Next Article in Journal
Acknowledgment to the Reviewers of Cells in 2022
Previous Article in Journal
Defining a Correlative Transcriptional Signature Associated with Bulk Histone H3 Acetylation Levels in Adult Glioblastomas
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 12
Issue 3
10.3390/cells12030369
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

FTO Regulated Intramuscular Fat by Targeting APMAP Gene via an m6A-YTHDF2-dependent Manner in Rex Rabbits

by
Gang Luo
,
Tingting Hong
,
Lin Yu
and
Zhanjun Ren
*
College of Animal Science and Technology, Northwest A & F University, Xianyang 712100, China
*
Author to whom correspondence should be addressed.
Cells 2023, 12(3), 369; https://doi.org/10.3390/cells12030369
Submission received: 16 November 2022 / Revised: 6 December 2022 / Accepted: 13 December 2022 / Published: 19 January 2023
(This article belongs to the Section Cell and Gene Therapy)
Browse Figures
Review Reports Versions Notes

Abstract

:
N6-methyladenosine (m6A) regulates fat development in many ways. Low intramuscular fat (IMF) in rabbit meat seriously affects consumption. In order to improve meat quality, we explored the law of IMF deposition. FTO could increase the expression of APMAP and adipocyte differentiation through methylation. However, interference YTHDF2 can partially recover the influence of interference FTO on the APMAP gene and adipocyte differentiation. APMAP promoted the differentiation of adipocytes. Analysis of IMF and APMAP expression showed IMF content is positive with the expression level of the APMAP gene (p < 0.01). Conclusion: Together, FTO can regulate intramuscular fat by targeting the APMAP gene via an m6A-YTHDF2-dependent manner in Rex rabbits. The result provides a theoretical basis for the molecular breeding of rabbits.

1. Introduction

Meat contains most minerals, vitamins, essential fatty acids, and other nutrients that human beings need [1]. The flavor of meat food is the main factor affecting consumers’ choice and fatty acids in intramuscular fat can affect the flavor of meat food [2,3]. The content and composition of IMF is a very important symbol of meat quality and IMF influences the flavor, juiciness, and tenderness of meat [4]. Adipocyte differentiation and proliferation form fat deposition. Therefore, understanding the mechanism of adipogenesis could provide a scientific basis for breeding rabbits with high intramuscular fat.
M6A was discovered in the 1970s [5,6] and involved almost all aspects of RNA metabolism. Demethylases (FTO) [7,8], methylase [5], and methylation recognition enzyme (YTHDF2) [9,10,11,12] are the main factors causing m6A modification. The FTO gene is the first gene [13,14] that regulates fat deposition [15,16]. Studies indicated knockout of FTO inhibited fat deposition in mouse liver [17] and overexpression of FTO promoted adipogenesis in cells [18]. YTHDF2 has been found to regulate the translation of m6A containing mRNA [19]. However, it is not clear whether FTO and YTHDF2 regulate adipogenesis through m6A modification. So, it is important to explore the regulatory pathway of FTO on fat deposition.
APMAP contains 415 amino acids [20]. Studies found APMAP participated in the material exchange between the environment and mature adipocytes and regulates adipogenesis [21]. In addition, interference APMAP reduced fat deposition [21,22], which indicated APMAP was a crucial factor in adipogenesis. However, the role of APMAP in adipogenesis has not been reported yet.
In this study, we found that the expression level of the APMAP gene was higher in the muscle tissue of rabbits with high fat content. Further study showed FTO knockdown decreased APMAP expression by identification function of YTHDF2. In addition, we found that APMAP promoted adipocyte differentiation. Finally, the results of tissue PCR and intramuscular fat content showed that they were positively correlated (r = 0.844, p < 0.01). Our study provided a new way to breed Rex rabbits with high-quality meat.

2. Material and Methods

2.1. Animals

The adipose tissues were isolated from newborn rabbits’ perirenal fat after rabbits were slaughtered humanely. Adipose tissues were cut in PBS and digested in a 37 ℃ water bath for 1 h. Finally, preadipocytes were obtained after filtering and centrifuging the mixture. Longissimus lumborum and perirenal fat were rapidly separated from 18 female Rex rabbits who were aged 35 days, 75 days, and 165 days. After separating the sample, we quickly put it in liquid nitrogen for 15 min and kept it in the −80 ℃ refrigerator for a long time to extract mRNA. In addition, another 15 g longissimus lumborum was isolated to keep in the −20 ℃ refrigerator. These rabbits were raised under standard conditions (Farm of Northwest Agriculture and Forestry University Yangling, Shaanxi, China).

2.2. Ethical Statement

All research involving animals was conducted following the Regulations for the Administration of Affairs Concerning Experimental Animals and approved by the Institutional Animal Care and Use Committee in the College of Animal Science and Technology, Northwest A&F University, Yangling, China, under permit No. DK-2019008.

2.3. Cell Experiment

The method of cell culture is consistent with that in the previous literature [23]. In short, we digested the tissue into a single cell with 0.25% collagenase type I and filtered the cells with a 40 µm cell sieve. Then, the cells were cultured at 37 ℃ for a period of time. Finally, the induced differentiation solution (DM/F12, 0.5 mM 3-isobutyl-1-methylxanthine, 1.7 μM insulin, 10% fetal bovine serum, 1 μM dexamethasone, and 2% penicillin-streptomycin) and maintained differentiation solution (DM/F12, 1.7 mM insulin, 10% fetal bovine serum, and 2% penicillin-streptomycin) were used to differentiate the cells in the incubator (37 ℃, 5% CO2). We used Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) to transfect the synthesis into cells.

2.4. Oil Red O Staining and Measurement of Triglyceride Content

Oil red O staining solution (Solarbio, Beijing, China) was used to stain fat droplets of adipocytes. In short, we fixed them with 4% formaldehyde for 30 min after PBS washing cells. Cells were stained in a dark environment with oil red O solution for 30 min after discarding the formaldehyde solution. After dyeing, we washed cells with water and took pictures under a microscope. Finally, 200 uL isopropanol was added and the OD value was measured at 510 nm wavelength of the microplate reader. A TG Assay Kit (Applygen, Beijing, China) was used to obtain the Intracellular triglyceride (TG) content. Firstly, the standard was prepared and diluted to obtain standards of different concentrations. Secondly, the cells were lysed using cell lysate, and the mixture was heated at 70 ℃ for 10 min before centrifugation. Then, OD values of the supernatant and the standard samples of various concentrations were measured using the microplate reader. Finally, we calculate the content of triglyceride according to the concentration of the standard through the standard curve.

2.5. RT-qPCR

Total RNA was obtained by TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). A NanoDrop 2000 spectrophotometer (Thermo, Waltham, MA, USA) was used to assess RNA quality. RT-qPCR was performed by the previous method [24] and the primers are in Table 1.

2.6. Gene-specific m6A qPCR

The methylation level was determined with a Magna MeRIP m6A Kit (Millipore, Darmstadt, Germany). Briefly, fragmented RNA binds to the antibody at 4 degrees for 12 h. After using the reaction mixture of A/G magnetic beads, we used the RNeasy kit (Qiagen, Shanghai, China) to recover the methylated RNA. Finally, the methylation level of fragmented RNA and enriched RNA was detected by qPCR.

2.7. Western Blotting

Total protein was extracted with the RIPA Lysis Buffer (CWBIO, Jiangsu, China) and Protease Inhibitor Cocktail (CWBIO, Jiangsu, China). BCA Protein Assay Kit was used to quantify the protein content. Western blotting drew on the previous literature methods [25]. The protein solution was heated at 100 ℃ for 10 min after adding the loading buffer. Then, 40 mg proteins were added in 4–12% SDS-polyacrylamide gels for electrophoresis (1.5 h). After electrophoresis, we used a semi-dry membrane rotator to rotate the membrane for 25 min at 18 volts. The membrane was incubated for 12 h in primary antibody solution at 4 ℃ and was incubated for 1 h in secondary antibody solution at room temperature. Finally, protein bands were obtained with a Bio-Rad GelDoc system equipped with a Universal Hood III (Bio-Rad), and a gray value was used to quantify the protein expression level.

2.8. Measurement of IMF

IMF was measured using Soxhlet petroleum-ether extraction [26]. In brief, the meat sample was chopped into minced meat, then dehydrated in an oven to a constant amount, cooled and crushed. We accurately weighed about 1.0 g of the treated sample (F) into a filter paper cylinder and then dehydrated it to a constant amount in an oven at 105 ℃ so that the total mass was F1. Subsequently, the sample was treated in a Soxhlet extractor and was dried in an oven at 105 ℃ to a constant amount (F2). IMF = (F1 − F2)/F × 100%.

2.9. Statistical Analysis

GraphPad Prism software 5.0 (GraphPad, Santiago, CA, USA) was used to assess all data. One-way analysis of variance (ANOVA) and two-tail Student’s t-test were used in this study. A general linear model was fitted in the R software environment [27] to develop prediction models for APMAP expression level and IMF. The model is as follows, Intramuscular fat = APMAP expression level + Age. Marginal and conditional R2 values were calculated for the model. p < 0.05 and p < 0.01 were significant and highly significant, respectively.

3. Results

3.1. Methylation Modification of APMAP and APMAP Expression in Rabbits during Growth Periods

Based on previous MeRIP-seq results (the raw data are published and the results did not appear in published articles [28]), we found that mRNA of APMAP was methylated in both muscle and fat tissue (Figure 1A). As shown in Figure 1A, the methylation of the APMAP gene in perirenal fat and muscles occurred at multiple loci and there were significant differences. The expression level of APMAP in fat and muscle increased with age (Figure 1B,C).

3.2. Preadipocytes Deletion of FTO Inhibits Adipocyte Differentiation

To investigate the role of FTO during adipogenesis, the FTO gene was interfered. The results of qPCR and WB showed that the experiment was successful (Figure 2A–C). Silencing of FTO significantly inhibited adipogenic differentiation (Figure 2D,E). The content of Triglyceride also indicated that knockout of FTO significantly inhibited adipogenic differentiation (Figure 2F). In addition, PPARγ C/EBPα, and FABP4 expression were inhibited when FTO was interfered (Figure 2G–I).

3.3. Upregulation of FTO Increased Preadipocyte Differentiation

Tofurther make clear the role of FTO, the function studies were conducted by using pcDNA3.1 + FTO. As shown in Figure 3A–C, FTO was successfully upregulated. When FTO was overexpressed, the increased lipid droplets were observed (Figure 3D,E) and the increased content of Triglyceride was measured (Figure 3F). In addition, adipogenic marker genes were significantly promoted (Figure 3G–I).

3.4. The Deletion of YTHDF2 Partially Restored Adipocyte Differentiation of FTO Depleted Cells

To explore the molecular mechanisms of YTHDF2 on FTO regulating adipocyte differentiation, YTHDF2 was inhibited in FTO siRNA adipocytes. Western blot assay and qPCR were shown and our operation was effective (Figure 4A–D). The content of triglyceride and lipid droplets was partially restored in FTO siRNA adipocytes (Figure 4E–G). As expected, adipogenic marker gene expression levels were significantly higher than that in FTO siRNA adipocytes when YTHDF2 was knocked out (Figure 4H–J).

3.5. FTO and YTHDF2 Interact to Regulate APMAP Expression

As shown in Figure 5A–C APAMP expression was significantly lower after interfering with the FTO gene (p < 0.01) whereas fold enrichment of the APMAP gene was significantly higher (p < 0.01) (Figure 5E). As expected, overexpression of FTO achieved the opposite result (Figure 5D). After knocking out the YTHDF2 gene in FTO siRNA adipocytes. APAMP expression was significantly higher (p < 0.01) (Figure 5F–H) whereas fold enrichment of methylation modification was significantly lower (p < 0.01) (Figure 5I) than that in FTO siRNA adipocytes.

3.6. APMAP Is Essential for Adipogenesis In Vitro

We knocked out the APMAP gene in preadipocytes and found knockout was effective (Figure 6A–C). Contents of triglycerides and lipid droplets indicated that APMAP could promote the differentiation of adipocytes (Figure 6D–F). As expected, the same conclusion is drawn from the verification results of adipogenic marker genes (Figure 6G–I).

3.7. Correlation Analysis between Intramuscular Fat Content and APMAP mRNA Expression

The correlation between IMF and APMAP expression was presented in Table 2. For the model, intramuscular fat content and expression level of the APMAP gene (p < 0.01) were significant. The marginal R2 = 0.9461 and a conditional R2 = 0.9345 (p < 0.01).

4. Discussion

In recent years, scientists have been very keen on the exploration and research of fat deposition mechanisms. However, mRNA m6A regulates fat development poorly. In our study, we found that FTO regulated adipocyte differentiation through interference and overexpression of FTO. Previous studies have shown that FTO regulated fat deposition by promoting adipocyte differentiation [29,30]. In addition, FTO promoted the activity of FAS and PPARγ genes [31]. A previous study found that restricting feed significantly decreased FTO mRNA levels and insulin levels [32,33]. In addition, the level of IGF-1 decreased in FTO-specific deficient mice [34]. These results indicated FTO can promote insulin secretion. Studies found insulin can stimulate the phosphorylation of AKT and IRS-1 and regulate the function of AKT and IRS-1. [35,36]. Interference APMAP significantly reduced the expression of P-AKT and pIRS-1 [37]. In summary, FTO may regulate the expression level of the APMAP gene. In our study, APMAP expression decreased significantly whereas the methylation level of the APMAP gene increased significantly after transfection si-FTO (Figure 5). These results indicated that FTO affected the expression level of the APMAP gene by m6A methylation.
The modification of m6A to mRNA transcripts should be recognized by specific proteins, which are m6A readers [38]. YTHDF3, YTHDF1, and YTHDF2 were identified as m6A readers [10,39]. YTHDF1 and YTHDF3 played an important role in protein synthesis and mRNA translation [40,41]. YTHDF2 participated in recognizing and destabilizing m6A-containing mRNA [10]. A previous study revealed that FTO regulated adipogenesis via m6A-YTHDF2 dependent mechanism [25]. In addition, The study also demonstrated epigallocatechin gallate targets FTO and FTO inhibited adipogenesis by YTHDF2 [42]. These results revealed that YTHDF2 can recognize FTO and regulate the expression of FTO. In our study, the data of MeRIP-seq also showed that the APMAP gene is regulated at multiple sites by m6A methylase (Figure 1A). Interference of YTHDF2 partially rescued the expression level of APMAP in FTO-depleted cells (Figure 4). The methylation level of APMAP gene was significantly recovered (Figure 5I). These results indicated FTO regulated APMAP gene expression by YTHDF2 gene.
APMAP is a regulatory factor related to adipocyte differentiation [43]. Interference APMAP inhibited adipocyte differentiation [22]. APMAP caused insulin resistance through IRS-1/insulin sensitive genes/free fatty acids pathway [44,45,46]. The activity of FAS can be improved by insulin in adipocytes [47,48] and high FAS expression significantly increased diacylglycerol deposition and caused obesity [49]. At the same time, FAS expression was positively correlated with body fat levels in many mammals [50]. In this study, we also found that APMAP promoted adipocyte differentiation (Figure 6).
The study showed interfering with APMAP inhibited the differentiation of preadipocytes and lipid droplet formation [21]. In Table 2, we found intramuscular fat content and APMAP expression (p < 0.01) were significant. So, a high expression level of the APMAP gene means high intramuscular fat content. In addition, we found that the expression level of the APMAP gene increases with age. Studies also showed intramuscular fat content of rabbits increased with age [51]. These results indicated APMAP can regulate the intramuscular fat content of Rex rabbits. In summary, FTO regulated the expression of APMAP through YTHDF2 recognition and APMAP can promote intramuscular fat deposition(Figure 7).

5. Conclusions

In summary, we found FTO promoted the expression level of the APMAP gene by YTHDF2 recognition. APMAP promoted differentiation of adipocytes and APMAP expression was positively correlated with IMF content. FTO promotes intramuscular fat by targeting.
APMAP gene via YTHDF2 recognition (Figure 7). The mechanism of IMF may provide a theoretical basis for the molecular breeding of rabbits with high meat quality.

Author Contributions

Z.R.: Conceptualization, Funding. G.L.: Conceptualization, Experimentation, Writing and editing. T.H.: Experimentation. L.Y.: Writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Yangling Demonstration Area Industry University research and application collaborative innovation major project (1017cxy-15), Agricultural science and technology innovation and tackling key projects in Shaanxi Province (2016NY-108) and Integration and demonstration of rabbit breeding and factory breeding technology (2018ZDXM-NY-041).

Institutional Review Board Statement

All the experimental procedures in this study were approved by the guidelines of the Animal Experiment Committee Northwest A&F University, China(Permit No. DK-2019008,2019).

Acknowledgments

We thank friends of the special economic animal team for their help.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. de Castro Cardoso Pereira, P.M.; dos Reis Baltazar Vicente, A.F. B Meat nutritional composition and nutritive role in the human diet. Meat Sci. 2013, 93, 586–592. [Google Scholar] [CrossRef] [Green Version]
  2. Frank, D.; Eyres, G.T.; Piyasiri, U.; Cochet-Broch, M.; Delahunty, C.M.; Lundin, L.; Appelqvist, I.M. Effects of Agar Gel Strength and Fat on Oral Breakdown, Volatile Release, and Sensory Perception Using in Vivo and in Vitro Systems. J. Agric. Food Chem. 2015, 63, 9093–9102. [Google Scholar] [CrossRef]
  3. Mezgebo, G.B.; Monahan, F.J.; McGee, M.; O’Riordan, E.G.; Richardson, I.R.; Brunton, N.P.; Moloney, A.P. Fatty acid, volatile and sensory characteristics of beef as affected by grass silage or pasture in the bovine diet. Food Chem. 2017, 235, 86–97. [Google Scholar] [CrossRef] [Green Version]
  4. Webb, E.C. Manipulating beef quality through feeding. S. Afr. J. Anim. 2006, 7, 5–15. [Google Scholar]
  5. Desrosiers, R.; Friderici, K.; Rottman, F. Identification of Methylated Nucleosides in Messenger RNA from Novikoff Hepatoma Cells. Proc. Natl. Acad. Sci. 1974, 71, 3971–3975. [Google Scholar] [CrossRef] [Green Version]
  6. Perry, R.P.; Kelley, D.E. Existence of methylated messenger RNA in mouse L cells. Cell 1974, 1, 37–42. [Google Scholar] [CrossRef]
  7. Jia, G.; Fu, Y.; Zhao, X.; Dai, Q.; Zheng, G.; Yang, Y. N6-methyladenosine in nuclear rna is a major substrate of the obesi-ty-associated fto. Nat. Chem. Biol. 2011, 1, 885–887. [Google Scholar] [CrossRef]
  8. Zheng, G.; Dahl, J.A.; Niu, Y.; Fedorcsak, P.; Huang, C.-M.; Li, C.J.; Vågbø, C.B.; Shi, Y.; Wang, W.-L.; Song, S.-H.; et al. ALKBH5 Is a Mammalian RNA Demethylase that Impacts RNA Metabolism and Mouse Fertility. Mol. Cell 2013, 49, 18–29. [Google Scholar] [CrossRef] [Green Version]
  9. Wang, X.; Lu, Z.; Gomez, A.; Hon, G.C.; Yue, Y.; Han, D.; Fu, Y.; Parisien, M.; Dai, Q.; Jia, G.; et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 2013, 505, 117–120. [Google Scholar] [CrossRef] [Green Version]
  10. Xiao, W.; Adhikari, S.; Dahal, U.; Chen, Y.-S.; Hao, Y.-J.; Sun, B.-F.; Sun, H.-Y.; Li, A.; Ping, X.-L.; Lai, W.-Y.; et al. Nuclear m 6 A Reader YTHDC1 Regulates mRNA Splicing. Mol. Cell 2016, 61, 507–519. [Google Scholar] [CrossRef] [Green Version]
  11. Hsu, P.; Zhu, Y.; Ma, H.; Guo, Y.; Shi, X.; Liu, Y.; Qi, M.; Lu, Z.; Shi, H.; Wang, J.; et al. Ythdc2 is an N6-methyladenosine binding protein that regulates mammalian spermatogenesis. Cell Res. 2017, 27, 1115–1127. [Google Scholar] [CrossRef]
  12. Dominissini, D.; Moshitch-Moshkovitz, S.; Schwartz, S.; Salmon-Divon, M.; Ungar, L.; Osenberg, S.; Cesarkas, K.; Jacob-Hirsch, J.; Amariglio, N.; Kupiec, M.; et al. Topology of the human and mouse m6a rna methylomes revealed by m6a-seq. Nature 2012, 485, 201–206. [Google Scholar] [CrossRef]
  13. Frayling, T.M.; Timpson, N.J.; Weedon, M.N.; Zeggini, E.; Freathy, R.M.; Lindgren, C.M.; Perry, J.R.B.; Elliott, K.S.; Lango, H.; Rayner, N.W.; et al. A Common Variant in the FTO Gene Is Associated with Body Mass Index and Predisposes to Childhood and Adult Obesity. Science 2007, 316, 889–894. [Google Scholar] [CrossRef] [Green Version]
  14. Angelo, S.; Serena, S.; Chen, W.M.; Manuela, U.; Giuseppe, A.; James, S.; Samer, N.; Ramaiah, N.; Marco, O.; Gianluca, U. Genome-wide association scan shows genetic variants in the fto gene are associated with obesity-related traits. PLoS Genetics 2007, 3, e115. [Google Scholar]
  15. Shuling, L.; Huiling, T.; He Qian, e.a. FTO is a transcriptional repressor to auto-regulate its own gene and potentially associated with homeostasis of body weight. J Mol Cell Biol 2019, 11, 118–132. [Google Scholar]
  16. Loos, R.J.F.; Bouchard, C. FTO: The first gene contributing to common forms of human obesity. Obes. Rev. 2008, 9, 246–250. [Google Scholar] [CrossRef]
  17. Kathrin, I.; Stefanie, K.; Julia, F.; Kaisers, W.; Eberhard, D.; Rüther, U. Fto is a relevant factor for the development of the metabolic syndrome in mice. PLoS ONE 2014, 9, e105349. [Google Scholar]
  18. Guo, J.; Ren, W.; Li, A.; Ding, Y.; Guo, W.; Su, D.; Hu, C.; Xu, K.; Chen, H.; Xu, X.; et al. Fat Mass and Obesity-Associated Gene Enhances Oxidative Stress and Lipogenesis in Nonalcoholic Fatty Liver Disease. Dig. Dis. Sci. 2013, 58, 1004–1009. [Google Scholar] [CrossRef]
  19. Meyer, K.D.; Jaffrey, S.R. The dynamic epitranscriptome: N6-methyladenosine and gene expression control. Nat. Rev. Mol. Cell Biol. 2014, 15, 313–326. [Google Scholar] [CrossRef] [Green Version]
  20. Albrektsen, T.; Richter, H.E.; Clausen, J.T.; Fleckner, J. Identification of a novel integral plasma membrane protein induced during adipocyte differentiation. Biochem. J. 2001, 359, 393–402. [Google Scholar] [CrossRef]
  21. Bogner-Strauss, J.G.; Prokesch, A.; Sanchez-Cabo, F.; Rieder, D.; Hackl, H.; Duszka, K.; Krogsdam, A.; Di Camillo, B.; Walenta, E.; Klatzer, A.; et al. Reconstruction of gene association network reveals a transmembrane protein required for adipogenesis and targeted by PPARγ. Cell. Mol. Life Sci. 2010, 67, 4049–4064. [Google Scholar] [CrossRef] [PubMed]
  22. Pessentheiner, A.R.; Huber, K.; Pelzmann, H.J.; Prokesch, A.; Radner, F.P.W.; Wolinski, H.; Lindroos-Christensen, J.; Hoefler, G.; Rülicke, T.; Birner-Gruenberger, R.; et al. APMAP interacts with lysyl oxidase–like proteins, and disruption of Apmap leads to beneficial visceral adipose tissue expansion. FASEB J. 2017, 31, 4088–4103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Luo, G.; Hu, S.; Lai, T.; Wang, J.; Wang, L.; Lai, S. MiR-9-5p promotes rabbit preadipocyte differentiation by suppressing leptin gene expression. Lipids Heal. Dis. 2020, 19, 126. [Google Scholar] [CrossRef]
  24. Wu, R.; Liu, Y.; Yao, Y.; Zhao, Y.; Bi, Z.; Jiang, Q.; Liu, Q.; Cai, M.; Wang, F.; Wang, Y.; et al. FTO regulates adipogenesis by controlling cell cycle progression via m6A-YTHDF2 dependent mechanism. Biochim. Et Biophys. Acta (BBA) Mol. Cell Biol. Lipids 2018, 1863, 1323–1330. [Google Scholar] [CrossRef] [PubMed]
  25. He, H.; Cai, M.; Zhu, J.; Xiao, W.; Liu, B.; Shi, Y.; Yang, X.; Liang, X.; Zheng, T.; Hu, S.; et al. miR-148a-3p promotes rabbit preadipocyte differentiation by targeting PTEN. Vitr. Cell. Dev. Biol. Anim. 2018, 54, 241–249. [Google Scholar] [CrossRef] [PubMed]
  26. Uezumi, A.; Ito, T.; Morikawa, D.; Shimizu, N.; Yoneda, T.; Segawa, M.; Yamaguchi, M.; Ogawa, R.; Matev, M.M.; Miyagoe-Suzuki, Y.; et al. Fibrosis and adipogenesis originate from a common mesenchymal progenitor in skeletal muscle. J. Cell Sci. 2011, 124, 3654–3664. [Google Scholar] [CrossRef] [Green Version]
  27. R Core Team. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. 2015. Available online: https://www.r-project.org/ (accessed on 6 June 2022).
  28. Luo, G.; Wang, S.; Ai, Y.; Li, J.; Ren, Z. N6-Methyladenosine Methylome Profiling of Muscle and Adipose Tissues Reveals Methylase–mRNA Metabolic Regulatory Networks in Fat Deposition of Rex Rabbits. Biology 2022, 11, 944. [Google Scholar] [CrossRef]
  29. Wåhlén, K.; Sjölin, E.; Hoffstedt, J. The common rs9939609 gene variant of the fat mass- and obesity-associated gene FTO is related to fat cell lipolysis. J. Lipid Res. 2008, 49, 607–611. [Google Scholar] [CrossRef] [Green Version]
  30. Friebe, D.; Löffler, D.; Schönberg, M.; Bernhard, F.; Büttner, P.; Landgraf, K.; Kiess, W.; Körner, A. Impact of metabolic reg-ulators on the expression of the obesity associated genes fto and nampt in human preadipocytes and adipocytes. PLoS ONE 2011, 6, e19526. [Google Scholar] [CrossRef]
  31. Bravard, A.; Lefai, E.; Meugnier, E.; Pesenti, S.; Disse, E.; Vouillarmet, J.; Peretti, N.; Rabasa-Lhoret, R.; Laville, M.; Vidal, H.; et al. FTO Is Increased in Muscle During Type 2 Diabetes, and Its Overexpression in Myotubes Alters Insulin Signaling, Enhances Lipogenesis and ROS Production, and Induces Mitochondrial Dysfunction. Diabetes 2010, 60, 258–268. [Google Scholar] [CrossRef] [Green Version]
  32. Gerken, T.; Girard, C.A.; Loraine Tung, Y.-C.; Webby, C.J.; Saudek, V.; Hewitson, K.S.; Yeo, G.S.H.; McDonough, M.A.; Cunliffe, S.; McNeill, L.A.; et al. The obesity-associated fto gene encodes a 2-oxoglutarate-dependent nucleic acid demethylase. Science 2007, 318, 1469–1472. [Google Scholar] [CrossRef] [Green Version]
  33. Stratigopoulos, G.; Padilla, S.L.; LeDuc, C.A.; Watson, E.; Hattersley, A.T.; McCarthy, M.I.; Zeltser, L.M.; Chung, W.K.; Leibel, R.L. Regulation of Fto/Ftm gene expression in mice and humans. Am. J. Physiol. Integr. Comp. Physiol. 2008, 294, R1185–R1196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Xue, G.; Yong-Hyun, S.; Min, L.; Fei, W.; Qiang, T.; Zhang, P.; Krisztian, S. The fat mass and obesity associated gene fto functions in the brain to regulate postnatal growth in mice. PLoS ONE 2010, 5, e14005. [Google Scholar]
  35. Cusi, K.; Maezono, K.; Osman, A.; Pendergrass, M.; Patti, M.E.; Pratipanawatr, T.; DeFronzo, R.A.; Kahn, C.R.; Mandarino, L.J. Insulin resistance differentially affects the PI 3-kinase– and MAP kinase–mediated signaling in human muscle. J. Clin. Investig. 2000, 105, 311–320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Kadowaki, T. Insights into insulin resistance and type 2 diabetes from knockout mouse models. J. Clin. Investig. 2000, 106, 459–465. [Google Scholar] [CrossRef] [PubMed]
  37. Ma, Y.; Gao, J.; Yin, J.; Gu, L.; Liu, X.; Chen, S.; Huang, Q.; Lu, H.; Yang, Y.; Zhou, H.; et al. Identification of a Novel Function of Adipocyte Plasma Membrane-Associated Protein (APMAP) in Gestational Diabetes Mellitus by Proteomic Analysis of Omental Adipose Tissue. J. Proteome Res. 2016, 15, 628–637. [Google Scholar] [CrossRef]
  38. Fu, Y.; Dominissini, D.; Rechavi, G.; He, C. Gene expression regulation mediated through reversible m6A RNA methylation. Nat. Rev. Genet. 2014, 15, 293–306. [Google Scholar] [CrossRef]
  39. Xu, C.; Wang, X.; Liu, K.; Roundtree, I.A.; Tempel, W.; Li, Y.; Lu, Z.; He, C.; Min, J. Structural basis for selective binding of m6A RNA by the YTHDC1 YTH domain. Nat. Chem. Biol. 2014, 10, 927–929. [Google Scholar] [CrossRef]
  40. Shi, H.; Wang, X.; Lu, Z.; Zhao, B.S.; Ma, H.; Hsu, P.J.; Liu, C.; He, C. YTHDF3 facilitates translation and decay of N6-methyladenosine-modified RNA. Cell Res. 2017, 27, 315–328. [Google Scholar] [CrossRef] [Green Version]
  41. Wang, X.; Zhao, B.S.; Roundtree, I.A.; Lu, Z.; He, C. N(6)-methyladenosine modulates messenger rna translation efficiency. Cell 2015, 161, 1388–1399. [Google Scholar] [CrossRef] [Green Version]
  42. Wu, R.; Yao, Y.; Jiang, Q.; Cai, M.; Liu, Q.; Wang, Y.; Wang, X. Epigallocatechin gallate targets FTO and inhibits adipogenesis in an mRNA m6A-YTHDF2-dependent manner. Int. J. Obes. 2018, 42, 1378–1388. [Google Scholar] [CrossRef]
  43. Dani, C. Activins in adipogenesis and obesity. Int. J. Obes. 2012, 37, 163–166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Ruan, H.; Hacohen, N.; Golub, T.R.; Van Parijs, L.; Lodish, H.F. Tumor Necrosis Factor-α Suppresses Adipocyte-Specific Genes and Activates Expression of Preadipocyte Genes in 3T3-L1 Adipocytes. Diabetes 2002, 51, 1319–1336. [Google Scholar] [CrossRef] [Green Version]
  45. Ruan, H.; Lodish, H.F. Insulin resistance in adipose tissue: Direct and indirect effects of tumor necrosis factor-α. Cytokine Growth Factor Rev. 2003, 14, 447–455. [Google Scholar] [CrossRef]
  46. Ishizuka, K.; Usui, I.; Kanatani, Y.; Bukhari, A.; He, J.; Fujisaka, S.; Yamazaki, Y.; Suzuki, H.; Hiratani, K.; Ishiki, M.; et al. Chronic Tumor Necrosis Factor-α Treatment Causes Insulin Resistance via Insulin Receptor Substrate-1 Serine Phosphorylation and Suppressor of Cytokine Signaling-3 Induction in 3T3-L1 Adipocytes. Endocrinology 2007, 148, 2994–3003. [Google Scholar] [CrossRef]
  47. Mingrone, G.; Rosa, G.; Greco, A.; Manco, M.; Vega, N.; Nanni, G.; Castagneto, M.; Vidal, H. Intramyocitic lipid accumulation and SREBP-1c expression are related to insulin resistance and cardiovascular risk in morbid obesity. Atherosclerosis 2003, 170, 155–161. [Google Scholar] [CrossRef]
  48. Erol, A. Adipocyte insensitivity syndromes – novel approach to nutritional metabolic problems including obesity and obesity related disorders. Med Hypotheses 2005, 64, 826–832. [Google Scholar] [CrossRef] [PubMed]
  49. Smith, S.; Witkowski, A.; Joshi, A.K. Structural and functional organization of the animal fatty acid synthase. Prog. Lipid Res. 2003, 42, 289–317. [Google Scholar] [CrossRef] [PubMed]
  50. Semenkovich, C.F. Regulation of fatty acid synthase (FAS). Prog. Lipid Res. 1997, 36, 43–53. [Google Scholar] [CrossRef]
  51. Luo, G.; Wang, L.; Hu, S.; Du, K.; Wang, J.; Lai, S. Association of leptin mRNA expression with meat quality trait in Tianfu black rabbits. Anim. Biotechnol. 2020, 33, 480–486. [Google Scholar] [CrossRef]
Cells 12 00369 g001 550
Figure 1. Methylation modification and APMAP expression in muscle and fat tissues. (A) Examples of dynamic methylated with m6A peaks in APMAP gene (According to our m6A sequencing data and we selected an m6A modified gene from them. The article was published in Biology journal [28]. This figure does not exist in the published article. This figure only plays the role of leading out the research in this paper.); (B) APMAP expression in dorsal muscles at 35, 75, and 165 days of age; (C) APMAP expression in fat tissues at 35, 75, and 165 days of age ( ** p ≤ 0.01).
Figure 1. Methylation modification and APMAP expression in muscle and fat tissues. (A) Examples of dynamic methylated with m6A peaks in APMAP gene (According to our m6A sequencing data and we selected an m6A modified gene from them. The article was published in Biology journal [28]. This figure does not exist in the published article. This figure only plays the role of leading out the research in this paper.); (B) APMAP expression in dorsal muscles at 35, 75, and 165 days of age; (C) APMAP expression in fat tissues at 35, 75, and 165 days of age ( ** p ≤ 0.01).
Cells 12 00369 g001
Cells 12 00369 g002 550
Figure 2. Interference of FTO reduced preadipocyte differentiation: (A) FTO expression level after transfecting with si-FTO and NC; (B,C) FTO protein level after transfecting with si-FTO and NC; (D) lipid droplets (magnifications = 10 × 10); (E) lipid droplet content; (F) Triglyceride content; (G–I) PPARγ, CEBPα and FABP4 expression after transfecting with si-FTO and NC ( ** p ≤0.01).
Figure 2. Interference of FTO reduced preadipocyte differentiation: (A) FTO expression level after transfecting with si-FTO and NC; (B,C) FTO protein level after transfecting with si-FTO and NC; (D) lipid droplets (magnifications = 10 × 10); (E) lipid droplet content; (F) Triglyceride content; (G–I) PPARγ, CEBPα and FABP4 expression after transfecting with si-FTO and NC ( ** p ≤0.01).
Cells 12 00369 g002
Cells 12 00369 g003 550
Figure 3. Overexpression of FTO gene promoted preadipocyte differentiation: (A) FTO expression level after overexpression of FTO; (B,C) FTO protein level after overexpression of FTO; (D,E) size and content of lipid droplets (magnifications = 10 × 10); (F) Triglyceride content; (G–I) expression levels of PPARγ, CEBPα and FABP4 after overexpression of FTO ( ** p ≤0.01).
Figure 3. Overexpression of FTO gene promoted preadipocyte differentiation: (A) FTO expression level after overexpression of FTO; (B,C) FTO protein level after overexpression of FTO; (D,E) size and content of lipid droplets (magnifications = 10 × 10); (F) Triglyceride content; (G–I) expression levels of PPARγ, CEBPα and FABP4 after overexpression of FTO ( ** p ≤0.01).
Cells 12 00369 g003
Cells 12 00369 g004 550
Figure 4. Inhibition of YTHDF2 reduced the inhibitory effect of interference FTO gene on rabbit preadipocyte differentiation. (A) FTO expression after transfecting with si-FTO, si-YTHDF2 and NC; (B,C) FTO protein level after transfecting with si-FTO, si-YTHDF2 and NC; (D) YTHDF2 expression after transfecting with si-FTO, si-YTHDF2 and NC; (E) size of lipid droplets (magnifications = 10 × 10); (F) content of lipid droplets; (G) Triglyceride content; (H–J) expression levels of PPARγ, CEBPα and FABP4 after transfecting with si-FTO, si-YTHDF2 and NC; ( ** p ≤ 0.01).
Figure 4. Inhibition of YTHDF2 reduced the inhibitory effect of interference FTO gene on rabbit preadipocyte differentiation. (A) FTO expression after transfecting with si-FTO, si-YTHDF2 and NC; (B,C) FTO protein level after transfecting with si-FTO, si-YTHDF2 and NC; (D) YTHDF2 expression after transfecting with si-FTO, si-YTHDF2 and NC; (E) size of lipid droplets (magnifications = 10 × 10); (F) content of lipid droplets; (G) Triglyceride content; (H–J) expression levels of PPARγ, CEBPα and FABP4 after transfecting with si-FTO, si-YTHDF2 and NC; ( ** p ≤ 0.01).
Cells 12 00369 g004
Cells 12 00369 g005 550
Figure 5. FTO upregulated APMAP expression level in an m6A-YTHDF2 manner. (A) APMAP expression level after interfering with FTO gene; (B,C) APMAP protein level after interfering with FTO gene; (D) APMAP expression level after overexpression of FTO; (E) fold enrichment of APMAP gene after interfering with FTO gene; (F) APMAP expression level after interfering with FTO and YTHDF2 genes; (G,H) APMAP protein levels after interfering with FTO and YTHDF2 genes; (I) fold enrichment of APMAP gene after interfering with FTO and YTHDF2 genes; ( ** p ≤ 0.01).
Figure 5. FTO upregulated APMAP expression level in an m6A-YTHDF2 manner. (A) APMAP expression level after interfering with FTO gene; (B,C) APMAP protein level after interfering with FTO gene; (D) APMAP expression level after overexpression of FTO; (E) fold enrichment of APMAP gene after interfering with FTO gene; (F) APMAP expression level after interfering with FTO and YTHDF2 genes; (G,H) APMAP protein levels after interfering with FTO and YTHDF2 genes; (I) fold enrichment of APMAP gene after interfering with FTO and YTHDF2 genes; ( ** p ≤ 0.01).
Cells 12 00369 g005
Cells 12 00369 g006 550
Figure 6. Inhibition of APMAP gene inhibited rabbit preadipocyte differentiation: (A) APMAP expression level after transfecting with si-APMAP and NC; (B,C) APMAP protein level after transfecting with si-APMAP and NC; (D) size of lipid droplets (magnifications = 10 × 10); (E) content of lipid droplets; (F) Triglyceride content; (G–I) PPARγ, CEBPα, and FABP4 expression after transfecting si-APMAP and NC ( ** p ≤ 0.01).
Figure 6. Inhibition of APMAP gene inhibited rabbit preadipocyte differentiation: (A) APMAP expression level after transfecting with si-APMAP and NC; (B,C) APMAP protein level after transfecting with si-APMAP and NC; (D) size of lipid droplets (magnifications = 10 × 10); (E) content of lipid droplets; (F) Triglyceride content; (G–I) PPARγ, CEBPα, and FABP4 expression after transfecting si-APMAP and NC ( ** p ≤ 0.01).
Cells 12 00369 g006
Cells 12 00369 g007 550
Figure 7. Regulatory mechanisms by which FTO affects intramuscular fat of Rex rabbits through m6A/YTHDF2/APMAP pathway.
Figure 7. Regulatory mechanisms by which FTO affects intramuscular fat of Rex rabbits through m6A/YTHDF2/APMAP pathway.
Cells 12 00369 g007
Table
Table 1. Primers.
Table 1. Primers.
Gene NamePrimer Sequence (5′-3′)(Tm/°C)CG%(Product Size/bp)
FTOATCCCGATCTCTCACCACAC6055183
ACATCTGCGGACCATACAAA 45
YTHDF2CAGACACAGCCATTGCCTCCAC6059122
CCGTTATGACCGAACCCACTGC 59
APMAPGCTGCTGGATTCTCCCATAG6055163
AAACATCACGTCCCCGATAT 45
PPARγGAGGACATCCAGGACAACC6158168
GTCCGTCTCCGTCTTCTTT 53
β-actinGGAGATCGTGCGGGACAT61.461318
GTTGAAGGTGGTCTCGTGGAT 52
C/EBPαGCGGGAACGAACAACAT6453172
GGCGGTCATTGTCACTGGTC 6
FABP4GGCCAGGAATTTGATGAAGTC61.448140
AGTTTATCGCCCTCCCGTT 53
si-YTHDF2CAUGAAUACUAUAGACCAATT 29
UUGGUCUAUAGUAUUCAUGTT 29
si-FTOGCAGCUGAAAUAUCCUAAATT 33
UUUAGGAUAUUUCAGCUGCTT 33
si-APMAPGUGGAAAGGCUAUUUGAAATT 33
UUUCAAAUAGCCUUUCCACTT 33
over-FTOGCTAGCGCCACCATGAAGC 63
CTCGAGCTAAGGCTTTGCTTCC 55
Negative ControlUUCUCCGAACGUGUCACGUTT 48
ACGUGACACGUUCGGAGAATT 48
Table
Table 2. APMAP expression affected IMF in Rex rabbits (regression coefficients, standard errors, and probability levels).
Table 2. APMAP expression affected IMF in Rex rabbits (regression coefficients, standard errors, and probability levels).
Model CoefficientStd Errorp-Value
Intercept0.00013470.01999960.99472
APMAP Expression in longissimus lumborum0.00070150.00018040.00164
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Luo, G.; Hong, T.; Yu, L.; Ren, Z. FTO Regulated Intramuscular Fat by Targeting APMAP Gene via an m6A-YTHDF2-dependent Manner in Rex Rabbits. Cells 2023, 12, 369. https://doi.org/10.3390/cells12030369

AMA Style

Luo G, Hong T, Yu L, Ren Z. FTO Regulated Intramuscular Fat by Targeting APMAP Gene via an m6A-YTHDF2-dependent Manner in Rex Rabbits. Cells. 2023; 12(3):369. https://doi.org/10.3390/cells12030369

Chicago/Turabian Style

Luo, Gang, Tingting Hong, Lin Yu, and Zhanjun Ren. 2023. "FTO Regulated Intramuscular Fat by Targeting APMAP Gene via an m6A-YTHDF2-dependent Manner in Rex Rabbits" Cells 12, no. 3: 369. https://doi.org/10.3390/cells12030369

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop