Changes in the Differentiation Program of Birch Cambial Derivatives following Trunk Girdling
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Selection and Sampling
2.2. Microscopic Analysis
- (1)
- Phloem and xylem increments that formed after the girdling were measured on transverse sections in 6-fold replications for each sample. The late phloem in birch is clearly distinguishable from the early phloem, because the sieve tubes have a smaller diameter therein [52].
- (2)
- The ratio of different cell types in the phloem and xylem increments was determined using the grid method [53]. A grid of points spaced 50 µm apart in the horizontal and vertical directions was superimposed on the image of the transverse section. A minimum of 300 points for each sample were analyzed. The percentage ratio of each cell type was estimated as a number of points of a particular type divided by the total number of points analyzed. The ratio of the cell types in the xylem was determined only in the AG35 level. We calculated the proportion of elements in the part closest to the barrier zone in order to compare the anatomical changes that occurred in the xylem with the level of gene expression, the samples for determination of which were taken at 10DAG and 20DAG.
- (3)
- The length and width of the xylem vessels were measured on macerated material in 30-fold replications for each sample.
2.3. Relative Water Content Determination
2.4. Enzyme Activity Analysis
2.5. Choice of Primers for Determination of Gene Expression Level
2.6. Total RNA Isolation and Complementary DNA Synthesis
2.7. Real-Time PCR
2.8. Statistical Analysis
3. Results
3.1. Structure of Conducting Tissues
3.2. Enzyme Activity
3.2.1. Sucrose-Metabolizing Enzymes
3.2.2. AOS Enzymes
3.3. Gene Expression
3.3.1. Genes Involved in Sugar Metabolism and Transport
3.3.2. Genes Encoding Proteins Involved in Auxin Transport and Metabolism
3.3.3. Genes Involved in Phloem and Xylem Formation
4. Discussion
4.1. Experiment Design
4.2. Increased Sucrose Concentration in the Cambial Zone Causes Activation of Phloem Formation
4.3. High Levels of Sugars Stimulate Differentiation of Cambial Derivatives into Parenchyma Cells
4.4. Sclerification of Parenchyma Cells in the Phloem May Be Involved in the Reduction of Sugars in the Cambial Zone
5. Conclusions
- (1)
- the compromise between xylogenesis and phloem formation, as described in the literature, can be controlled by the level of incoming photoassimilates;
- (2)
- an increase in the level of photoassimilates causes an increase in the proportion of parenchyma in the composition of the conducting tissues. The potential mechanism involved in switching the cell differentiation program can be the active supply of apoplast sugars and the inactivation of auxin;
- (3)
- the formation of thick sclereid cell walls may be one of the mechanisms involved in regulating sugar level in the cambial zone.
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Sudachkova, N.E. Metabolism of Conifers and Wood Formation; Nauka: Novosibirsk, Russia, 1977. [Google Scholar]
- Krabel, D. Influence of Sucrose on Cambial Activity. In Cell and Molecular Biology of Wood Formation; Savidge, R.A., Barnett, J.R., Napier, R., Eds.; BIOS Scientific Publishers Limited: Oxford, UK, 2000; pp. 113–125. [Google Scholar]
- Oribe, Y.; Funada, R.; Kubo, T. Relationships between Cambial Activity, Cell Differentiation and the Localization of Starch in Storage Tissues around the Cambium in Locally Heated Stems of Abies sachalinensis (Schmidt) Masters. Trees 2003, 17, 185–192. [Google Scholar] [CrossRef]
- Deslauriers, A.; Giovannelli, A.; Rossi, S.; Castro, G.; Fragnelli, G.; Traversi, L. Intra-Annual Cambial Activity and Carbon Availability in Stem of Poplar. Tree Physiol. 2009, 29, 1223–1235. [Google Scholar] [CrossRef] [Green Version]
- Simard, S.; Giovannelli, A.; Treydte, K.; Traversi, M.L.; King, G.M.; Frank, D.; Fonti, P. Intra-Annual Dynamics of Non-Structural Carbohydrates in the Cambium of Mature Conifer Trees Reflects Radial Growth Demands. Tree Physiol. 2013, 33, 913–923. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Magel, E.; Einig, W.; Hampp, R. Carbohydrates in Trees. In Developments in Crop Science; Elsevier: Amsterdam, The Netherlands, 2000; Volume 26, pp. 317–336. ISBN 9780444502698. [Google Scholar]
- Hartmann, H.; Adams, H.D.; Hammond, W.M.; Hoch, G.; Landhäusser, S.M.; Wiley, E.; Zaehle, S. Identifying Differences in Carbohydrate Dynamics of Seedlings and Mature Trees to Improve Carbon Allocation in Models for Trees and Forests. Environ. Exp. Bot. 2018, 152, 7–18. [Google Scholar] [CrossRef]
- Loescher, W.H.; McCamant, T.; Keller, J.D. Carbohydrate Reserves, Translocation, and Storage in Woody Plant Roots. HortScience 1990, 25, 274–281. [Google Scholar] [CrossRef] [Green Version]
- Hagedorn, F.; Joseph, J.; Peter, M.; Luster, J.; Pritsch, K.; Geppert, U.; Kerner, R.; Molinier, V.; Egli, S.; Schaub, M.; et al. Recovery of Trees from Drought Depends on Belowground Sink Control. Nat. Plants 2016, 2, 16111. [Google Scholar] [CrossRef] [PubMed]
- Deslauriers, A.; Fonti, P.; Rossi, S.; Rathgeber, C.B.K.; Gričar, J. Ecophysiology and Plasticity of Wood and Phloem Formation. In Dendroecology; Amoroso, M.M., Daniels, L.D., Baker, P.J., Camarero, J.J., Eds.; Ecological Studies; Springer International Publishing: Cham, Switzerland, 2017; Volume 231, pp. 13–33. ISBN 9783319616681. [Google Scholar]
- Oberhuber, W.; Gruber, A.; Lethaus, G.; Winkler, A.; Wieser, G. Stem Girdling Indicates Prioritized Carbon Allocation to the Root System at the Expense of Radial Stem Growth in Norway Spruce under Drought Conditions. Environ. Exp. Bot. 2017, 138, 109–118. [Google Scholar] [CrossRef]
- Guillemot, J.; Francois, C.; Hmimina, G.; Dufrêne, E.; Martin-StPaul, N.K.; Soudani, K.; Marie, G.; Ourcival, J.; Delpierre, N. Environmental Control of Carbon Allocation Matters for Modelling Forest Growth. New Phytol. 2017, 214, 180–193. [Google Scholar] [CrossRef] [Green Version]
- Rademacher, T.T.; Basler, D.; Eckes-Shephard, A.H.; Fonti, P.; Friend, A.D.; Le Moine, J.; Richardson, A.D. Using Direct Phloem Transport Manipulation to Advance Understanding of Carbon Dynamics in Forest Trees. Front. For. Glob. Change 2019, 2, 11. [Google Scholar] [CrossRef] [Green Version]
- Friend, A.D.; Eckes-Shephard, A.H.; Fonti, P.; Rademacher, T.T.; Rathgeber, C.B.K.; Richardson, A.D.; Turton, R.H. On the Need to Consider Wood Formation Processes in Global Vegetation Models and a Suggested Approach. Ann. For. Sci. 2019, 76, 49. [Google Scholar] [CrossRef] [Green Version]
- Noel, A.R.A. The Girdled Tree. Bot. Rev. 1970, 36, 162–195. [Google Scholar] [CrossRef]
- Goren, R.; Huberman, M.; Goldschmidt, E.E. Girdling: Physiological and Horticultural Aspects. In Horticultural Reviews; Janick, J., Ed.; John Wiley & Sons, Inc.: Oxford, UK, 2010; Volume 30, pp. 1–36. ISBN 9780470650837. [Google Scholar]
- Ferreira Torres, L.; López de Andrade, S.A.; Mazzafera, P. Split-Root, Grafting and Girdling as Experimental Tools to Study Root-to Shoot-to Root Signaling. Environ. Exp. Bot. 2021, 191, 104631. [Google Scholar] [CrossRef]
- Leitch, M.A.; Savidge, R.A. Cell, Tissue and Organ Culture for the Study of Cambial Activity and Wood Formation—A Resurgence of Interest in an Old Technique. In Cell and Molecular Biology of Wood Formation; Savidge, R.A., Barnett, J.R., Napier, R., Eds.; BIOS Scientific Publishers Ltd.: Oxford, UK, 2000; pp. 493–512. [Google Scholar]
- Tarelkina, T.V.; Novitskaya, L.L.; Nikolaeva, N.N. Effect of Sucrose Exposure on the Xylem Anatomy of Three Temperate Species. IAWA J. 2018, 39, 156–176. [Google Scholar] [CrossRef]
- Tarelkina, T.; Novitskaya, L. Influence of Exogenous Sucrose Exposure on the Phloem Formation of Silver Birch, Grey Alder and Aspen. Proc. Karelian Res. Cent. Russ. Acad. Sci. 2019, 43, 43–54. [Google Scholar] [CrossRef]
- Grigri, M.S.; Atkins, J.W.; Vogel, C.; Bond-Lamberty, B.; Gough, C.M. Aboveground Wood Production Is Sustained in the First Growing Season after Phloem-Disrupting Disturbance. Forests 2020, 11, 1306. [Google Scholar] [CrossRef]
- Edwards, N.T.; Ross-Todd, B.M. The Effects of Stem Girdling on Biogeochemical Cycles within a Mixed Deciduous Forest in Eastern Tennessee: I. Soil Solution Chemistry, Soil Respiration, Litterfall and Root Biomass Studies. Oecologia 1979, 40, 247–257. [Google Scholar] [CrossRef] [PubMed]
- Sharif Hossain, A.B.M.; Mizutani, F.; Onguso, J.M.; El-Shereif, A.R.; Yamada, H. Dwarfing Peach Trees by Bark Ringing. Sci. Hortic. 2006, 110, 38–43. [Google Scholar] [CrossRef]
- De Schepper, V.; Steppe, K.; Van Labeke, M.-C.; Lemeur, R. Detailed Analysis of Double Girdling Effects on Stem Diameter Variations and Sap Flow in Young Oak Trees. Environ. Exp. Bot. 2010, 68, 149–156. [Google Scholar] [CrossRef]
- Daudet, F.-A.; Ame´glio, T.; Cochard, H.; Archilla, O.; Lacointe, A. Experimental Analysis of the Role of Water and Carbon in Tree Stem Diameter Variations. J. Exp. Bot. 2005, 56, 135–144. [Google Scholar] [CrossRef] [Green Version]
- Wilson, B.F.; Gartner, B.L. Effects of Phloem Girdling in Conifers on Apical Control of Branches, Growth Allocation and Air in Wood. Tree Physiol. 2002, 22, 347–353. [Google Scholar] [CrossRef] [Green Version]
- Lopez, R.; Brossa, R.; Gil, L.; Pita, P. Stem Girdling Evidences a Trade-off between Cambial Activity and Sprouting and Dramatically Reduces Plant Transpiration Due to Feedback Inhibition of Photosynthesis and Hormone Signaling. Front. Plant Sci. 2015, 6, 285. [Google Scholar] [CrossRef] [PubMed]
- Johnsen, K.; Maier, C.; Sanchez, F.; Anderson, P.; Butnor, J.; Waring, R.; Linder, S. Physiological Girdling of Pine Trees via Phloem Chilling: Proof of Concept. Plant Cell Environ. 2007, 30, 128–134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maunoury-Danger, F.; Fresneau, C.; Eglin, T.; Berveiller, D.; Francois, C.; Lelarge-Trouverie, C.; Damesin, C. Impact of Carbohydrate Supply on Stem Growth, Wood and Respired CO2δ13C: Assessment by Experimental Girdling. Tree Physiol. 2010, 30, 818–830. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Regier, N.; Streb, S.; Zeeman, S.C.; Frey, B. Seasonal Changes in Starch and Sugar Content of Poplar (Populus deltoides × Nigra Cv. Dorskamp) and the Impact of Stem Girdling on Carbohydrate Allocation to Roots. Tree Physiol. 2010, 30, 979–987. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramírez Correa, J.A. The Functional Role of Carbohydrate Reserves in the Growth and Survival of Trees. Ph.D. Thesis, Université du Québec à Montréa, Montréal, QC, Canada, 2017. [Google Scholar]
- Arakawa, O.; Kanno, K.; Kanetsuka, A.; Shiozaki, Y. Effects of Girdling and Bark Inversion on Tree Growth and Fruit Quality of Apple. Acta Hortic. 1997, 451, 579–586. [Google Scholar] [CrossRef]
- Swarbrick, T. The Healing of Wounds in Woody Stems.: II. Contributions to the Physiological Anatomy of Ringed Apple Shoots. J. Pomol. Hortic. Sci. 1928, 6, 29–46. [Google Scholar] [CrossRef]
- Schneider, H. Effect of Trunk Girdling on Phloem of Trunk of Sweet Orange Trees on Sour Orange Rootstock. Hilgardia 1954, 22, 593–601. [Google Scholar] [CrossRef] [Green Version]
- Fajstavr, M.; Giagli, K.; Vavrčík, H.; Gryc, V.; Urban, J. The Effect of Stem Girdling on Xylem and Phloem Formation in Scots Pine. Silva Fenn. 2017, 51, 1760. [Google Scholar] [CrossRef] [Green Version]
- Li, C.-Y.; Weiss, D.; Goldschmidt, E.E. Girdling Affects Carbohydrate-Related Gene Expression in Leaves, Bark and Roots of Alternate-Bearing Citrus Trees. Ann. Bot. 2003, 92, 137–143. [Google Scholar] [CrossRef] [Green Version]
- Cooke, J.E.K.; Brown, K.A.; Wu, R.; Davis, J.M. Gene Expression Associated with N-Induced Shifts in Resource Allocation in Poplar: N-Responsive Genes in Poplar. Plant Cell Environ. 2003, 26, 757–770. [Google Scholar] [CrossRef] [Green Version]
- Moscatello, S.; Proietti, S.; Augusti, A.; Scartazza, A.; Walker, R.P.; Famiani, F.; Battistelli, A. Late Summer Photosynthesis and Storage Carbohydrates in Walnut (Juglans regia L.): Feed-Back and Feed-Forward Effects. Plant Physiol. Biochem. 2017, 118, 618–626. [Google Scholar] [CrossRef] [PubMed]
- Novitskaya, L.L. Karelian Birch: Mechanisms of Growth and Development of Structural Abnormalities; Verso: Petrozavodsk, Russia, 2008; ISBN 9785850392291. [Google Scholar]
- Galibina, N.A.; Novitskaya, L.L.; Krasavina, M.S.; Moshchenskaya, J.L. Invertase Activity in Trunk Tissues of Karelian Birch. Russ. J. Plant Physiol. 2015, 62, 753–760. [Google Scholar] [CrossRef]
- Galibina, N.A.; Novitskaya, L.L.; Krasavina, M.S.; Moshchenskaya, Y.L. Activity of Sucrose Synthase in Trunk Tissues of Karelian Birch during Cambial Growth. Russ. J. Plant Physiol. 2015, 62, 381–389. [Google Scholar] [CrossRef]
- Nikerova, K.M.; Galibina, N.A.; Moshchenskaya, J.L.; Novitskaya, L.L.; Podgornaya, M.N.; Sofronova, I.N. Determination of superoxide dismutase and polyphenol oxidase activity in Betula pendula var. carelica (Betulaceae) wood with different degree of xylogenesis disturbance. Rastit. Resur. 2019, 55, 213–230. [Google Scholar] [CrossRef]
- Nikerova, K.M.; Galibina, N.A.; Moshchenskaya, J.L.; Novitskaya, L.L.; Podgornaya, M.N.; Sofronova, I.N. Contribution of catalase and peroxidase to xylogenesis of Karelian birch. Lesovedenie 2019, 2, 115–127. [Google Scholar] [CrossRef]
- Salojärvi, J.; Smolander, O.-P.; Nieminen, K.; Rajaraman, S.; Safronov, O.; Safdari, P.; Lamminmäki, A.; Immanen, J.; Lan, T.; Tanskanen, J.; et al. Genome Sequencing and Population Genomic Analyses Provide Insights into the Adaptive Landscape of Silver Birch. Nat. Genet. 2017, 49, 904–912. [Google Scholar] [CrossRef]
- Roper, T.R.; Williams, L.E. Net CO2 Assimilation and Carbohydrate Partitioning of Grapevine Leaves in Response to Trunk Girdling and Gibberellic Acid Application. Plant Physiol. 1989, 89, 1136–1140. [Google Scholar] [CrossRef] [Green Version]
- Novitskaya, L.L.; Tarelkina, T.V.; Galibina, N.A.; Moshchenskaya, Y.L.; Nikolaeva, N.N.; Nikerova, K.M.; Podgornaya, M.N.; Sofronova, I.N.; Semenova, L.I. The Formation of Structural Abnormalities in Karelian Birch Wood Is Associated with Auxin Inactivation and Disrupted Basipetal Auxin Transport. J. Plant Growth Regul. 2020, 39, 378–394. [Google Scholar] [CrossRef]
- Tarelkina, T.V.; Novitskaya, L.L.; Galibina, N.A.; Moshchenskaya, Y.L.; Nikerova, K.M.; Nikolaeva, N.N.; Sofronova, I.N.; Ivanova, D.S.; Semenova, L.I. Expression Analysis of Key Auxin Biosynthesis, Transport, and Metabolism Genes of Betula pendula with Special Emphasis on Figured Wood Formation in Karelian Birch. Plants 2020, 9, 1406. [Google Scholar] [CrossRef]
- Mollenhauer, H.H. Plastic Embedding Mixtures for Use in Electron Microscopy. Stain Technol. 1964, 39, 111–114. [Google Scholar]
- IAWA List of Microscopic Features for Hardwood Identification. IAWA Bull. 1989, 10, 219–332.
- Scholz, A.; Klepsch, M.; Karimi, Z.; Jansen, S. How to Quantify Conduits in Wood? Front. Plant Sci. 2013, 4, 56. [Google Scholar] [CrossRef] [Green Version]
- Angyalossy, V.; Pace, M.R.; Evert, R.F.; Marcati, C.R.; Oskolski, A.A.; Terrazas, T.; Kotina, E.; Lens, F.; Mazzoni-Viveiros, S.C.; Angeles, G.; et al. IAWA List of Microscopic Bark Features. IAWA J. 2016, 37, 517–615. [Google Scholar] [CrossRef] [Green Version]
- Trockenbrodt, M. Qualitative Structural Changes during Bark Development in Quercus robuk, Ulmus glabra, Populus tremula and Betula pendula. IAWA J. 1991, 12, 18. [Google Scholar] [CrossRef]
- Smith, D.M. Microscopic Methods for Determining Cross-Sectional Cell Dimensions; U.S. Department of Agriculture: Madison, WI, USA, 1967.
- Nguyen, Q.A.; Luan, S.; Wi, S.G.; Bae, H.; Lee, D.-S.; Bae, H.-J. Pronounced Phenotypic Changes in Transgenic Tobacco Plants Overexpressing Sucrose Synthase May Reveal a Novel Sugar Signaling Pathway. Front. Plant Sci. 2016, 6, 1216. [Google Scholar] [CrossRef] [Green Version]
- Nikerova, K.; Galibina, N.; Moshchenskaya, Y.; Novitskaya, L.; Podgornaya, M.; Sofronova, I. The Antioxidant Enzymes—Indicators of Different Xylogenesis Scenarios: In Early Ontogeny and in Adult Plants (Example of Betula pendula Roth). Proc. Karelian Res. Cent. Russ. Acad. Sci. 2018, 9, 68–80. [Google Scholar] [CrossRef] [Green Version]
- Galibina, N.A.; Moshkina, E.V.; Nikerova, K.M.; Moshchenskaya, J.L.; Znamenskii, S.R. Peroxydase Activity Indicates Veining of Curly Birch. Lesovedenie 2016, 4, 294–304. [Google Scholar]
- Nikerova, K.M.; Galibina, N.A. The Influence of Nitrate Nitrogen on the Peroxidase Activity in Tissues of Betula pendula Roth Var. pendula and B. pendula Var. carelica (Mercklin). Sib. J. For. Sci. 2017, 1, 15–24. [Google Scholar] [CrossRef]
- Moshchenskaya, Y.L.; Galibina, N.A.; Tarelkina, T.V.; Nikerova, K.M.; Chirva, O.V.; Novitskaya, L.L. Selection of Reference Genes for Normalization of Quantitative PCR Data in Real Time in Two Forms of Silver Birch. Russ. J. Plant Physiol. 2021, 68, 214–221. [Google Scholar] [CrossRef]
- Rebrikov, D.V.; Korostin, D.O.; Ushakov, V.L.; Barsova, E.V.; Lukyanov, S.A. Application of Modern Methods of Molecular Biology for the Search and Cloning of Full-Length Nucleotide Sequences of CDNA; Publishing House of the NNIU MEPhI: Moscow, Russia, 2011. [Google Scholar]
- Tippett, J.T.; Shigo, A.L. Barrier Zone Formation: A Mechanism of Tree Defense against Vascular Pathogens. IAWA J. 1981, 2, 163–168. [Google Scholar] [CrossRef]
- Smith, C.M.; Rodriguez-Buey, M.; Karlsson, J.; Campbell, M.M. The Response of the Poplar Transcriptome to Wounding and Subsequent Infection by a Viral Pathogen. New Phytol. 2004, 164, 123–136. [Google Scholar] [CrossRef] [PubMed]
- Biggs, A.R. Anatomical and Physiological Responses of Bark Tissues to Mechanical Injury. In Defense Mechanisms of Woody Plants Against Fungi; Blanchette, R.A., Biggs, A.R., Eds.; Springer: Berlin, Germany, 2008; pp. 13–40. [Google Scholar]
- Lim, K.-J.; Paasela, T.; Harju, A.; Venäläinen, M.; Paulin, L.; Auvinen, P.; Kärkkäinen, K.; Teeri, T.H. A Transcriptomic View to Wounding Response in Young Scots Pine Stems. Sci. Rep. 2021, 11, 3778. [Google Scholar] [CrossRef] [PubMed]
- Goodin, M.M.; Biggs, A.R.; Castle, A.M. Changes in Levels and Isozymes of Peroxidase in Wounded Peach Bark. Fruit Var. J. 1993, 47, 185–192. [Google Scholar]
- Constabel, C.P.; Yip, L.; Patton, J.J.; Christopher, M.E. Polyphenol Oxidase from Hybrid Poplar. Cloning and Expression in Response to Wounding and Herbivory. Plant Physiol. 2000, 124, 285–296. [Google Scholar] [CrossRef] [Green Version]
- Schafleitner, R.; Wilhelm, E. Isolation of Wound Inducible Genes from Castanea Sativa Stems and Expression Analysis in the Bark Tissue. Plant Physiol. Biochem. 2002, 40, 235–245. [Google Scholar] [CrossRef]
- Allison, S.D.; Schultz, J.C. Differential Activity of Peroxidase Isozymes in Response to Wounding, Gypsy Moth, and Plant Hormones in Northern Red Oak (Quercus rubra L.). J. Chem. Ecol. 2004, 30, 1363–1379. [Google Scholar] [CrossRef]
- Tsai, C.; Harding, S.A.; Tschaplinski, T.J.; Lindroth, R.L.; Yuan, Y. Genome-wide Analysis of the Structural Genes Regulating Defense Phenylpropanoid Metabolism in Populus. New Phytol. 2006, 172, 47–62. [Google Scholar] [CrossRef]
- Gijzen, M.; Lewinsohn, E.; Croteau, R. Antigenic Cross-Reactivity among Monoterpene Cyclases from Grand Fir and Induction of These Enzymes upon Stem Wounding. Arch. Biochem. Biophys. 1992, 294, 670–674. [Google Scholar] [CrossRef]
- Hawkins, S.; Boudet, A. “Defence Lignin” and Hydroxycinnamyl Alcohol Dehydrogenase Activities in Wounded Eucalyptus gunnii. For. Pathol. 2003, 33, 91–104. [Google Scholar] [CrossRef]
- Zwieniecki, M.A.; Melcher, P.J.; Feild, T.S.; Holbrook, N.M. A Potential Role for Xylem-Phloem Interactions in the Hydraulic Architecture of Trees: Effects of Phloem Girdling on Xylem Hydraulic Conductance. Tree Physiol. 2004, 24, 911–917. [Google Scholar] [CrossRef]
- Pfautsch, S.; Renard, J.; Tjoelker, M.G.; Salih, A. Phloem as Capacitor: Radial Transfer of Water into Xylem of Tree Stems Occurs via Symplastic Transport in Ray Parenchyma. Plant Physiol. 2015, 167, 963–971. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pfautsch, S.; Hölttä, T.; Mencuccini, M. Hydraulic Functioning of Tree Stems—Fusing Ray Anatomy, Radial Transfer and Capacitance. Tree Physiol. 2015, 35, 706–722. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maier, C.A.; Johnsen, K.H.; Clinton, B.D.; Ludovici, K.H. Relationships between Stem CO2 Efflux, Substrate Supply, and Growth in Young Loblolly Pine Trees. New Phytol. 2010, 185, 502–513. [Google Scholar] [CrossRef] [PubMed]
- Hubbard, R.M.; Rhoades, C.C.; Elder, K.; Negron, J. Changes in Transpiration and Foliage Growth in Lodgepole Pine Trees Following Mountain Pine Beetle Attack and Mechanical Girdling. For. Ecol. Manag. 2013, 289, 312–317. [Google Scholar] [CrossRef]
- Laurila, J.; Lauhanen, R.; Hakonen, T. The Effect of Girdling on the Moisture Content of Small-Sized Trees. Scand. J. For. Res. 2014, 29, 259–265. [Google Scholar] [CrossRef]
- Sevanto, S.; Mcdowell, N.G.; Dickman, L.T.; Pangle, R.; Pockman, W.T. How Do Trees Die? A Test of the Hydraulic Failure and Carbon Starvation Hypotheses. Plant Cell Environ. 2014, 37, 153–161. [Google Scholar] [CrossRef]
- Lintunen, A.; Paljakka, T.; Jyske, T.; Peltoniemi, M.; Sterck, F.; von Arx, G.; Cochard, H.; Copini, P.; Caldeira, M.C.; Delzon, S.; et al. Osmolality and Non-Structural Carbohydrate Composition in the Secondary Phloem of Trees across a Latitudinal Gradient in Europe. Front. Plant Sci. 2016, 7, 726. [Google Scholar] [CrossRef] [Green Version]
- Dann, I.R.; Jerie, P.H.; Chalmers, D.J. Short-Term Changes in Cambial Growth and Endogenous IAA Concentrations in Relation to Phloem Girdling of Peach, Prunus persica (L.) Batsch. Funct. Plant Biol. 1985, 12, 395. [Google Scholar] [CrossRef]
- Novitskaya, L.L.; Kushnir, F.V. The Role of Sucrose in Regulation of Trunk Tissue Development in Betula Pendula Roth. J. Plant Growth Regul. 2006, 25, 18–29. [Google Scholar] [CrossRef]
- Holtta, T.; Makinen, H.; Nojd, P.; Makela, A.; Nikinmaa, E. A Physiological Model of Softwood Cambial Growth. Tree Physiol. 2010, 30, 1235–1252. [Google Scholar] [CrossRef]
- Wetmore, R.H.; Rier, J.P. Experimental Induction of Vascular Tissues in Callus of Angiosperms. Am. J. Bot. 1963, 50, 418–430. [Google Scholar] [CrossRef]
- Jeffs, R.A.; Northcote, D.H. The Influence of Indol-3Yl Acetic Acid and Sugar on the Pattern of Induced Differentiation in Plant Tissue Culture. J. Cell Sci. 1967, 2, 77–88. [Google Scholar] [CrossRef] [PubMed]
- Warren Wilson, J.; Roberts, L.W.; Warren Wilson, P.M.; Gresshoff, P.M. Stimulatory and Inhibitory Effects of Sucrose Concentration on Xylogenesis in Lettuce Pith Explants; Possible Mediation by Ethylene Biosynthesis. Ann. Bot. 1994, 73, 65–73. [Google Scholar] [CrossRef]
- Aloni, R. Ecophysiological Implications of Vascular Differentiation and Plant Evolution. Trees 2015, 29, 1–16. [Google Scholar] [CrossRef]
- Zakrzewski, J. Effect of Indole-3-Acetic Acid (IAA) and Sucrose on Vessel Size and Density in Isolated Stem Segments of Oak (Quercus robur). Physiol. Plant. 1991, 81, 234–238. [Google Scholar] [CrossRef]
- Galibina, N.A.; Tarelkina, T.V.; Chirva, O.V.; Moshchenskaya, Y.L.; Nikerova, K.M.; Ivanova, D.S.; Semenova, L.I.; Serkova, A.A.; Novitskaya, L.L. Molecular Genetic Characteristics of Different Scenarios of Xylogenesis on the Example of Two Forms of Silver Birch Differing in the Ratio of Structural Elements in the Xylem. Plants 2021, 10, 1593. [Google Scholar] [CrossRef]
- De Schepper, V.; De Swaef, T.; Bauweraerts, I.; Steppe, K. Phloem Transport: A Review of Mechanisms and Controls. J. Exp. Bot. 2013, 64, 4839–4850. [Google Scholar] [CrossRef] [Green Version]
- Liesche, J.; Patrick, J. An Update on Phloem Transport: A Simple Bulk Flow under Complex Regulation. F1000Research 2017, 6, 2096. [Google Scholar] [CrossRef] [Green Version]
- McQueen, J.C.; Minchin, P.E.H.; Thorpe, M.R.; Silvester, W.B. Short-Term Storage of Carbohydrate in Stem Tissue of Apple (Malus Domestica), a Woody Perennial: Evidence for Involvement of the Apoplast. Funct. Plant Biol. 2005, 32, 1027. [Google Scholar] [CrossRef]
- Thorpe, M.R.; Minchin, P.E.H.; Gould, N.; McQueen, J. The Stem Apoplast: A Potential Communication Channel in Plant Growth Regulation. In Vascular Transport in Plants; Holbrook, N.M., Zwieniecki, M.A., Eds.; Elsevier Academic Press: Burlington, NC, USA, 2005; pp. 201–220. ISBN 9780120884575. [Google Scholar]
- Van Bel, A.J.E. Xylem-Phloem Exchange via the Rays: The Undervalued Route of Transport. J. Exp. Bot. 1990, 41, 631–644. [Google Scholar] [CrossRef]
- Galibina, N.A.; Novitskaya, L.L.; Nikerova, K.M.; Moshchenskaya, Y.L.; Borodina, M.N.; Sofronova, I.N. Apoplastic Invertase Activity Regulation in the Cambial Zone of Karelian Birch. Russ. J. Dev. Biol. 2019, 50, 20–29. [Google Scholar] [CrossRef]
- Novitskaya, L.; Nikolaeva, N.; Galibina, N.; Tarelkina, T.; Semenova, L. The Greatest Density of Parenchyma Inclusions in Karelian Birch Wood Occurs at Confluences of Phloem Flows. Silva Fenn. 2016, 50, 1461–1478. [Google Scholar] [CrossRef] [Green Version]
- Shchetinkin, S.V. Histogenesis of Figured Wood in Birch (Betula pendula Roth Var. carelica Merkl. and Betula pendula Roth). Ph.D. Thesis, Voronezh State University, Voronezh, Russia, 1987. [Google Scholar]
- Novitskaya, L.; Nikolaeva, N.; Tarelkina, T. Endogenous Variability of the Figured Wood of Karelian Birch. Wulfenia 2016, 23, 175–188. [Google Scholar]
- Iglesias, M.J.; Terrile, M.C.; Bartoli, C.G.; D’Ippólito, S.; Casalongué, C.A. Auxin Signaling Participates in the Adaptative Response against Oxidative Stress and Salinity by Interacting with Redox Metabolism in Arabidopsis. Plant Mol. Biol. 2010, 74, 215–222. [Google Scholar] [CrossRef]
- Tognetti, V.B.; Mühlenbock, P.; Van Breusegem, F. Stress Homeostasis—The Redox and Auxin Perspective: Stress Homeostasis. Plant Cell Environ. 2012, 35, 321–333. [Google Scholar] [CrossRef]
- Krishnamurthy, A.; Rathinasabapathi, B. Oxidative Stress Tolerance in Plants: Novel Interplay between Auxin and Reactive Oxygen Species Signaling. Plant Signal. Behav. 2013, 8, e25761. [Google Scholar] [CrossRef] [Green Version]
- Barratt, D.H.P.; Derbyshire, P.; Findlay, K.; Pike, M.; Wellner, N.; Lunn, J.; Feil, R.; Simpson, C.; Maule, A.J.; Smith, A.M. Normal Growth of Arabidopsis Requires Cytosolic Invertase but Not Sucrose Synthase. Proc. Natl. Acad. Sci. USA 2009, 106, 13124–13129. [Google Scholar] [CrossRef] [Green Version]
- Rende, U.; Wang, W.; Gandla, M.L.; Jönsson, L.J.; Niittylä, T. Cytosolic Invertase Contributes to the Supply of Substrate for Cellulose Biosynthesis in Developing Wood. New Phytol. 2017, 214, 796–807. [Google Scholar] [CrossRef]
- Moshchenskaya, Y.L.; Galibina, N.A.; Novitskaya, L.L.; Nikerova, K.M. The Role of Sucrose Synthase in Sink Organs of Woody Plants. Russ. J. Plant Physiol. 2019, 66, 10–21. [Google Scholar] [CrossRef]
- Novitskaya, L.L. Effect of Sucrose on Sclerification of Bark Cells in Betula pendula Roth. Acta Hortic. 2009, 835, 117–128. [Google Scholar] [CrossRef]
- Cai, Y.; Li, G.; Nie, J.; Lin, Y.; Nie, F.; Zhang, J.; Xu, Y. Study of the Structure and Biosynthetic Pathway of Lignin in Stone Cells of Pear. Sci. Hortic. 2010, 125, 374–379. [Google Scholar] [CrossRef]
- Prislan, P.; Koch, G.; Schmitt, U.; Gričar, J.; Čufar, K. Cellular and Topochemical Characteristics of Secondary Changes in Bark Tissues of Beech (Fagus sylvatica). Holzforschung 2012, 66, 131–138. [Google Scholar] [CrossRef] [Green Version]
- Zahur, M.S. Comparative Study of Secondary Phloem of 423 Species of Woody Dicotyledons Belonging to 85 Families; Cornell University Agriculture Experimental Station: Wilsboro, NY, USA, 1959. [Google Scholar]
- Alonso-Serra, J.; Safronov, O.; Lim, K.; Fraser-Miller, S.J.; Blokhina, O.B.; Campilho, A.; Chong, S.; Fagerstedt, K.; Haavikko, R.; Helariutta, Y.; et al. Tissue-specific Study across the Stem Reveals the Chemistry and Transcriptome Dynamics of Birch Bark. New Phytol. 2019, 222, 1816–1831. [Google Scholar] [CrossRef] [PubMed]
- Kopanina, A. Structural Features of Bark and Wood of Spiraea beauverdiana (Rosaceae) in the Extreme Conditions of Arctic and Volcanic Activity on the Kuril Islands. Sib. Lesn. Zurnal 2019, 3, 52–63. [Google Scholar] [CrossRef]
- Rioux, D.; Yamada, T.; Simard, M.; Lessard, G.; Rheault, F.J.; Blouin, D. Contribution to the Fine Anatomy and Histochemistry of Birdseye Sugar Maple. Can. J. For. Res. 2003, 33, 946–958. [Google Scholar] [CrossRef]
- Nikerova, K.M.; Galibina, N.A.; Moshchenskaya, Y.L.; Sofronova, I.N.; Borodina, M.N.; Moshkina, E.V.; Novitskaya, L.L. The Effect of Soil Fertility on Antioxidant Enzymes Activity in a Subarctic Woody Species. Czech Polar Rep. 2021, 11, 41–66. [Google Scholar] [CrossRef]
- Nikerova, K.M.; Galibina, N.A.; Moshchenskaya, Y.L.; Tarelkina, T.V.; Borodina, M.N.; Sofronova, I.N.; Semenova, L.I.; Ivanova, D.S.; Novitskaya, L.L. Upregulation of Antioxidant Enzymes Is a Biochemical Indicator of Abnormal Xylogenesis in Karelian Birch. Trees 2021, 36, 517–529. [Google Scholar] [CrossRef]
- Pradedova, E.V.; Isheeva, O.D.; Salyaev, R.K. Antioxidant Defense Enzymes in Cell Vacuoles of Red Beet Roots. Russ. J. Plant Physiol. 2011, 58, 36–44. [Google Scholar] [CrossRef]
- Bi, Y.-M.; Kenton, P.; Mur, L.; Darby, R.; Draper, J. Hydrogen Peroxide Does Not Function Downstream of Salicylic Acid in the Induction of PR Protein Expression. Plant J. 1995, 8, 235–245. [Google Scholar] [CrossRef]
- Pellinen, R.I.; Korhonen, M.-S.; Tauriainen, A.A.; Palva, E.T.; Kangasjärvi, J. Hydrogen Peroxide Activates Cell Death and Defense Gene Expression in Birch. Plant Physiol. 2002, 130, 549–560. [Google Scholar] [CrossRef] [Green Version]
- Thipyapong, P.; Hunt, M.D.; Steffens, J.C. Antisense Downregulation of Polyphenol Oxidase Results in Enhanced Disease Susceptibility. Planta 2004, 220, 105–117. [Google Scholar] [CrossRef] [PubMed]
- Domec, J.-C.; Pruyn, M.L. Bole Girdling Affects Metabolic Properties and Root, Trunk and Branch Hydraulics of Young Ponderosa Pine Trees. Tree Physiol. 2008, 28, 1493–1504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jajic, I.; Sarna, T.; Strzalka, K. Senescence, Stress, and Reactive Oxygen Species. Plants 2015, 4, 393–411. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Name | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Locus [44] | Product Function |
---|---|---|---|---|
ACTIN1 | GGTGGTGAATGAGTAGCC | TTCTTTCCCTTTATGCC | Bpev01.c0427.g0027 | Component of the cytoskeleton |
CWINV3 | TATCAGACTCAAGCACCCAG | ATTACACGCCCAGAACAGAC | Bpev01.c0237.g0050 | CWInv isoforms |
CWINV1 | AGTGCCCCGATTTCTTCCCTG | GTCCACCTGCCCCTTGTCCG | Bpev01.c0333.g0031 | |
CWINV2 | GCTCTACCACAATCCTCCCA | GCACTCGCATTCATCCCCTC | Bpev01.c0516.g0006 | |
SUS1 | TAGCATCAACCCCTGTCCCT | GTTCAGTTCCTCAACCGTCA | Bpev01.c0294.g0013 | SuSy isoforms |
SUS2 | CTGCTAACCGCAACGAAAT | ACCGCCAAGGCAACCCAC | Bpev01.c0051.g0185 | |
CIF | GCAAGCAGACACCCTTTTAT | GTTTAGTTTTGGGCTACCGT | Bpev01.c0932.g0004 | Protein inhibitor of CWInv |
CESA3 | TGTCTGCTGCATCACCTG | AAAGAGTCATCCACAAGCACAT | Bpev01.c0777.g0012 | Cellulose synthase isoforms |
CESA7 | GTAATAGCCGGTGGTAGATCC | TGCTCGAAGCAATCGGTA | Bpev01.c0603.g0003 | |
VND7 | CCACTGCTGCTGGATTC | TACCATTGGGTGCTCGT | Bpev01.c0411.g0006 | Xylem-specific transcription factor |
APL | GAAGCTCAAGCTGGTCAC | GGAGAAAGCCTGTCAAAC | Bpev01.c0189.g0073 | Phloem-specific transcription factor |
HEX1 | GGGGTGGTTGATTCCTA | TCCAGCAGAGCATTGTG | Bpev01.c0329.g0008 | Hexose transporters |
HEX2 | GGATTTGCTTGGTCATGGGGTCC | ATTTATACCCTTGGTCTCTGG | Bpev01.c0151.g0005 | |
SUC | CTTCATCTGGCTCTGCG | GGTTTTCGTCGTCTTGTC | Bpev01.c0594.g0012 | Sucrose transporter |
UGT84B1 | CAGCATCGTAGGCTCAAGTC | TGTTCTCACGGTCAAAGTCC | Bpev01.c0157.g0047 | Auxin conjugation with UGT-glucose |
PIN1 | CACTCCCAGACCCTCAAAT | TTCCTCCCACCAGCCATCA | Bpev01.c0147.g0002 | Polar auxin transport |
PIN2 | CCATTGTGCCTTTATACGTTGCC | GAAATTTCCGTACATGGCCTTCAG | Bpev01.c0606.g0011 | |
PIN3 | CCCAACCCAGAGTTCTCGTC | CACACCGAATCCCTCACTTTC | Bpev01.c1162.g0001 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Serkova, A.A.; Tarelkina, T.V.; Galibina, N.A.; Nikerova, K.M.; Moshchenskaya, Y.L.; Sofronova, I.N.; Nikolaeva, N.N.; Ivanova, D.S.; Semenova, L.I.; Novitskaya, L.L. Changes in the Differentiation Program of Birch Cambial Derivatives following Trunk Girdling. Forests 2022, 13, 1171. https://doi.org/10.3390/f13081171
Serkova AA, Tarelkina TV, Galibina NA, Nikerova KM, Moshchenskaya YL, Sofronova IN, Nikolaeva NN, Ivanova DS, Semenova LI, Novitskaya LL. Changes in the Differentiation Program of Birch Cambial Derivatives following Trunk Girdling. Forests. 2022; 13(8):1171. https://doi.org/10.3390/f13081171
Chicago/Turabian StyleSerkova, Aleksandra A., Tatiana V. Tarelkina, Natalia A. Galibina, Kseniya M. Nikerova, Yulia L. Moshchenskaya, Irina N. Sofronova, Nadezhda N. Nikolaeva, Diana S. Ivanova, Ludmila I. Semenova, and Ludmila L. Novitskaya. 2022. "Changes in the Differentiation Program of Birch Cambial Derivatives following Trunk Girdling" Forests 13, no. 8: 1171. https://doi.org/10.3390/f13081171