Taxifolin Inhibits WSSV Infection and Transmission by Increasing the Innate Immune Response in Litopenaeus vannamei
Abstract
:1. Introduction
2. Materials and Methods
2.1. Shrimp, WSSV and Medicines
2.2. Acute Toxicity of Molecules on Shrimp
2.3. Anti-WSSV Effect of Medicines
2.4. Stability of Taxifolin
2.5. Effect of Taxifolin on Horizontal Transmission of WSSV
2.6. Effect of Taxifolin on Innate Immunity of Shrimp
2.7. Effects of Dietary Supplementation with Taxifolin on WSSV Replication
2.8. Statistical Analysis
3. Results
3.1. Preliminary Screening on Active Small Molecules
3.2. Anti-WSSV Activity of Taxifolin
3.3. The Stability of Taxifolin
3.4. Effect of Continuous Taxifolin Treatment on WSSV Replication
3.5. Taxifolin Inhibits Horizontal Transmission of WSSV
3.6. Effects of Taxifolin on Expression of Immune-Related Genes
3.7. Dietary Supplementation with Taxifolin Inhibited WSSV Replication in Shrimp
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jennings, S.; Stentiford, G.D.; Leocadio, A.M.; Jeffery, K.R.; Metcalfe, J.D.; Katsiadaki, I.; Neil, A.A.; Stephen, C.M.; John, K.P.; Tim, E.; et al. Aquatic food security: Insights into challenges and solutions from an analysis of interactions between fisheries, aquaculture, food safety, human health, fish and human welfare, economy and environment. Fish Fish. 2016, 17, 893–938. [Google Scholar] [CrossRef] [Green Version]
- Fajardo, C.; Martinez-Rodriguez, G.; Costas, B.; Mancera, J.M.; Fernandez-Boo, S.; Rodulfo, H.; Donato, M.D. Shrimp immune response: A transcriptomic perspective. Rev. Aquacult. 2022, 14, 1136–1149. [Google Scholar] [CrossRef]
- JH, P.; Ys, L.; Lee, S.; Lee, Y. An infectious viral disease of penaeid shrimp newly found in Korea. Dis. Aquat. Organ. 1998, 34, 71–75. [Google Scholar]
- Stentiford, G.D.; Lightner, D.V. Cases of White Spot Disease (WSD) in European shrimp farms. Aquaculture 2011, 319, 302–306. [Google Scholar] [CrossRef]
- Flegel, T.W. Major viral diseases of the black tiger prawn (Penaeus monodon) in Thailand. World J. Microb. Biot. 1997, 13, 433–442. [Google Scholar] [CrossRef]
- CF, L.; Ho, C.H.; Peng, S.E.; Chen, C.H.; Hsu, H.C.; Chiu, Y.L.; Chang, C.F.; Liu, K.F.; Su, M.S.; Wang, C.H.; et al. White spot syndrome baculovirus (WSBV) detected in cultured and captured shrimp, crabs and other arthropods. Dis. Aquat. Organ. 1996, 27, 215–225. [Google Scholar]
- Lightner, D.V.; Redman, R.M.; Pantoja, C.R.; Tang, K.; Noble, B.L.; Schofield, P.; Mohney, L.L.; Nunan, L.M.; Navarro, S.A. Historic emergence, impact and current status of shrimp pathogens in the Americas. J. Invertebr. Pathol. 2012, 110, 174–183. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Shan, L.P.; Yan, M.C.; Liu, G.L.; Chen, J. Infection of WSSV shows potential promise of a novel antiviral amino nitrophenyl medicine for application in culture of shrimp seedling. Aquaculture 2021, 534, 736283. [Google Scholar] [CrossRef]
- Park, J.H.; Seok, S.H.; Cho, S.A.; Baek, M.W.; Lee, H.Y.; Kim, D.J.; Kim, H.Y.; Chang, S.O.; Park, J.H. Safety and protective effect of a disinfectant (STEL water) for white spot syndrome viral infection in shrimp. Dis. Aqua. Organ. 2004, 60, 253–257. [Google Scholar] [CrossRef] [PubMed]
- Lulijwa, R.; Rupia, E.J.; Alfaro, A.C. Antibiotic use in aquaculture, policies and regulation, health and environmental risks: A review of the top 15 major producers. Rev. Aqua. 2020, 12, 640–663. [Google Scholar] [CrossRef]
- Ring, E.; Olsen, R.E.; Gifstad, T.Ø.; Dalmo, R.A.; Amlund, H.; Hemre, G.I.; Bakke, A.M. Prebiotics in aquaculture: A review. Aquacult. Nutr. 2010, 16, 117–136. [Google Scholar] [CrossRef]
- Reverter, M.; Bontemps, N.; Lecchini, D.; Banaigs, B.; Sasal, P. Use of plant extracts in fish aquaculture as an alternative to chemotherapy: Current status and future perspectives. Aquaculture 2014, 433, 50–61. [Google Scholar] [CrossRef]
- Stratev, D.; Zhelyazkov, G.; Noundou, X.S.; Krause, R.W. Beneficial effects of medicinal plants in fish diseases. Aquacult. Int. 2018, 26, 289–308. [Google Scholar] [CrossRef]
- Afe, O.E.; Omosowone, O.O. Growth and feed utilization in Clarias gariepinus fingerlings fed on Acacia auriculiformis leaf supplemented diets. Int. J. Fish. Aquac. 2019, 11, 55–61. [Google Scholar] [CrossRef] [Green Version]
- Beltrán, J.M.G.; Espinosa, C.; Guardiola, F.A.; Esteban, M.Á. In vitro effects of Origanum vulgare leaf extracts on gilthead seabream (Sparus aurata L.) leucocytes, cytotoxic, bactericidal and antioxidant activities. Fish Shellfish Immunol. 2018, 79, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Palanikumar, P.; Daffni, B.D.J.; Lelin, C.; Thirumalaikumar, E.; Michaelbabu, M.; Citarasu, T. Effect of Argemone mexicana active principles on inhibiting viral multiplication and stimulating immune system in Pacific white leg shrimp Litopenaeus vannamei against white spot syndrome virus. Fish Shellfish Immunol. 2018, 75, 243–252. [Google Scholar] [CrossRef] [PubMed]
- Citarasu, T.; Sivaram, V.; Immanuel, G.; Rout, N.; Murugan, V. Influence of selected Indian immunostimulant herbs against white spot syndrome virus (WSSV) infection in black tiger shrimp, Penaeus monodon with reference to haematological, biochemical and immunological changes. Fish Shellfish Immunol. 2006, 21, 372–384. [Google Scholar] [CrossRef]
- Sanchez-Paz, A. White spot syndrome virus: An overview on an emergent concern. Vet. Res. 2010, 41, 43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, W.C.; Liu, L.; Shen, Y.F.; Hu, Y.; Ling, F.; Wang, G.X.; Zhu, B. A new coumarin derivative plays a role in rhabdoviral clearance by interfering glycoprotein function during the early stage of viral infection. Cell Signal. 2018, 51, 199–210. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Liu, L.; Li, B.; Shen, Y.; Wang, G.X.; Zhu, B. Synthesis of arctigenin derivatives against infectious hematopoietic necrosis virus. Eur. J. Med. Chem. 2019, 163, 183–194. [Google Scholar] [CrossRef]
- Yu, Q.; Liu, M.; Xiao, H.; Wu, S.; Qin, X.; Lu, Z.; Shi, D.; Li, S.; Mi, H.; Wang, Y.; et al. The inhibitory activities and antiviral mechanism of Viola philippica aqueous extracts against grouper iridovirus infection in vitro and in vivo. J. Fish. Dis. 2019, 42, 859–868. [Google Scholar] [CrossRef] [PubMed]
- Huang, A.G.; Tan, X.P.; Cui, H.B.; Qi, X.Z.; Zhu, B.; Wang, G.X. Antiviral activity of geniposidic acid against white spot syndrome virus replication in red swamp crayfish Procambarus clarkii. Aquaculture 2020, 528, 735533. [Google Scholar] [CrossRef]
- Bachere, E.; Gueguen, Y.; Gonzalez, M.; Lorgeril, J.; Garnier, J.; Romestand, B. Insights into the anti-microbial defense of marine invertebrates: The penaeid shrimps and the oyster Crassostrea gigas. Immunol. Rev. 2004, 198, 149–168. [Google Scholar] [CrossRef]
- Rajkumar, T.; Taju, G.; Majeed, S.A.; Sajid, M.S.; Kumar, S.S.; Sivakumar, S.; Hameed, A.S. Ontogenetic changes in the expression of immune related genes in response to immunostimulants and resistance against white spot syndrome virus in Litopenaeus vannamei. Dev. Comp. Immunol. 2017, 76, 132–142. [Google Scholar] [CrossRef]
- Cantelli, L.; Goncalves, P.; Guertler, C.; Kayser, M.; Pilotto, M.R.; Barracco, M.A.; Perazzolo, L.M. Dietary supplementation with sulfated polysaccharides from Gracilaria birdiae promotes a delayed immunostimulation in marine shrimp challenged by the white spot syndrome virus. Aquacult. Int. 2019, 27, 349–367. [Google Scholar] [CrossRef]
- Shan, L.P.; Hu, L.H.; Zhao, Q.; Yan, M.C.; Chen, J.P. Difference in medication pattern potentially enhances antiviral efficiency of a novel amino-fluorophenyl compound on WSS risk in shrimp seedling culture. Aquaculture 2021, 539, 736670. [Google Scholar] [CrossRef]
- Dhanasekaran, S.; Doherty, T.M.; Kenneth, J. Comparison of different standards for real-time PCR-based absolute quantification. J. Immunol. Methods 2010, 354, 34–39. [Google Scholar] [CrossRef]
- Liu, L.; Song, D.W.; Liu, G.L.; Shan, L.P.; Qiu, T.X.; Chen, J. Hydroxycoumarin efficiently inhibits spring viraemia of carp virus infection in vitro and in vivo. Zool. Res. 2020, 41, 395–409. [Google Scholar] [CrossRef]
- Wang, H.; Qiu, T.X.; Lu, J.F.; Liu, H.W.; Hu, L.; Liu, L.; Chen, J. Potential aquatic environmental risks of trifloxystrobin: Enhancement of virus susceptibility in zebrafish through initiation of autophagy. Zool. Res. 2021, 42, 339–349. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Qiu, W.; Geng, R.; Zuo, H.L.; Wang, S.P.; He, J.G.; Xu, X.P. Toll receptor 2 (Toll2) positively regulates antibacterial immunity but promotes white spot syndrome virus (WSSV) infection in shrimp. Dev. Comp. Immunol. 2021, 115, 103878. [Google Scholar] [CrossRef] [PubMed]
- Yuan, F.H.; Chen, Y.G.; Zhang, Z.Z.; Yue, H.T.; Bi, H.T.; Yuan, K.; Weng, S.P. Down-regulation apoptosis signal-regulating kinase 1 gene reduced the Litopenaeus vannamei hemocyte apoptosis in WSSV infection. Fish Shellfish Immunol. 2016, 50, 109–116. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Yin, B.; Wang, S.; Fu, Q.H.; Xiao, B.; Lu, K.; He, J.G.; Li, C.Z. RNAi screening identifies a new Toll from shrimp Litopenaeus vannamei that restricts WSSV infection through activating Dorsal to induce antimicrobial peptides. PLoS Pathog. 2018, 14, e1007109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pirarat, N.; Pinpimai, K.; Endo, M.; Katagiri, T.; Ponpornpisit, A.; Chansue, N.; Maita, M. Modulation of intestinal morphology and immunity in Nile tilapia (Oreochromis niloticus) by Lactobacillus rhamnosus GG. Res. Vet. Sci. 2011, 91, e92–e97. [Google Scholar] [CrossRef] [PubMed]
- Luo, L.; Chen, X.X.; Cai, X.F. Effects of Andrographis paniculate on the variation of intestinal microflora of Ctenopharyngodon idellus. J. Fish. China 2001, 3, 232–237. [Google Scholar]
- Verbruggen, B.; Bickley, L.K.; Aerle, R.; Bateman, K.S.; Stentiford, G.D.; Santos, E.M.; Tyler, C.R. Molecular mechanisms of white spot syndrome virus infection and perspectives on treatments. Viruses 2016, 8, 23. [Google Scholar] [CrossRef] [Green Version]
- Pradeep, B.; Rai, P.; Mohan, S.A.; Shekhar, M.S.; Karunasagar, I. Biology, Host Range, Pathogenesis and Diagnosis of White spot syndrome virus. Indian J. Virol. 2012, 23, 161–174. [Google Scholar] [CrossRef] [Green Version]
- Shan, L.P.; Zhang, X.; Hu, Y.; Liu, L.; Chen, J. Antiviral activity of esculin against white spot syndrome virus: A new starting point for prevention and control of white spot disease outbreaks in shrimp seedling culture. J. Fish. Dis. 2022, 45, 59–68. [Google Scholar] [CrossRef]
- Shan, L.P.; Zhou, Y.; Yan, M.C.; Liu, L.; Chen, J.; Chen, J.P. A novel antiviral coumarin derivative as a potential agent against WSSV infection in shrimp seedling culture. Virus Res. 2021, 297, 198387. [Google Scholar] [CrossRef]
- Chen, K.; Hsu, T.; Huang, P.; Kang, S.; Lo, C.; Huang, W.; Chen, L. Penaeus monodon chitin binding protein (PmCBP) is involved in white spot syndrome virus (WSSV) infection. Fish Shellfish Immunol. 2009, 27, 460–465. [Google Scholar] [CrossRef]
- Li, L.; Lin, S.; Yang, F. Characterization of an envelope protein (VP110) of White spot syndrome virus. J. Gen. Virol. 2006, 87, 1909–1915. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Qiu, T.X.; Song, D.W.; Shan, L.P.; Chen, J. Inhibition of a novel coumarin on an aquatic rhabdovirus by targeting the early stage of viral infection demonstrates potential application in aquaculture. Antivir. Res. 2020, 174, 104672. [Google Scholar] [CrossRef] [PubMed]
- Tjwa, E.T.T.L.; Zoutendijk, R.; VanOord, G.W.; Boeijen, L.L.; Reijnders, J.G.P.; Van-Campenhout, M.J.H.; Knegt, R.J.; Janssen, H.L.A.; Woltman, A.M.; Boonstra, A. Similar frequencies, phenotype and activation status of intrahepatic NK cells in chronic HBV patients after long-term treatment with tenofovir disoproxil fumarate (TDF). Antivir. Res. 2016, 132, 70–75. [Google Scholar] [CrossRef] [PubMed]
- Citarasu, T. Herbal biomedicines: A new opportunity for aquaculture industry. Aquac. Int. 2010, 18, 403–414. [Google Scholar] [CrossRef]
- Zhang, Y.; Bian, Y.; Cui, Q.; Yuan, C.; Lin, Y.; Li, J.; Meng, P. Effect of dietary complex Chinese herbal medicine on growth performance, digestive enzyme activities in tissues and expression of genes involved in the digestive enzymes and antioxidant enzymes and bacterial challenge in Litopenaeus vannamei. Aquac. Res. 2021, 52, 6741–6750. [Google Scholar] [CrossRef]
- Wang, M.; Gang, P.; Qin, Q.; Tang, S. Effects of chinese herbal medicine on the immunity function of Macrobrachium nipponense as additive in feed. J. Aqua. 2008, 2, 8–10. [Google Scholar]
- Liu, Y.; Tong, B.; Wang, S.; Li, G.; Tan, Y.; Yu, H.; Yu, Y. A mini review of Yu-Ping-Feng polysaccharides: Their biological activities and potential applications in aquaculture. Aquac. Rep. 2021, 20, 100697. [Google Scholar] [CrossRef]
- Huang, A.G.; Tu, X.; Qi, X.Z.; Ling, F.; Zhu, B.; Wang, G.X. Gardenia jasminoides ellis inhibit white spot syndrome virus replication in red swamp crayfish Procambarus clarkii. Aquaculture 2019, 504, 239–247. [Google Scholar] [CrossRef]
- Jiravanichpaisal, P.; Lee, B.L.; Söderhäll, K. Cell-mediated immunity in arthropods: Hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006, 211, 213–236. [Google Scholar] [CrossRef]
- Kulkarni, A.; Krishnan, S.; Anand, D.; Kokkattunivarthil, U.S.; Otta, S.K.; Karunasagar, I.; Kooloth, V.R. Immune responses and immunoprotection in crustaceans with special reference to shrimp. Rev. Aquacult. 2021, 13, 431–459. [Google Scholar] [CrossRef]
- Peters, C.W.; Kruse, U.; Pollwein, R.; Grzeschik, K.H.; Sippel, A.E. The human lysozyme gene: Sequence organization and chromosomal localization. Eur. J. Biochem. 1989, 182, 507–516. [Google Scholar] [CrossRef] [PubMed]
- Kaizu, A.; Fagutao, F.F.; Kondo, H.; Aoki, T.; Hirono, I. Functional analysis of C-type lysozyme in penaeid shrimp. J. Biol. Chem. 2011, 286, 44344–44349. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.; Jiravanichpaisal, P.; Söderhäll, I.; Cerenius, L.; Söderhäll, K. Antilipopolysaccharide factor interferes with white spot syndrome virus replication in vitro and in vivo in the crayfish Pacifastacus leniusculus. J. Virol. 2006, 80, 10365–10371. [Google Scholar] [CrossRef] [Green Version]
- Suraprasit, S.; Methatham, T.; Jaree, P.; Phiwsaiya, K.; Senapin, S.; Hirono, I.; Lo, C.F.; Tassanakajon, A.; Somboonwiwat, K. Anti-lipopolysaccharide factor isoform 3 from Penaeus monodon (ALFPm3) exhibits antiviral activity by interacting with WSSV structural proteins. Antivir. Res. 2014, 110, 142–150. [Google Scholar] [CrossRef]
- Khairnar, K.; Raut, M.P.; Chandekar, R.H.; Sanmukh, S.G.; Paunikar, W.N. Novel bacteriophage therapy for controlling metallo-beta-lactamase producing Pseudomonas aeruginosa infection in catfish. BMC Vet. Res. 2013, 9, 264. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lomelí-Ortega, C.O.; Martínez-Díaz, S.F. Phage therapy against Vibrio parahaemolyticus infection in the whiteleg shrimp (Litopenaeus vannamei) larvae. Aquaculture 2014, 434, 208–211. [Google Scholar] [CrossRef]
- Hameed, A.S.; Balasubramanian, G.; Musthaq, S.S.; Yoganandhan, K. Experimental infection of twenty species of Indian marine crabs with white spot syndrome virus (WSSV). Dis. Aquat. Organ. 2003, 57, 157–161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dey, B.K.; Dugassa, G.H.; Hinzano, S.M.; Bossier, P. Causative agent, diagnosis and management of white spot disease in shrimp: A review. Rev. Aquacult. 2020, 12, 822–865. [Google Scholar] [CrossRef]
Genes | Primer Sequence (from 5′ to 3′) | Amplicon (bp) | Accession No. [31,32,33] | |
---|---|---|---|---|
EF1α | Forward | GTATTGGAACAGTGCCCGTG | 143 | GU136229 |
Reverse | ACCAGGGACAGCCTCAGTAAG | |||
ALF1 | Forward | TTACTTCAATGGCAGGATGTGG | 142 | EW713395 |
Reverse | GTCCTCCGTGATGAGATTACTCTG | |||
CRU1 | Forward | GTAGGTGTTGGTGGTGGTTTC | 174 | AF430071 |
Reverse | CTCGCAGCAGTAGGCTTGAC | |||
LYZ1 | Forward | TACGCGACCGATTACTGGCTAC | 138 | ABD65298 |
Reverse | AGTCTTTGCTGCGACCACATTC | |||
PEN4 | Forward | GGTGCGATGTATGCTACGGAA | 106 | DQ206402 |
Reverse | CATCGTCTTCTCCATCAACCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Shan, L.-P.; Zhao, Q.; Liu, L.; OuYang, X.; Hu, Y.; Fei, C.-J.; Chen, J. Taxifolin Inhibits WSSV Infection and Transmission by Increasing the Innate Immune Response in Litopenaeus vannamei. Viruses 2022, 14, 2731. https://doi.org/10.3390/v14122731
Zhang X, Shan L-P, Zhao Q, Liu L, OuYang X, Hu Y, Fei C-J, Chen J. Taxifolin Inhibits WSSV Infection and Transmission by Increasing the Innate Immune Response in Litopenaeus vannamei. Viruses. 2022; 14(12):2731. https://doi.org/10.3390/v14122731
Chicago/Turabian StyleZhang, Xu, Li-Peng Shan, Qi Zhao, Lei Liu, Xu OuYang, Yang Hu, Chen-Jie Fei, and Jiong Chen. 2022. "Taxifolin Inhibits WSSV Infection and Transmission by Increasing the Innate Immune Response in Litopenaeus vannamei" Viruses 14, no. 12: 2731. https://doi.org/10.3390/v14122731