Queuine Salvaging in the Human Parasite Entamoeba histolytica
Abstract
:1. Introduction
2. Materials and Methods
2.1. E. histolytica Culture
2.2. Transfection of E. histolytica Trophozoites
2.3. Resistance of E. histolytica Trophozoites to OS
2.4. Growth Rate of E. histolytica Trophozoites
2.5. Construction of GST-Tagged EhDUF2419 Vector
2.6. Construction of Silenced EhDUF2419 Vector
2.7. Preparation of Recombinant GST-Tagged EhDUF2419
2.8. Preparation of Recombinant GST
2.9. Enzymatic Activity of EhDUF2419
2.10. Quantification of tRNA Modifications in E. histolytica by LC-MS/MS
2.11. tRNA Purification Using HPLC
2.12. Hydrolysis of tRNA to Nucleosides
2.13. LC-MS/MS Quantification Analysis
2.14. N-Acryloyl-3-Aminophenylboronic Acid (APB) Northern Blotting for E. histolytica tRNAHisGUG
2.15. Quantitative-Real Time PCR
2.16. Western Blotting
2.17. Statistical Analysis
3. Results and Discussion
3.1. Salvage of Queuine from Q and from E. coli K12 by E. histolytica
3.2. Characterization of EhDUF2419 as an Enzyme That Salvages Queuine from Q in E. histolytica
3.3. Phenotypical Characterization of siEhDUF2419 Trophozoites
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bansal, D.; Sehgal, R.; Chawla, Y.; Mahajan, R.C.; Malla, N. In vitro activity of antiamoebic drugs against clinical isolates of Entamoeba histolytica and Entamoeba dispar. Ann. Clin. Microbiol. Antimicrob. 2004, 3, 27. [Google Scholar] [CrossRef] [PubMed]
- Chatterjee, B.; Shen, C.J.; Majumder, P. RNA Modifications and RNA Metabolism in Neurological Disease Pathogenesis. Int. J. Mol. Sci. 2021, 22, 11870. [Google Scholar] [CrossRef] [PubMed]
- Xue, C.; Chu, Q.; Zheng, Q.; Jiang, S.; Bao, Z.; Su, Y.; Lu, J.; Li, L. Role of main RNA modifications in cancer: N(6)-methyladenosine, 5-methylcytosine, and pseudouridine. Signal Transduct. Target. Ther. 2022, 7, 142. [Google Scholar] [CrossRef] [PubMed]
- Fergus, C.; Barnes, D.; Alqasem, M.A.; Kelly, V.P. The queuine micronutrient: Charting a course from microbe to man. Nutrients 2015, 7, 2897–2929. [Google Scholar] [CrossRef] [PubMed]
- Walden, T.; Reyniers, J.P.; Hiatt, V.; Farkas, W.R. Yeast cells cannot incorporate queuine into their tRNA. Proc. Soc. Exp. Biol. Medicine. Soc. Exp. Biol. Med. 1982, 170, 328–332. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.; Zallot, R.; Grove, T.L.; Payan, D.J.; Martin-Verstraete, I.; Sepic, S.; Balamkundu, S.; Neelakandan, R.; Gadi, V.K.; Liu, C.F.; et al. Discovery of novel bacterial queuine salvage enzymes and pathways in human pathogens. Proc. Natl. Acad. Sci. USA 2019, 116, 19126–19135. [Google Scholar] [CrossRef] [PubMed]
- Katze, J.R.; Basile, B.; McCloskey, J.A. Queuine, a modified base incorporated posttranscriptionally into eukaryotic transfer RNA: Wide distribution in nature. Science 1982, 216, 55–56. [Google Scholar] [CrossRef] [PubMed]
- Ott, G.; Kersten, H.; Nishimura, S. Dictyostelium discoideum: A useful model system to evaluate the function of queuine and of the Q-family of tRNAs. FEBS Lett. 1982, 146, 311–314. [Google Scholar] [CrossRef]
- Farkas, W.R. Effect of diet on the queuosine family of tRNAs of germ-free mice. J. Biol. Chem. 1980, 255, 6832–6835. [Google Scholar] [CrossRef]
- Sievers, K.; Welp, L.; Urlaub, H.; Ficner, R. Structural and functional insights into human tRNA guanine transgylcosylase. RNA Biol. 2021, 18, 382–396. [Google Scholar] [CrossRef] [PubMed]
- Goodenough-Lashua, D.M.; Garcia, G.A. tRNA-guanine transglycosylase from E. coli: A ping-pong kinetic mechanism is consistent with nucleophilic catalysis. Bioorganic Chem. 2003, 31, 331–344. [Google Scholar] [CrossRef]
- Nagaraja, S.; Cai, M.W.; Sun, J.; Varet, H.; Sarid, L.; Trebicz-Geffen, M.; Shaulov, Y.; Mazumdar, M.; Legendre, R.; Coppee, J.Y.; et al. Queuine Is a Nutritional Regulator of Entamoeba histolytica Response to Oxidative Stress and a Virulence Attenuator. mBio 2021, 12. [Google Scholar] [CrossRef]
- Gunduz, U.; Katze, J.R. Queuine salvage in mammalian cells. Evidence that queuine is generated from queuosine 5′-phosphate. J. Biol. Chem. 1984, 259, 1110–1113. [Google Scholar] [CrossRef]
- Kirtland, G.M.; Morris, T.D.; Moore, P.H.; O’Brian, J.J.; Edmonds, C.G.; McCloskey, J.A.; Katze, J.R. Novel salvage of queuine from queuosine and absence of queuine synthesis in Chlorella pyrenoidosa and Chlamydomonas reinhardtii. J. Bacteriol. 1988, 170, 5633–5641. [Google Scholar] [CrossRef] [PubMed]
- Zallot, R.; Brochier-Armanet, C.; Gaston, K.W.; Forouhar, F.; Limbach, P.A.; Hunt, J.F.; de Crecy-Lagard, V. Plant, animal, and fungal micronutrient queuosine is salvaged by members of the DUF2419 protein family. ACS Chem. Biol. 2014, 9, 1812–1825. [Google Scholar] [CrossRef] [PubMed]
- Diamond, L.S.; Harlow, D.R.; Cunnick, C.C. A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans. R. Soc. Trop. Med. Hyg. 1978, 72, 431–432. [Google Scholar] [CrossRef]
- Olvera, A.; Olvera, F.; Vines, R.R.; Recillas-Targa, F.; Lizardi, P.M.; Dhar, S.; Bhattacharya, S.; Petri, W., Jr.; Alagon, A. Stable transfection of Entamoeba histolytica trophozoites by lipofection. Arch. Med. Res. 1997, 28, 49–51. [Google Scholar]
- Shahi, P.; Trebicz-Geffen, M.; Nagaraja, S.; Hertz, R.; Baumel-Alterzon, S.; Methling, K.; Lalk, M.; Mazumder, M.; Samudrala, G.; Ankri, S. N-acetyl ornithine deacetylase is a moonlighting protein and is involved in the adaptation of Entamoeba histolytica to nitrosative stress. Sci. Rep. 2016, 6, 36323. [Google Scholar] [CrossRef]
- Su, D.; Chan, C.T.; Gu, C.; Lim, K.S.; Chionh, Y.H.; McBee, M.E.; Russell, B.S.; Babu, I.R.; Begley, T.J.; Dedon, P.C. Quantitative analysis of ribonucleoside modifications in tRNA by HPLC-coupled mass spectrometry. Nat. Protoc. 2014, 9, 828–841. [Google Scholar] [CrossRef] [PubMed]
- Igloi, G.L.; Kossel, H. Affinity electrophoresis for monitoring terminal phosphorylation and the presence of queuosine in RNA. Application of polyacrylamide containing a covalently bound boronic acid. Nucleic Acids Res. 1985, 13, 6881–6898. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Hertz, R.; Tovy, A.; Kirschenbaum, M.; Geffen, M.; Nozaki, T.; Adir, N.; Ankri, S. The Entamoeba histolytica Dnmt2 homolog (Ehmeth) confers resistance to nitrosative stress. Eukaryot. Cell 2014, 13, 494–503. [Google Scholar] [CrossRef] [PubMed]
- Gish, W.; States, D.J. Identification of protein coding regions by database similarity search. Nat. Genet. 1993, 3, 266–272. [Google Scholar] [CrossRef] [PubMed]
- Das, P.; Das, S.R.; Moorji, A.; Baer, H.P. Characterization of nucleoside uptake and transport in Entamoeba histolytica. Parasitol. Res. 1997, 83, 364–369. [Google Scholar] [CrossRef] [PubMed]
- Anwar, T.; Samudrala, G. Bioinformatics Analysis and Functional Prediction of Transmembrane Proteins in Entamoeba histolytica. Genes 2018, 9, 499. [Google Scholar] [CrossRef]
- Dean, P.; Major, P.; Nakjang, S.; Hirt, R.P.; Embley, T.M. Transport proteins of parasitic protists and their role in nutrient salvage. Front. Plant Sci. 2014, 5, 153. [Google Scholar] [CrossRef]
- Iyer, L.R.; Verma, A.K.; Paul, J.; Bhattacharya, A. Phagocytosis of Gut Bacteria by Entamoeba histolytica. Front. Cell. Infect. Microbiol. 2019, 9, 34. [Google Scholar] [CrossRef]
- Brooks, A.F.; Velez-Martinez, C.S.; Showalter, H.D.; Garcia, G.A. Investigating the prevalence of queuine in Escherichia coli RNA via incorporation of the tritium-labeled precursor, preQ(1). Biochem. Biophys. Res. Commun. 2012, 425, 83–88. [Google Scholar] [CrossRef]
- Gaur, R.; Varshney, U. Genetic analysis identifies a function for the queC (ybaX) gene product at an initial step in the queuosine biosynthetic pathway in Escherichia coli. J. Bacteriol. 2005, 187, 6893–6901. [Google Scholar] [CrossRef]
- Coyte, K.Z.; Rakoff-Nahoum, S. Understanding Competition and Cooperation within the Mammalian Gut Microbiome. Curr. Biol. 2019, 29, R538–R544. [Google Scholar] [CrossRef]
- Morf, L.; Pearson, R.J.; Wang, A.S.; Singh, U. Robust gene silencing mediated by antisense small RNAs in the pathogenic protist Entamoeba histolytica. Nucleic Acids Res. 2013, 41, 9424–9437. [Google Scholar] [CrossRef] [PubMed]
- Ankri, S. Entamoeba histolytica-Gut Microbiota Interaction: More Than Meets the Eye. Microorganisms 2021, 9, 581. [Google Scholar] [CrossRef] [PubMed]
- Rigottier-Gois, L. Dysbiosis in inflammatory bowel diseases: The oxygen hypothesis. ISME J. 2013, 7, 1256–1261. [Google Scholar] [CrossRef] [PubMed]
- Singhal, R.; Shah, Y.M. Oxygen battle in the gut: Hypoxia and hypoxia-inducible factors in metabolic and inflammatory responses in the intestine. J. Biol. Chem. 2020, 295, 10493–10505. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence | Direction | Used for |
---|---|---|---|
5′ BamHI EhDUF2419 | GGATCCATGTGTGAATATGTTCGTTGG | Sense | pGEX-EhDUF2419 vector |
3′ EhDUF2419 | ATAAAAAATGGTTTGTGTTCGGTGG | Anti-sense | pGEX-EhDUF2419 vector |
5′ EhDUF2419 set 3 | CACCCTGAAGTTTTTGAGCC | Sense | qPCR |
3′ EhDUF2419 set 3 | GGTTGAATCTCTAAACCCAGG | Anti-sense | qPCR |
5′ BglII EhDUF2419 | AGATCTATGTGTGAATATGTTCGTTGGA | Sense | siEhDUF2419 vector |
3′ XhoI EhDUF2419 | CTCGAGATAAAAAATGGTTTGTGTTCGGTGG | Anti-sense | siEhDUF2419 vector |
rDNA5′ | TCAAAAAGCAACGTCGCTA | Sense | qPCR |
rDNA3′ | AGCCCGTAAGGTGATTTCT | Anti-sense | qPCR |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sarid, L.; Sun, J.; Chittrakanwong, J.; Trebicz-Geffen, M.; Ye, J.; Dedon, P.C.; Ankri, S. Queuine Salvaging in the Human Parasite Entamoeba histolytica. Cells 2022, 11, 2509. https://doi.org/10.3390/cells11162509
Sarid L, Sun J, Chittrakanwong J, Trebicz-Geffen M, Ye J, Dedon PC, Ankri S. Queuine Salvaging in the Human Parasite Entamoeba histolytica. Cells. 2022; 11(16):2509. https://doi.org/10.3390/cells11162509
Chicago/Turabian StyleSarid, Lotem, Jingjing Sun, Jurairat Chittrakanwong, Meirav Trebicz-Geffen, Jun Ye, Peter C. Dedon, and Serge Ankri. 2022. "Queuine Salvaging in the Human Parasite Entamoeba histolytica" Cells 11, no. 16: 2509. https://doi.org/10.3390/cells11162509