Next Article in Journal
In Search for the Optimal Forest Use Behaviour: Riparian Forest Use in Central Asia, Using the Example of Ak-Tal, Naryn, Kyrgyzstan
Previous Article in Journal
Response of Larix chinensis Radial Growth to Climatic Factors Using the Process-Based Vaganov–Shashkin-Lite Model at Mt. Taibai, China
Previous Article in Special Issue
Influences of Shading on Ascorbic Acid Biosynthesis of Blackcurrant (Ribes nigrum L.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 13
Issue 8
10.3390/f13081253
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Expression Analyses of the 4-Coumarate: CoA Ligase (4CL) Gene Family in Eucommia ulmoides

by
Jian Zhong
1,2,†,
Jun Qing
1,2,†,
Qi Wang
3,
Chenlu Liu
3,
Hongyan Du
1,2,
Panfeng Liu
1,2,
Qingxin Du
1,2,
Lanying Du
1,2 and
Lu Wang
1,2,*
1
Research Institute of Non-Timber Forestry, Chinese Academy of Forestry (CAF), Zhengzhou 450003, China
2
Key Laboratory of Non-Timber Forest Germplasm Enhancement & Utilization of State Forestry and Grassland Administration, Zhengzhou 450003, China
3
Non-Timber Forest R&D Center, Central South University of Forestry and Technology, Changsha 410004, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Forests 2022, 13(8), 1253; https://doi.org/10.3390/f13081253
Submission received: 22 June 2022 / Revised: 3 August 2022 / Accepted: 4 August 2022 / Published: 8 August 2022
(This article belongs to the Special Issue Physiological Responses of Trees to Biotic and Abiotic Stresses)
Browse Figures
Review Reports Versions Notes

Abstract

:
4-Coumarate: coenzyme A ligase (4CL) is an important rate-limiting enzyme in phenylpropanoid metabolism that plays an important role in the biosynthesis of phenylpropanoid, flavonoid, lignin and other secondary metabolites in plants. However, the family members and functions have not been identified in Eucommia ulmoides (E. ulmoides). In this study, 35 Eu4CLs were identified in the E. ulmoides genome, and the gene structure, conserved domain, evolutionary relationship and expression pattern were comprehensively analyzed. The results show that 35 Eu4CLs were assembled into three subgroups according to the classification in Arabidopsis, where Eu4CLs in the same subgroup had similar gene structures and conserved protein motifs. Putative cis-element analysis of Eu4CL promoter regions uncovered numerous elements related to the response of stress and plant hormones. Expression patterns showed that Eu4CL4/5/13/34 expression levels were positively related to chlorogenic acid content in different periods, which indicate that the synthesis of chlorogenic acid in E. ulmoides was regulated by multiple genes, and the genes regulating the synthesis of chlorogenic acid in different tissues were different. In addition, nine selected Eu4CL genes showed different expression patterns under cold, WeJA (methyl jasmonate), and ethylene by quantitative reverse transcription-PCR (qRT-PCR) assay, suggesting that Eu4CL genes not only play an important role in the synthesis of chlorogenic acid, but also plays an important role in the process of biotic and abiotic stress. Taken together, these findings provide theoretical reference for further exploring the molecular characteristics and biological functions of Eu4CL genes.

1. Introduction

Eucommia ulmoides, a plant belonging to the Eucommiaceae family, has been used for more than 2000 years. It is a unique economic tree species in China and has high medicinal value and ecological maintenance function [1,2]. The main medicinal components of E. ulmoides include phenylpropanoids, flavonoids, lignans and iridoids, among which chlorogenic acid is a secondary metabolite of phenylpropanoids and an important dietary polyphenol with biological activity [3]. It has the functions of antioxidation, anti-inflammation, nerve protection, anti-obesity, anti-virus and anti-hypertension [4,5]. In addition, chlorogenic acid is a natural antioxidant, which plays a key role in plant response to abiotic and biotic stresses such as drought, low temperature, pests and pathogen infection, and enhances plant adaptability to severe environments due to its strong ability to scavenge free radicals [6,7]. In recent years, the synthesis pathway and related gene function of chlorogenic acid in plants have been gradually clarified. It is found that the expression of key enzymes in the synthesis pathway of chlorogenic acid can be regulated by abiotic and biotic treatment, thereby increasing the content of chlorogenic acid, which has become one of the effective ways to obtain chlorogenic acid [8,9].
The key enzymes of the chlorogenic acid synthesis pathway mainly contain phenylalanine ammonia lyase (PAL), cinnamic acid 4-hydroxylase (C4H), 4-coumaric coenzyme A ligase (4CL) and quinic acid hydroxycinnamoyl transferase (HQT) [10]. Among them, 4CLs are the key enzymes in the third step of the phenylpropanoid metabolic pathway that catalyze cinnamic acid to generate the corresponding coenzyme A ester [11]. They participate in phenylpropanoid synthesis pathways and synthesize chlorogenic acid and other compounds [12,13]. Since the first 4CL gene was cloned from Petroselinum hortense in 1987, it has been studied in several species [14]. A. thaliana contains four 4CL genes encoding catalytically active proteins, in which At4CL3 is highly expressed in mature leaves and flowers, mainly regulating the synthesis of flavonoids [15]. There are two completely different 4CL genes in P. tomentosa. Pt4CL1 is specifically expressed in lignification tissues and participates in lignin biosynthesis. Pt4CL2 is specifically expressed in the epidermis of stems and leaves and is involved in the biosynthesis of flavonoids and other phenolic compounds [16].
In summary, the current studies on the function of 4CL genes mainly focus on regulating the biosynthesis of lignin and flavonoids, while there are few studies on the synthesis pathway of chlorogenic acid. Therefore, in this study, E. ulmoides with high chlorogenic acid content was used as the experimental material. Based on the whole genome of E. ulmoides, the members of the 4CL gene family were identified, and their gene structure, conserved motif, evolutionary relationship and expression pattern were analyzed. This study provides theoretical reference for further exploring the molecular characteristics and biological functions of the E. ulmoides 4CL gene.

2. Materials and Methods

2.1. Plant Materials

The leaves and bark of E. ulmoides were obtained from the Mengzhou Test Base, Institute of Economic Forestry, Chinese Academy of Forestry. ‘Huazhong 8’ E. ulmoides were selected as typical sample plants and sampled every month after 15 April. Sampling occurred 6 times on 15 April, 15 May, 15 June, 15 July, 15 August and 15 September. The leaves without diseases and pests were randomly collected. The bark was selected as strips of length of 50 cm and width of 5 cm from the main cadres approximately 130 cm above the ground, and then the leaves and bark were brought back to the laboratory and stored in a ventilated dry room for natural air drying.

2.2. Determination of Chlorogenic Acid

After natural drying, the plant materials were crushed and screened, and the content of chlorogenic acid in the bark and leaves was determined by high-performance liquid chromatography (HPLC) [17].

2.2.1. Materials Treatment

Amounts of 0.1 g of the bark and leaf powder were weighed and added into 50% methanol solution to fix the volume to 5 mL, then sonicated for 40 min, and finally filtered through a 0.22 μm microporous membrane to obtain the test solution.

2.2.2. Reaction Conditions

Thermo Hypersil Gold (250 mm × 4.6 mm, 5 μm), methanol (A)—0.5% phosphoric acid aqueous solution (B) as mobile phase, gradient elution, 0–30 min, 5%–15% A; 30–70 min, 15%–30% A; 70–100 min, 30%–54% A; detection wavelength 206 nm (0–15 min), 236 nm (15–55 min), 255 nm (55–100 min); volume flow rate 1.0 mL/min; injection volume 8 μL; column temperature 30 °C.

2.3. Identification of the 4CL Gene Family in E. ulmoides

Eucommia genome data were downloaded from Genome Warehouse (https://ngdc.cncb.ac.cn/gwh/Assembly/13/show, (accessed on 21 June 2022)) (PRJCA000677). Arabidopsis 4CL gene sequences were downloaded from TATR (https://www.arabidopsis.org/, (accessed on 21 June 2022)). Two 4CL genes (EUC10101 and EUC15175) annotated by KEGG were used for the blast search, and the 4CL conserved domain (PF00501) HMM file was downloaded from the Pfam database (http://pfam.sanger.ac.uk/, (accessed on 21 June 2022)). The HMM file was used to query the 4CLs in E. ulmoides using the hmmsearch program of HMMER 3.0 software, with an E-value threshold of 1.0E-5. Three incomplete sequences were removed by online alignment with NCBI CDD (http://www.ncbi.nlm.nih.gov/cdd/, (accessed on 21 June 2022)) and Pfam (https://pfam.xfam.org/, (accessed on 21 June 2022)), resulting in 35 sequences with the 4CL conserved domain.

2.4. Bioinformatic Analysis of EU4CL Genes

Based on Eu4CL gene full-length sequences and CDS sequences of E. ulmoides genome data, exon–intron structure analysis was performed using the online Gene Structure Display Server (GSDS) (http://gsds.cbi.pku.edu.cn/, (accessed on 21 June 2022)). MEME (http://meme.nbcr.net/meme/tools/meme, (accessed on 21 June 2022)) was used to analyze the conserved domain of Eu4CL proteins with the following parameters: number of repeats, any; maximum number of motifs, 10; and optimal length of each motif, 6–30. ExPASy (https://web.expasy.org/protparam/, (accessed on 21 June 2022)) was used to predict protein physicochemical features. Subcellular localization of EU4CL genes was predicted by online software CELLO v. 2.5 (http://cello.life.nctu.edu.tw/, (accessed on 21 June 2022)) [18]. Thirty-five Eu4CL protein sequences were compared with the 4CL sequences of A. thaliana using clustalW, and the phylogenetic tree of the 4CL gene family was constructed using MEGA 7.0 Maximum Likelihood (ML) and 500 bootstrap tests (Bootstrap = 500). The 1500 bp upstream region of the 4CL sequences was intercepted and predicted by the plantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, (accessed on 21 June 2022)) website.

2.5. RNA Extraction and Quantitative Reverse Transcription-PCR

(qRT-PCR) Assay

EZgene Plant Easy Spin RNA Miniprep Kit (R6611) was used to extract total RNA from E. ulmoides leaves and bark at different growth stages. Reverse transcription of RNA into cDNA was conducted according to Novoprotein E047-01B reverse transcription kit instructions. The primers were designed by Primer 5, and the reference gene was actin. Primers are shown in Table 1. Expression analysis was performed using ChamQ Universal SYBR qRT-PCR Master Mix fluorescent dye with the DLAB Precision 96 fluorescence quantitative PCR instrument. The reaction program was as follows: 95 °C 5 min, 95 °C 10 s, 60 °C 10 s, 72 °C 10 s, 75 °C 5 s, a total of 40 cycles. Repeat 3 times. SPSS software was used to analyze the significant difference (* means significant difference (p < 0.05), * means extremely significant difference (p < 0.01).

2.6. Analysis of 4CL Gene Expression Patterns in E. ulmoides

Raw RNA-seq data of salt stress in different tissues (fruit, leaves and bark) of E. ulmoides were downloaded from NCBI (https://www.ncbi.nlm.nih.gov, (accessed on 21 June 2022)) with the landing numbers PRJNA329457, SRR2170964 and PRJNA321358, respectively. The transcriptome data of male and female flower bud differentiation were obtained from the E ulmoides team of the Economic Forest Research Institute, Chinese Academy of Forestry Sciences [19]. The TBtools program was used to display the heatmap of gene expression [20]. The STRING protein interaction database (http://string-db.org/, (accessed on 21 June 2022)) was used to analyze the interactions of 35 Eu4CL proteins, and the plant model was Arabidopsis. Pearson correlation analysis was performed between Eu4CL genes with expression levels greater than 1 and chlorogenic acid accumulation using Spass 20.

3. Results

3.1. Identification and Protein Physicochemical Feature Analysis of 4CL in E. ulmoides

Based on the hidden Markov model and the two existing genes, BLAST and HMMER3.0 were used to search for the protein sequences of E. ulmoides, and ClustalW was used to construct the specific 4CL model. HMMER3.0 was then used to search for the whole-genome protein sequences of E. ulmoides. The E-value was set to be less than 0.1, and 35 sequences were finally obtained. The 35 genes were renamed Eu4CL1–Eu4CL35, and the gene structure and distribution of these genes were further analyzed.
The physicochemical features of Eu4CL proteins were analyzed using the ExPasy online website (Table 2). The results showed that the average length of Eu4CL proteins was 518 aa, the longest was Eu4CL4 (802 aa), and the shortest was Eu4CL1 (119 aa). The molecular weight of Eu4CL proteins was 12.61–89.16 kDa; the theoretical isoelectric point ranged from 5.31 to 9.52, of which 23 proteins’ pI values were less than 7, indicating that most were alkaline proteins. The instability index of Eu4CL proteins was 25.02–48.55, and the instability index of 10 proteins was greater than 40, indicating unstable proteins. The instability index of 25 proteins was less than 40, indicating stable proteins. The aliphatic index was between 78.27 and 104.04. The average hydrophobic index was −0.344 to 0.246. Subcellular localization of proteins can provide important information for protein function research [18]. Subcellular localization prediction showed that Eu4CL proteins were mainly distributed in plasma membrane, cytoplasm and chloroplast, and Eu4CL17 and Eu4CL29 were located in mitochondria and nuclei, respectively. It is speculated that the different distribution positions of Eu4CL proteins in plants may be related to functional diversity.

3.2. Conserved Motifs and Gene Structure Analysis

To further study the structural characteristics and distribution of Eu4CL proteins, the amino acid sequences of Eu4CL proteins were analyzed using MEME online software. Finally, 20 motifs (Figure 1a,b) were identified, of which four were conserved motifs. The motifs 1, 2, 3 and 4 (Figure 1b) correspond to the conserved domains Box IV [GWLHTGD], Box I [SSGTTGLPKGV], Box II [GEICIRG] and Box III [QGYGMTE], respectively. Box I and Box II were AMP-binding regions and enzyme catalytic sites [21]. The Eu4CL1 sequence contained only one conserved motif and three motifs in total. It was also the protein with the least number of motifs. The other Eu4CL sequences contained two or more conserved motifs. Multiple sequence alignment analysis showed that the 4CL genes of E. ulmoides could be divided into three groups. Among them, 12 Eu4CL sequences in Group I mainly contained motifs 2/5/8/13/4/3, 10 Eu4CL sequences in Group II mainly contained motifs 4/10/3/1/6/16/7/9, and 13 EU4CL sequences in Group III mainly contained motifs 17/11/2/13/4/12/3/1/6. There were differences in the number of motifs in different sequences, which might be related to the functional diversity of the 4CL gene family in E. ulmoides.
Gene structure analysis showed that the average length of the Eu4CL genes was 1556 bp. The Eu4CL4 gene had the longest length of 2406 bp, containing 18 exons. The EU4CL1 gene had the shortest length of 357 bp, containing two exons. There were significant differences in the number of introns and exons in the Eu4CL genes, and the number of exons was between 1 and 23. Among them, the most abundant exons were found in Eu4CL8 and Eu4CL34, and there were seven genes with only one exon (Figure 1c). Therefore, the number of exons and introns had no significant correlation with gene length.

3.3. Phylogenetic Analysis of the 4CL Gene Family in E. ulmoides

To study the phylogenetic relation of Eu4CLs, 35 Eu4CLs and 45 At4CL amino acid sequences were analyzed using MEGA7.0. The 4CL gene family of E. ulmoides was divided into six categories (Figure 2). There were nine Eu4CLs in Class 1, three Eu4CLs in Class 2, two Eu4CLs in Class 3, ten Eu4CLs in Class 4, only one Eu4CL in Class 5 and ten Eu4CLs in Class 6. The 4CL genes evolved to different degrees in the evolutionary process. At the same time, the 4CL genes of A. thaliana and E. ulmoides existed in each group, indicating that they had high homology.
The different-colored arcs indicate different groups (or subgroups) of 4CL domains. The green solid circles and red circles represent the 4CL domain from E. ulmoides and Arabidopsis, respectively. 4CL proteins from Arabidopsis with the prefix ‘At’ indicate ‘At4CL’.

3.4. Interaction Network and Promoter Cis-Acting Element Analysis of Eu4CLs

The STRING protein interaction database was used to predict the functional relationship and co-expression of 35 Eu4CL proteins, with Arabidopsis as the model plant (Figure 3). Except for AAE5, AAE11, AAE1 and AAE3 proteins, the proteins had correlations with each other, and each protein interacted with at least two or more proteins. According to the degree values, the top six 4CL proteins were selected as 4CL8/11/16/23/32/35, which indicated that they played significant roles in the whole protein interaction network. Therefore, it is speculated that the 4CL gene family completes a metabolic process through the cooperation of multiple proteins during plant development [22].
Promoters play an important role in the regulation of gene expression, and cis-acting elements regulate the initiation and transcription efficiency of gene transcription by combining with transcription factors [23,24]. PlantCARE was used to predict the cis-acting elements of Eu4CLs by extracting the promoter region sequence of 1500 bp upstream of Eu4CLs. The promoter region of Eu4CL contained 13 cis-elements, including drought-inducible elements, stress-responsive elements, light-responsive elements, low-temperature-responsive elements, methyl jasmonate-responsive elements, circadian rhythm regulatory elements and salicylic acid-responsive elements (Figure 4). Among these, the light-responsive cis-acting elements were the most abundant. The promoter regions of genes contained light-responsive elements, except for Eu4CL1/23/27. The Eu4CL2 gene contained the least cis-acting elements (only two), while Eu4CL20 contained the most cis-acting elements (21). Different 4CL gene family members have different types and numbers of cis-acting elements, which may explain the different functions and expressions of Eu4CL gene family members.
Blocks of different colors represent light-responsive elements, low-temperature-responsive elements, salicylic acid-responsive elements, abscisic acid-responsive elements, drought-responsive elements, MeJA-responsive elements, auxin-responsive elements, endosperm-responsive elements, gibberellin-responsive elements, and defense and stress-responsive elements.

3.5. Analysis of 4CL Expression Patterns in E. ulmoides

The expression levels of Eu4CL genes were analyzed based on transcriptome data, and the results showed that Eu4CL genes were differentially expressed in bark, leaves, flower buds and fruit of E. ulmoides at different developmental stages (Figure 5). Eu4CL32 was highly expressed in all tissues. The expression trend of Eu4CL15/1618 was significantly downregulated during the development of bark, fruit and leaves, while the expression trend of Eu4CL28/9 was significantly upregulated. The expression trend of Eu4CL23/22 was significantly downregulated with the development of floral buds, and the expression trend of Eu4CL8/16/29 was upregulated, indicating that these genes may be related to floral organ development. However, Eu4CL17/15/9 was specifically expressed on 14 June (the critical period of floral bud differentiation), suggesting that they may be associated with key hormones involved in floral organ differentiation. The expression of EU4CLs in the roots was significantly different from that in other tissues. The expression of Eu4CL6/11/10/7/21/28/2 was specifically expressed in the roots, while the expression of Eu4CL30/18/15/16/8/28/27 was significantly lower than that in other tissues, indicating that the Eu4CL gene family has tissue-specific expression and functional diversity.
Note: EuL, EuF and EuB indicate leaves, fruit and bark, respectively. The following number indicates the date; Eu0h_1 and Eu24h_1 indicate CK and salt treatment 24 h later. F6 indicates female flowers, and M11 indicates male flower buds. The following number indicates the date. The clustering tree was constructed by hierarchical clustering using the average linkage method.
To further confirm whether the expression of Eu4CL genes was influenced by different abiotic stresses and hormonal treatments, nine Eu4CL members, whose expression levels were relatively high across different tissues, were carefully selected from 35 E. ulmoides Eu4CL genes. qRT-PCR experiments were further performed to analyze their expression patterns in response to different treatments (Figure 6, Figure 7 and Figure 8). Overall, some Eu4CL genes were significantly induced/repressed by multiple treatments. For instance, Eu4CL13 and Eu4CL26 significantly responded to cold, WeJA (methyl jasmonate), and ethylene treatments. Eu4CL15 and Eu4CL32 were induced by all tested treatments except WeJA stress. In contrast, multiple Eu4CL genes were simultaneously induced by one treatment. For example, Eu4CL4, Eu4CL22 and Eu4CL35 were induced by ethylene, WeJA and cold treatment, respectively. Interestingly, the transcript levels of many Eu4CL genes, such as Eu4CL13, Eu4CL15 and Eu4CL26, were upregulated by ethylene stress treatment. Several genes showed opposing expression patterns under different treatments. For instance, Eu4CL13 was significantly induced by ethylene, but was repressed by WeJA treatment.
To explore the correlation between Eu4CL genes’ expression pattern and chlorogenic acid accumulation in E. ulmoides, the content of chlorogenic acid and the expression pattern of Eu4CL genes in bark and leaves of E. ulmoides at different stages were detected. The results showed that there were differences in the content of chlorogenic acid in bark and leaves of Eucommia ulmoides at different developmental stages (Figure 9). The content of chlorogenic acid in leaves was high, and increased rapidly at first and then decreased gradually, and finally reached the maximum in mid-June. However, the content of chlorogenic acid in bark was low and increased slowly at first and then decreased gradually, reaching its maximum in mid-August. Selected genes were expressed to varying degrees in bark and leaves of E.ulmoides at different developmental stages (Figure 10). Correlation analysis showed that (Figure 11) Eu4CL4 gene expression was significantly negatively correlated with chlorogenic acid accumulation in the leaves, and the absolute value of the correlation index was greater than 0.9. The expression levels of Eu4CL5 and Eu4CL13 were significantly positively correlated with chlorogenic acid accumulation in the leaves, and the correlation index was greater than 0.8. Eu4CL34 was positively correlated with the accumulation of chlorogenic acid in E. ulmoides bark, and the correlation index was 0.999. It was speculated that Eu4CL4/5/13/34 were significant genes in regulating chlorogenic acid biosynthesis in E. ulmoides.

4. Discussion

4-coumarate coenzyme A ligase (4CL) is an important rate-limiting enzyme in phenylpropanoid metabolic pathways and plays an important regulatory role in the synthesis of secondary metabolites such as chlorogenic acid, flavonoids and lignin [25,26]. At present, 4CL has been studied in honeysuckle, tobacco, Arabidopsis thaliana and Camellia oleifera [27,28]. However, as one of the species with high chlorogenic acid content, E. ulmoides has not been reported regarding its relation to 4CL genes. Therefore, this study identified 35 4CL genes based on the whole-genome data of E. ulmoides, and analyzed their gene structure, conserved motif, expression pattern and correlation with chlorogenic acid content, which provides theoretical reference for further exploring the biological function and molecular characteristics of E. ulmoides 4CL genes.
Members of the Eu4CL gene family in E. ulmoides were grouped into six subfamilies according to their relatedness with Arabidopsis, in line with earlier studies in other species, such as Glycine max, Citrus clementina, Lonicera japonica and Nicotiana tabacum [29,30]. The gene structure and conserved motif analysis showed that Eu4CL genes had structural similarity in the same group, and different subfamilies contained various differences, suggesting a variety of functions of Eu4CL genes [31]. Previous studies have shown that 4CL not only plays a key role in the flow of carbon sources into specific branches in phenylpropanoid metabolic pathways, but also plays an important role in plant responses to biotic and abiotic stresses. For example, At4CL1, At4CL2, Pt4CL1 and Os4CL2 are induced by cold, drought, WeJA and ethylene [32]. In this study, we investigated the cis-elements of Eu4CL genes on their promoters and the expression levels under different stress. Most of the Eu4CL genes exhibited various cis-elements on their promoters, such as light-responsive elements, low-temperature-responsive elements, drought-responsive elements, methyl jasmonate-responsive elements, circadian rhythm-regulating elements and salicylic acid-responsive elements, and they were induced by cold, WeJA and ethylene, which indicates their functional roles in stress resistance in E. ulmoides [33]. Among these Eu4CL genes, expressions of Eu4CL26, Eu4CL32 and Eu4CL34 were obviously induced by almost all stresses, especially the expression levels of Eu4CL34, which were upregulated more than 6-fold and 10-fold after the WeJA and ethylene treatment. These results indicated that Eu4CL genes played crucial roles in the regulation of stress resistance in E. ulmoides [34].
Chlorogenic acid is the main phenylpropanoid metabolite in E. ulmoides, and its accumulation has developmental stages and tissue specificity. [35,36]. This study found that the content of chlorogenic acid in leaves at different developmental stages was significantly different, and higher than that in bark [37]. To explore the 4CL genes related to chlorogenic acid synthesis in leaves and bark of E. ulmoides, this study analyzed the 4CL genes in leaves and bark of E. ulmoides at different developmental stages based on transcriptome data and qRT-PCR [38]. The results showed that the expression of Eu4CL had tissue and developmental specificity. The expression levels of Eu4CL13, Eu4CL26 and Eu4CL34 were positively correlated with the content of chlorogenic acid in bark, and the expression levels of Eu4CL4, Eu4CL13 and Eu4CL26 were positively correlated with the content of chlorogenic acid in leaves. It was indicated that Eu4CL4, Eu4CL13, Eu4CL26 and Eu4CL34 might be involved in the synthesis of chlorogenic acid from E. ulmoides [39]. Previous studies have found that Lm4CL1 and Lm4CL2 genes are highly expressed in leaves and flowers of Lonicera macranthoides, respectively, and are positively correlated with chlorogenic acid content in leaves and flowers, which further indicates that Eu4CL expression is tissue-specific and chlorogenic acid synthesis is regulated by multiple genes [40,41,42]. In summary, Eu4CL genes not only participate in a variety of biotic and abiotic stresses during the growth and development of E. ulmoides, but also play an important regulatory role in chlorogenic acid synthesis [43]. This study provides theoretical reference for further exploring the molecular characteristics and biological functions of Eu4CL genes.

5. Conclusions

A comprehensive analysis of 4CL gene families in E. ulmoides was carried out in the present study. A total of 35 Eu4CL genes were characterized and further classified into six main groups, with high similar exon–intron structures and motif compositions within the same groups and subgroups. Eu4CL genes played important roles in E. ulmoides growth and development as indicated by their expression patterns in different tissues and in response to various treatments. The synthesis of chlorogenic acid in E. ulmoides is regulated by multiple genes, and the genes regulating the synthesis of chlorogenic acid in different tissues are different. Eu4CL13, Eu4CL26 and Eu4CL34 are mainly involved in the synthesis of chlorogenic acid in bark, and Eu4CL4, Eu4CL13 and Eu4CL26 are involved in the synthesis of chlorogenic acid in leaves. These results provide theoretical reference for further exploring the molecular characteristics and biological functions of Eu4CL genes.

Author Contributions

Conceptualization, J.Z. and J.Q.; methodology, Q.W.; software, J.Z. and C.L.; validation, P.L., Q.D. and J.Z.; formal analysis, J.Z. and J.Q.; investigation, L.D. and H.D.; resources, L.W.; data curation, J.Q.; writing—original draft preparation, J.Z.; writing—review and editing, J.Z.; visualization, J.Q.; supervision, L.W.; project administration, H.D.; funding acquisition, H.D. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (Grant No. 2017YFD0600702).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Du, Q.X.; Wei, Y.X.; Liu, P.F.; Du, H.Y. Diversity of the Content of Main Active Components in Eucommia ulmoides Male Flowers. Sci. Silvae Sin. 2017, 53, 35–43. [Google Scholar]
  2. Qing, J.; Wei, Y.X.; Du, H.Y.; Du, L.Y. Study on Genetic Variation of Main Active Components in Leaves of Eucommia ulmoides. Acta. Bot. Boreali-Occident. Sin. 2018, 38, 316–323. [Google Scholar]
  3. Dong, J.; Ma, X.; Fu, Z.; Guo, Y. Effects of microwave drying on the contents of functional constituents of Eucommia ulmoides flower tea. Ind. Crops Prod. 2011, 34, 1102–1110. [Google Scholar] [CrossRef]
  4. Naveed, M.; Hejazi, V.; Abbas, K.; Ali, K. Chlorogenic acid (CGA): A pharmacological review and call for further research. Biomed. Pharmacother. 2018, 34, 267–283. [Google Scholar] [CrossRef]
  5. Li, F.M.; Chen, L.X.; Li, J.J. Identification and Bioinformatics Analysis of Gene for Chlorogenic Acid in Lonicera japonica Thunb. Mol. Plant Breed. 2021, 5, e3781. [Google Scholar]
  6. Kundu, A.; Vadassery, J. Chlorogenic acid-mediated chemical defence of plants against insect herbivores. Plant Biol. 2019, 21, 185–189. [Google Scholar] [CrossRef]
  7. Santana-Gálvez, J.; Cisneros-Zevallos, L.; Jacobo-Velázquez, D. Chlorogenic Acid: Recent Advances on Its Dual Role as a Food Additive and a Nutraceutical against Metabolic Syndrome. Molecules 2017, 22, 358. [Google Scholar] [CrossRef] [Green Version]
  8. Xu, P.; Xu, X.B.; Guo, H.; Zhong, C.H. Research Progress on Accumulation and Biosynthesis of Chlorogenic Acid in Lonicerae japonicae. Food Serv. 2021, 42, 252–256. [Google Scholar]
  9. Luo, Y.E.; Tian, J.X.; Ye, J.M.; Li, J.C. Analysis and Regulation of Biosynthetic Pathways of Chlorogenic Acid in Fungi. Sci. Technol. Eng. 2021, 21, 14029–14039. [Google Scholar]
  10. Endler, A.; Martens, S.; Wellmann, F.; Matern, U. Unusually divergent 4-coumarate: CoA-ligases from Ruta graveolens L. Plant Mol. Biol. 2008, 67, 335–346. [Google Scholar] [CrossRef]
  11. Zhang, J.; Yang, Y.; Zheng, K.; Xie, M.; Feng, K.; Jawdy, S.S. Genome-wide association studies and expression-based quantitative trait loci analyses reveal roles of HCT2 in caffeoylquinic acid biosynthesis and its regulation by defense-responsive transcription factors in Populus. New Phytol. 2018, 220, 502–516. [Google Scholar] [CrossRef] [Green Version]
  12. Kiewning, H. Structure and evolution of 4-coumarate: Coenzyme A ligase (4CL) gene families. Biol. Chem. 2001, 382, 645–654. [Google Scholar]
  13. He, L.; Yan, X.; Yuan, Y.; Zhong, J.J. Genome-wide Identification and Bioinformatics Analysis of the 4CL Gene Family in Pepper (Capsicum annuum). Mol. Plant Breed. 2022, 16, 1–15. [Google Scholar]
  14. Ragg, H.; Kunhn, D.N.; Hahlbrock, K. Coordinated regulation of 4-coumarate-coA ligase and phenylalanine ammonia-lyase messenger-RNAs in cultured plant-cells. J. Biol. Chem. 1981, 256, 10061–10065. [Google Scholar] [CrossRef]
  15. Ehlting, J.; Buttner, D.; Wang, Q.; Douglas, C.J. Three 4-coumarate: Coenzyme A ligases in Arabidopsis thaliana represent two evolutionarily divergent classes in angiosperms. Plant J. 1999, 19, 9–20. [Google Scholar] [CrossRef]
  16. Hu, W.J.; Kawaoka, A.; Tsai, C.J.; Lung, J.; Osakabe, K.; Ebinuma, H.; Chiang, V.L. Compartmentalized expression of two structurally and functionally distinct 4-coumarate: CoA ligase genes in aspen (Populus tremuloides). Proc. Natl. Acad. Sci. USA 1998, 95, 5407–5412. [Google Scholar] [CrossRef] [Green Version]
  17. Liu, C.Y. Research on the formation and accumulation of main active components and nutritional regulation of Eucommia ulmoides. Chin. Acad. For. Sci. 2011, 12, 43–91. [Google Scholar]
  18. Yu, C.S.; Lin, C.J.; Hwang, J.K. Predicting subcellular localization of proteins for Gram-negative bacteria by support vector machines based on n-peptide compositions. Protein Sci. 2004, 13, 1402–1406. [Google Scholar] [CrossRef] [Green Version]
  19. Qing, J.; Zhong, J.; Du, H.Y.; Wang, L. Genome-wide analysis of the long noncoding RNAs and mRNAs involved in flower bud development of Eucommia ulmoides Oliver. Sci. Hortic. Amst. 2022, 300, 111038. [Google Scholar] [CrossRef]
  20. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  21. Hamberger, B.; Hahlbrock, K. The 4-coumarate: CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes. Proc. Natl. Acad. Sci. USA 2004, 101, 2209–2214. [Google Scholar] [CrossRef] [Green Version]
  22. Lavhale, S.G.; Kalunke, R.M.; Giri, A.P. Structural, functional and evolutionary diversity of 4-coumarate-CoA ligase in plants. Planta 2018, 248, 1063–1078. [Google Scholar] [CrossRef]
  23. Fang, H.; Qi, X.; Li, Y.; Yu, X.; Liu, X. De novo transcriptomic analysis of light-induced flavonoid pathway, transcription factors in the flower buds of Lonicera japonica. Trees 2020, 34, 267–283. [Google Scholar] [CrossRef]
  24. Guo, J.Y.; Zheng, X.Y.; Zou, C.X. Research Progress of cis-elements of Abiotic Stress Inducible Promoters and Associated Transcription Factors. Biotechnol. Bull. 2011, 4, 16–20. [Google Scholar]
  25. Xu, J.; Lin, Y.H.; Wang, X.N.; Han, Y.S.; Tang, L.Q.; Wang, X.H.; Zhu, H.L. Bioinformatic Identification and Expression Analysis of 4CL Genes in Ipomoea batatas. Acta Bot. Boreali-Occident. Sin. 2020, 40, 581–587. [Google Scholar]
  26. Harding, S.A.; Leshkevich, J.; Chiang, V.L.; Tsai, C.J. Differential substrate inhibition couples kinetically distinct 4-coumarate: Coenzyme A ligases with spatially distinct metabolic roles in quaking aspen. Plant Physiol. 2002, 128, 428–438. [Google Scholar] [CrossRef] [PubMed]
  27. Li, Y.; Kim, J.I.; Pysh, L.; Chapple, C. Four isoforms of Arabidopsis thaliana 4-coumarate: CoA ligase (4CL) have overlapping yet distinct roles in phenylpropanoid metabolism. Plant Physiol. 2015, 35, 838–2015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Chen, X.H.; Peng, X.X.; Liu, Z.; Xu, X.L. Bioinformatics Analysis on Tobacco Nt4CL Gene Family. Guizhou Agric. Sci. 2018, 46, 11–15. [Google Scholar]
  29. Park, J.J.; Yoo, C.G.; Flanagan, Y.Q.; Debnath, Y.X. Defined tetra-allelic gene disruption of the 4-coumarate: Coenzyme A ligase 1 (Pv4CL1) gene by CRISPR/Cas9 in switchgrass results in lignin reduction and improved sugar release. Biotechnol. Biofuels 2017, 10, 284. [Google Scholar] [CrossRef] [Green Version]
  30. Sun, S.; Xiong, X.; Zhang, X.; Feng, H.; Li, Y. Characterization of the Gh4CL gene family reveals a role of Gh4CL7 in drought tolerance. BMC Plant Biol. 2020, 45, 337–346. [Google Scholar] [CrossRef]
  31. Zhang, Q.; Chen, T.; Wang, X.; Wang, J.H.; Gu, K.D. Genome-wide identification and expression analyses of homeodomain-leucine zipper family genes reveal their involvement in stress response in apple (Malus × domestica). Hortic. Plant J. 2022, 8, 261–278. [Google Scholar] [CrossRef]
  32. Zhang, T.; Li, X.M.; Zhao, Q.; Shi, Y.; Hao, Y.J. Genome-wide identification and functional characterization of the MdCLE peptide family in apple (Malus × domestica). Hortic. Plant J. 2022, 8, 279–288. [Google Scholar] [CrossRef]
  33. Gui, J.; Shen, J.; Li, L. Functional Characterization of Evolutionarily Divergent 4-Coumarate: Coenzyme A Ligases in Rice. Plant Physiol. 2011, 157, 574–586. [Google Scholar] [CrossRef] [Green Version]
  34. Soltani, B.M.; Ehlting, J.; Hamberger, B.; Douglas, C.J. Multiple cis-regulatory elements regulate distinct and complex patterns of developmental and wound-induced expression of Arabidopsis thaliana 4CL gene family members. Planta 2006, 224, 1239–1240. [Google Scholar] [CrossRef] [Green Version]
  35. Chen, H.; Song, J.N.; Wang, J.; Lin, Y.C.; Liu, J.; Li, Q.Z. Systems Biology of Lignin Biosynthesis in Populus trichocarpa: Heteromeric 4-Coumaric Acid: Coenzyme A Ligase Protein Complex Formation, Regulation, and Numerical Modeling. Plant Cell 2014, 26, 876–893. [Google Scholar] [CrossRef] [Green Version]
  36. Egea, C.; Ahmed, A.S.; Candela, M.; Candela, M.E. Elicitation of peroxidase activity and lignin biosynthesis in pepper suspension cells by Phytophthora capsici. Plant Physiol. 2001, 158, 151–158. [Google Scholar] [CrossRef]
  37. Burbulis, I.E.; Winkel-Shirley, B. Interactions among enzymes of the Arabidopsis flavonoid biosynthetic pathway. Proc. Natl. Acad. Sci. USA 1999, 96, 12929–12934. [Google Scholar] [CrossRef] [Green Version]
  38. Guan, Y.; Hu, W.; Jiang, A.; Xu, Y.; Yang, X. Effect of Methyl Jasmonate on Phenolic Accumulation in Wounded Broccoli. Molecules 2019, 24, 3537. [Google Scholar] [CrossRef] [Green Version]
  39. Cao, Y.; Han, Y.; Li, D.; Lin, Y.; Cai, Y. Systematic Analysis of the 4-Coumarate: Coenzyme A Ligase (4CL) Related Genes and Expression Profiling during Fruit Development in the Chinese Pear. Genes 2016, 7, 89. [Google Scholar] [CrossRef] [Green Version]
  40. Jung, J.H.; Kannan, B.; Dermawan, H.; Moxley, G.W.; Altpeter, F. Precision breeding for RNAi suppression of a major 4-coumarate: Coenzyme A ligase gene improves cell wall saccharification from field grown sugarcane. Plant Mol. Biol. 2016, 92, 505–517. [Google Scholar] [CrossRef]
  41. Zhi, L.; Nair, S. Structural Basis for Specificity and Flexibility in a Plant 4-Coumarate: CoA Ligase. Structure 2015, 23, 2032–2042. [Google Scholar]
  42. Zhang, C.H.; Ma, T.; Luo, W.C.; Xu, J.M.; Liu, J.Q. Identification of 4CL Genes in Desert Poplars and Their Changes in Expression in Response to Salt Stress. Genes 2015, 6, 901–917. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Tsai, C.J.; Harding, S.A.; Tschaplinski, T.J.; Lindroth, R.L.; Yuan, Y. Genome-wide analysis of the structural genes regulating defense phenylpropanoid metabolism in Populus. New Phytol. 2010, 172, 47–62. [Google Scholar] [CrossRef] [PubMed]
Forests 13 01253 g001 550
Figure 1. Phylogenetic relationships, gene structure and architecture of conserved protein motifs in 4CL genes from E. ulmoides. (a) The phylogenetic tree was constructed based on the full-length sequences of E. ulmoides 4CL proteins using MEGA 7 software. Details of clusters are shown in different colors. (b) Exon–intron structure of E. ulmoides 4CL genes, green boxes indicate exons; gray lines indicate introns. The number indicates the phases of corresponding introns. (c) The motif composition of E. ulmoides 4CL proteins. The motifs, numbers 1–20, are displayed in different-colored boxes. The length of protein can be estimated using the scale at the bottom.
Figure 1. Phylogenetic relationships, gene structure and architecture of conserved protein motifs in 4CL genes from E. ulmoides. (a) The phylogenetic tree was constructed based on the full-length sequences of E. ulmoides 4CL proteins using MEGA 7 software. Details of clusters are shown in different colors. (b) Exon–intron structure of E. ulmoides 4CL genes, green boxes indicate exons; gray lines indicate introns. The number indicates the phases of corresponding introns. (c) The motif composition of E. ulmoides 4CL proteins. The motifs, numbers 1–20, are displayed in different-colored boxes. The length of protein can be estimated using the scale at the bottom.
Forests 13 01253 g001
Forests 13 01253 g002 550
Figure 2. Unrooted phylogenetic tree representing relationships among 4CL domains of E. ulmoides and Arabidopsis.
Figure 2. Unrooted phylogenetic tree representing relationships among 4CL domains of E. ulmoides and Arabidopsis.
Forests 13 01253 g002
Forests 13 01253 g003 550
Figure 3. The predicted protein interaction network of the Eu4CL protein based on orthologs in Arabidopsis using STRING database.
Figure 3. The predicted protein interaction network of the Eu4CL protein based on orthologs in Arabidopsis using STRING database.
Forests 13 01253 g003
Forests 13 01253 g004 550
Figure 4. The cis-acting elements Analysis of Eu4CL genes promoters.
Figure 4. The cis-acting elements Analysis of Eu4CL genes promoters.
Forests 13 01253 g004
Forests 13 01253 g005 550
Figure 5. Expression profiles of Eu4CL genes during the development of flowers and roots under salt treatment.
Figure 5. Expression profiles of Eu4CL genes during the development of flowers and roots under salt treatment.
Forests 13 01253 g005
Forests 13 01253 g006 550
Figure 6. Expression profiles of selected Eu4CL genes under WeJA stress conditions. Error bars show the standard deviation of three biological replicates. * means significant correlation at a level of 0.05. ** means significant correlation at a level of 0.01.
Figure 6. Expression profiles of selected Eu4CL genes under WeJA stress conditions. Error bars show the standard deviation of three biological replicates. * means significant correlation at a level of 0.05. ** means significant correlation at a level of 0.01.
Forests 13 01253 g006
Forests 13 01253 g007 550
Figure 7. Expression profiles of selected Eu4CL genes under cold stress conditions. Error bars show the standard deviation of three biological replicates. * means significant correlation at a level of 0.05. ** means significant correlation at a level of 0.01.
Figure 7. Expression profiles of selected Eu4CL genes under cold stress conditions. Error bars show the standard deviation of three biological replicates. * means significant correlation at a level of 0.05. ** means significant correlation at a level of 0.01.
Forests 13 01253 g007
Forests 13 01253 g008 550
Figure 8. Expression profiles of selected Eu4CL genes under ethylene stress conditions. Error bars show the standard deviation of three biological replicates. * means significant correlation at a level of 0.05. ** means significant correlation at a level of 0.01.
Figure 8. Expression profiles of selected Eu4CL genes under ethylene stress conditions. Error bars show the standard deviation of three biological replicates. * means significant correlation at a level of 0.05. ** means significant correlation at a level of 0.01.
Forests 13 01253 g008
Forests 13 01253 g009 550
Figure 9. Changes of chlorogenic acid content in different developmental stages.
Figure 9. Changes of chlorogenic acid content in different developmental stages.
Forests 13 01253 g009
Forests 13 01253 g010a 550Forests 13 01253 g010b 550
Figure 10. Expression profiles of selected Eu4CL genes in different developmental stages. (A) represents the expression of 4CL gene in leaves at different developmental stages. (B) represents the expression of 4CL genes in bark at different developmental stages. * means significant correlation at a level of 0.05. ** means significant correlation at a level of 0.01.
Figure 10. Expression profiles of selected Eu4CL genes in different developmental stages. (A) represents the expression of 4CL gene in leaves at different developmental stages. (B) represents the expression of 4CL genes in bark at different developmental stages. * means significant correlation at a level of 0.05. ** means significant correlation at a level of 0.01.
Forests 13 01253 g010aForests 13 01253 g010b
Forests 13 01253 g011 550
Figure 11. Correlation analysis of chlorogenic acid accumulation and Eu4CL expression in Eucommia ulmoides leaves (a) and bark (b).
Figure 11. Correlation analysis of chlorogenic acid accumulation and Eu4CL expression in Eucommia ulmoides leaves (a) and bark (b).
Forests 13 01253 g011
Table
Table 1. The primers used in qRT-PCR analysis.
Table 1. The primers used in qRT-PCR analysis.
NamePrimer Sequences
Eu4CL4-FTCGTTGGCGACTCTTCCATC
Eu4CL4-RGCGGGATCCTCAATTGACCT
Eu4CL5-FGTTCGCCTCGTCTTGTCGTA
Eu4CL5-RCGTCGTGCCGGAGGTATAAT
Eu4CL13-FCGCTATTACGGTTCGCTGGA
Eu4CL13-RTATTCTGTGCACGCCGACTT
Eu4CL15-FTCTTGCCTTTACTGTGGCTG
Eu4CL15-RGCCGCAGTGTCTAGCTGAT
Eu4CL22-FATTCTTGCCGGTGGCTTGTT
Eu4CL22-RGAACGGAAGGCCTCCACAAT
Eu4CL26-FCTTATCTCGTCCGCTTCGCA
Eu4CL26-RGTGCTAGAGGGACTGCAACA
Eu4CL32-FGGCATGCAATGCTCATGGTC
Eu4CL32-RAAGAAACTCCGCCGAAGCTC
Eu4CL34-FAGGGGATACCGAAGGGTTCA
Eu4CL34-RACTTGACAGCATCTGGACCG
Eu4CL35-FATGGGCAGGTGTTTGATCGT
Eu4CL35-RCACTCCGCTCGAGTTTCAGA
Actin-FTTGTTAGCAACTGGGATGATATGG
Actin-RCAGGGTGTTCTTCAGGAGCAA
Table
Table 2. Detailed physicochemical characteristics of 4CL proteins of Eucommia ulmoides.
Table 2. Detailed physicochemical characteristics of 4CL proteins of Eucommia ulmoides.
Gene
Name		Number of Amino Acids Molecular Weight (kDa)Theoretical pIInstability
Index		Aliphatic IndexGrand Average of HydropathicitySubcellular Location
EU4CL111912.616.5625.0291.850.246plasma membrane
EU4CL237841.069.1339.4495.160.044cytoplasm
EU4CL325427.786.3342.7578.27−0.315plasma membrane
EU4CL480289.166.4137.281.2−0.23cytoplasm
EU4CL555561.046.9335.4188.22−0.033chloroplast
EU4CL625428.017.0243.3878.27−0.344cytoplasm
EU4CL725828.528.253881.94−0.29cytoplasm
EU4CL869576.856.8929.2388.78−0.074plasma membrane
EU4CL951555.545.7939.2392.83−0.062plasma membrane
EU4CL1052157.766.6936.2889.81−0.139cytoplasm
EU4CL1131735.047.1435.3484.79−0.205cytoplasm
EU4CL1242345.846.3247.0999.150.115cytoplasm
EU4CL1377185.099.5246.6784.16−0.129plasma membrane
EU4CL1455260.616.1535.0596.920.084chloroplast
EU4CL1556461.946.1736.24101.440.109chloroplast
EU4CL1670377.196.3934.6592.36−0.08chloroplast
EU4CL1752058.485.3534.2896.15−0.054mitochondrion
EU4CL1862370.148.2138.9792.3−0.21plasma membrane
EU4CL1951856.676.3834.99103.460.078plasma membrane
EU4CL2047551.625.5440.0996.250.029cytoplasm
EU4CL2119221.548.7742.6687.34−0.264chloroplast
EU4CL2266874.748.2948.5596.32−0.183cytoplasm
EU4CL2365873.506.0431.591.09−0.071chloroplast
EU4CL2434637.735.8540.5394.360.046cytoplasm
EU4CL2537540.428.5239.1191.550.023plasma membrane
EU4CL2662768.646.6636.4589.76−0.137plasma membrane
EU4CL2767475.825.7938.7683.04−0.199chloroplast
EU4CL2855360.728.240.5388.12−0.06chloroplast
EU4CL2955160.136.436.8186.46−0.055nucleus
EC4CL3061266.969.0132.81100.180.174chloroplast
EU4CL3155460.356.4444.7995.130.022chloroplast
EU4CL3266574.005.935.4689.17−0.126cytoplasm
EU4CL3344348.095.3127.4104.040.147chloroplast
EU4CL3469376.446.4533.6691.96−0.038chloroplast
EU4CL3573179.938.2630.3391−0.068cytoplasm
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhong, J.; Qing, J.; Wang, Q.; Liu, C.; Du, H.; Liu, P.; Du, Q.; Du, L.; Wang, L. Genome-Wide Identification and Expression Analyses of the 4-Coumarate: CoA Ligase (4CL) Gene Family in Eucommia ulmoides. Forests 2022, 13, 1253. https://doi.org/10.3390/f13081253

AMA Style

Zhong J, Qing J, Wang Q, Liu C, Du H, Liu P, Du Q, Du L, Wang L. Genome-Wide Identification and Expression Analyses of the 4-Coumarate: CoA Ligase (4CL) Gene Family in Eucommia ulmoides. Forests. 2022; 13(8):1253. https://doi.org/10.3390/f13081253

Chicago/Turabian Style

Zhong, Jian, Jun Qing, Qi Wang, Chenlu Liu, Hongyan Du, Panfeng Liu, Qingxin Du, Lanying Du, and Lu Wang. 2022. "Genome-Wide Identification and Expression Analyses of the 4-Coumarate: CoA Ligase (4CL) Gene Family in Eucommia ulmoides" Forests 13, no. 8: 1253. https://doi.org/10.3390/f13081253

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop