPB2-5F2	GGGGWGAYCAGAAGAAGGC	[52]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Share and Cite

MDPI and ACS Style

Chen, J.; Ran, F.; Shi, J.; Chen, T.; Zhao, Z.; Zhang, Z.; He, L.; Li, W.; Wang, B.; Chen, X.; et al. Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. Pathogens 2023, 12, 1327. https://doi.org/10.3390/pathogens12111327

AMA Style

Chen J, Ran F, Shi J, Chen T, Zhao Z, Zhang Z, He L, Li W, Wang B, Chen X, et al. Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673. Pathogens. 2023; 12(11):1327. https://doi.org/10.3390/pathogens12111327

Chicago/Turabian Style

Chen, Jia, Fei Ran, Jinqiao Shi, Tingting Chen, Zhibo Zhao, Zhuzhu Zhang, Linan He, Wenzhi Li, Bingce Wang, Xuetang Chen, and et al. 2023. "Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673" Pathogens 12, no. 11: 1327. https://doi.org/10.3390/pathogens12111327

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Menu

Correction: Chen et al. Identification of the Causal Agent of Brown Leaf Spot on Kiwifruit and Its Sensitivity to Different Active Ingredients of Biological Fungicides. Pathogens 2022, 11, 673

Error in Figure/Table

Reference

Share and Cite

Article Metrics

Article Access Statistics

Further Information

Guidelines

MDPI Initiatives

Follow MDPI