The Gelatinase Inhibitor ACT-03 Reduces Gliosis in the Rapid Kindling Rat Model of Epilepsy, and Attenuates Inflammation and Loss of Barrier Integrity In Vitro
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.1.1. ACT-03 Treatment
2.1.2. Immunohistochemistry
2.2. Cell Culture
2.2.1. Human Fetal Astrocytes
2.2.2. Brain Endothelial Cells
2.2.3. Cell Culture Treatment
2.2.4. Viability Assay
2.2.5. BBB Model
2.2.6. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
2.2.7. Permeability Assay
2.2.8. Immunocytochemistry
2.3. Statistical Analysis
3. Results
3.1. ACT-03 Attenuates Seizure-Induced Astro- and Microgliosis
3.2. ACT-03 Reduces the Expression of Various Pro-Inflammatory Factors In Vitro
3.3. Effects of ACT-03 on the Expression of MMPs and Transcriptional Regulators
3.4. Modulatory Effect of ACT-03 on In Vitro Barrier Integrity
4. Discussion
4.1. Astroglial and Inflammatory Responses Dampened by ACT-03
4.2. ACT-03 Treatment Partially Ameliorates Endothelial Activation
4.3. Reduced MMP Transcription Potentially through Indirect Negative Feedback
4.4. Functional Beneficial Effects of ACT-03 on Barrier Integrity
5. Conclusions
6. Patents
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bonnans, C.; Chou, J.; Werb, Z. Remodelling the extracellular matrix in development and disease. Nat. Rev. Mol. Cell Biol. 2014, 15, 786–801. [Google Scholar] [CrossRef] [PubMed]
- Huntley, G.W. Synaptic circuit remodelling by matrix metalloproteinases in health and disease. Nat. Rev. Neurosci. 2012, 13, 743–757. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Lee, S.R.; Arai, K.; Lee, S.R.; Tsuji, K.; Rebeck, G.W.; Lo, E.H. Lipoprotein receptor-mediated induction of matrix metalloproteinase by tissue plasminogen activator. Nat. Med. 2003, 9, 1313–1317. [Google Scholar] [CrossRef] [PubMed]
- Lakhan, S.E.; Kirchgessner, A.; Tepper, D.; Leonard, A. Matrix metalloproteinases and blood-brain barrier disruption in acute ischemic stroke. Front. Neurol. 2013, 4, 32. [Google Scholar] [CrossRef]
- Dufour, A.; Overall, C.M. Subtracting Matrix Out of the Equation: New Key Roles of Matrix Metalloproteinases in Innate Immunity and Disease, 1st ed.; Sagi, I., Gaffney, J., Eds.; John Wiley & Sons, Inc.: Franklin Township, NJ, USA, 2015; pp. 131–152. [Google Scholar]
- Bonneh-Barkay, D.; Wiley, C.A. Brain extracellular matrix in neurodegeneration. Brain Pathol. 2009, 19, 573–585. [Google Scholar] [CrossRef]
- De Luca, C.; Papa, M. Matrix Metalloproteinases, Neural Extracellular Matrix, and Central Nervous System Pathology. Prog Mol. Biol. Transl. Sci. 2017, 148, 167–202. [Google Scholar]
- Dityatev, A.; Seidenbecher, C.I.; Schachner, M. Compartmentalization from the outside: The extracellular matrix and functional microdomains in the brain. Trends Neurosci. 2010, 33, 503–512. [Google Scholar] [CrossRef]
- Rempe, R.G.; Hartz, A.M.; Bauer, B. Matrix metalloproteinases in the brain and blood-brain barrier: Versatile breakers and makers. J. Cereb. Blood Flow Metab. Off. J. Int. Soc. Cereb. Blood Flow Metab. 2016, 36, 1481–1507. [Google Scholar] [CrossRef]
- Dufour, A.; Zucker, S.; Sampson, N.S.; Kuscu, C.; Cao, J. Role of matrix metalloproteinase-9 dimers in cell migration: Design of inhibitory peptides. J. Biol. Chem. 2010, 285, 35944–35956. [Google Scholar] [CrossRef]
- Gorkiewicz, T.; Balcerzyk, M.; Kaczmarek, L.; Knapska, E. Matrix metalloproteinase 9 (MMP-9) is indispensable for long term potentiation in the central and basal but not in the lateral nucleus of the amygdala. Front. Cell. Neurosci. 2015, 9, 73. [Google Scholar] [CrossRef]
- Dufour, A.; Overall, C.M. Missing the target: Matrix metalloproteinase antitargets in inflammation and cancer. Trends Pharmacol. Sci. 2013, 34, 233–242. [Google Scholar] [CrossRef] [PubMed]
- Lischper, M.; Beuck, S.; Thanabalasundaram, G.; Pieper, C.; Galla, H.J. Metalloproteinase mediated occludin cleavage in the cerebral microcapillary endothelium under pathological conditions. Brain Res. 2010, 1326, 114–127. [Google Scholar] [CrossRef] [PubMed]
- Thanabalasundaram, G.; Pieper, C.; Lischper, M.; Galla, H.J. Regulation of the blood-brain barrier integrity by pericytes via matrix metalloproteinases mediated activation of vascular endothelial growth factor in vitro. Brain Res. 2010, 1347, 1–10. [Google Scholar] [CrossRef]
- Rempe, R.G.; Hartz, A.M.S.; Soldner, E.L.B.; Sokola, B.S. Matrix Metalloproteinase-Mediated Blood-Brain Barrier Dysfunction in Epilepsy. J. Neurosci. 2018, 38, 4301–4315. [Google Scholar] [CrossRef] [PubMed]
- Daneman, R. The blood-brain barrier in health and disease. Ann. Neurol. 2012, 72, 648–672. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.Y.; Senatorov, V.V., Jr.; Morrissey, C.S.; Lippmann, K.; Vazquez, O.; Milikovsky, D.Z.; Gu, F.; Parada, I.; Prince, D.A.; Becker, A.J.; et al. TGFbeta signaling is associated with changes in inflammatory gene expression and perineuronal net degradation around inhibitory neurons following various neurological insults. Sci. Rep. 2017, 7, 7711. [Google Scholar] [CrossRef]
- Stanimirovic, D.B.; Friedman, A. Pathophysiology of the neurovascular unit: Disease cause or consequence? J. Cereb. Blood Flow Metab. Off. J. Int. Soc. Cereb. Blood Flow Metab. 2012, 32, 1207–1221. [Google Scholar] [CrossRef]
- Reinhard, S.M.; Razak, K.; Ethell, I.M. A delicate balance: Role of MMP-9 in brain development and pathophysiology of neurodevelopmental disorders. Front. Cell. Neurosci. 2015, 9, 280. [Google Scholar] [CrossRef]
- Vafadari, B.; Salamian, A.; Kaczmarek, L. MMP-9 in translation: From molecule to brain physiology, pathology, and therapy. J. Neurochem. 2016, 139 (Suppl. S2), 91–114. [Google Scholar] [CrossRef]
- Cabral-Pacheco, G.A.; Garza-Veloz, I.; Castruita-De la Rosa, C.; Ramirez-Acuña, J.M.; Perez-Romero, B.A.; Guerrero-Rodriguez, J.F.; Martinez-Avila, N.; Martinez-Fierro, M.L. The Roles of Matrix Metalloproteinases and Their Inhibitors in Human Diseases. Int. J. Mol. Sci. 2020, 21, 9739. [Google Scholar] [CrossRef]
- Vandenbroucke, R.E.; Libert, C. Is there new hope for therapeutic matrix metalloproteinase inhibition? Nat. Rev. Drug Discov. 2014, 13, 904–927. [Google Scholar] [CrossRef] [PubMed]
- Gialeli, C.; Theocharis, A.D.; Karamanos, N.K. Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting. FEBS J. 2011, 278, 16–27. [Google Scholar] [CrossRef] [PubMed]
- Lees, K.R.; Bornstein, N.; Diener, H.C.; Gorelick, P.B.; Rosenberg, G.; Shuaib, A.; Investigators, M. Results of Membrane-Activated Chelator Stroke Intervention randomized trial of DP-b99 in acute ischemic stroke. Stroke 2013, 44, 580–584. [Google Scholar] [CrossRef]
- Wu, M.Y.; Gao, F.; Yang, X.M.; Qin, X.; Chen, G.Z.; Li, D.; Dang, B.Q.; Chen, G. Matrix metalloproteinase-9 regulates the blood brain barrier via the hedgehog pathway in a rat model of traumatic brain injury. Brain Res. 2020, 1727, 146553. [Google Scholar] [CrossRef] [PubMed]
- Jia, F.; Yin, Y.H.; Gao, G.Y.; Wang, Y.; Cen, L.; Jiang, J.Y. MMP-9 inhibitor SB-3CT attenuates behavioral impairments and hippocampal loss after traumatic brain injury in rat. J. Neurotrauma 2014, 31, 1225–1234. [Google Scholar] [CrossRef]
- Bertran, A.; Khomiak, D.; Konopka, A.; Rejmak, E.; Bulska, E.; Seco, J.; Kaczmarek, L.; Tarragó, T.; Prades, R. Design and synthesis of selective and blood-brain barrier-permeable hydroxamate-based gelatinase inhibitors. Bioorganic Chem. 2020, 94, 103365. [Google Scholar] [CrossRef] [PubMed]
- Broekaart, D.W.; Bertran, A.; Jia, S.; Korotkov, A.; Senkov, O.; Bongaarts, A.; Mills, J.D.; Anink, J.J.; Seco, J.; Baayen, J.C.; et al. The matrix metalloproteinase inhibitor IPR-179 has antiseizure and antiepileptogenic effects. J. Clin. Investig. 2021, 131, e138332. [Google Scholar] [CrossRef]
- van Scheppingen, J.; Iyer, A.M.; Prabowo, A.S.; Muhlebner, A.; Anink, J.J.; Scholl, T.; Feucht, M.; Jansen, F.E.; Spliet, W.G.; Krsek, P.; et al. Expression of microRNAs miR21, miR146a, and miR155 in tuberous sclerosis complex cortical tubers and their regulation in human astrocytes and SEGA-derived cell cultures. Glia 2016, 64, 1066–1082. [Google Scholar] [CrossRef]
- Korotkov, A.; Broekaart, D.W.M.; Van Scheppingen, J.; Anink, J.J.; Baayen, J.C.; Idema, S.; Gorter, J.A.; Aronica, E.; Van Vliet, E.A. Increased expression of matrix metalloproteinase 3 can be attenuated by inhibition of microRNA-155 in cultured human astrocytes. J. Neuroinflamm. 2018, 15, 211. [Google Scholar] [CrossRef]
- Iyer, A.; Zurolo, E.; Prabowo, A.; Fluiter, K.; Spliet, W.G.; van Rijen, P.C.; Gorter, J.A.; Aronica, E. MicroRNA-146a: A key regulator of astrocyte-mediated inflammatory response. PLoS ONE 2012, 7, e44789. [Google Scholar] [CrossRef]
- Weksler, B.; Romero, I.A.; Couraud, P.O. The hCMEC/D3 cell line as a model of the human blood brain barrier. Fluids Barriers CNS 2013, 10, 16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kulczar, C.; Lubin, K.E.; Lefebvre, S.; Miller, D.W.; Knipp, G.T. Development of a direct contact astrocyte-human cerebral microvessel endothelial cells blood-brain barrier coculture model. J. Pharm. Pharmacol. 2017, 69, 1684–1696. [Google Scholar] [CrossRef] [PubMed]
- van Scheppingen, J.; Broekaart, D.W.; Scholl, T.; Zuidberg, M.R.; Anink, J.J.; Spliet, W.G.; van Rijen, P.C.; Czech, T.; Hainfellner, J.A.; Feucht, M.; et al. Dysregulation of the (immuno)proteasome pathway in malformations of cortical development. J. Neuroinflamm. 2016, 13, 202. [Google Scholar] [CrossRef] [PubMed]
- Maxime, C.; Stefan, L.; Dorothée, V.; Stéphane, N.; Christophe, L.; Yannick, D.; Marie-Pierre, D.; Vincent, B.; Laurence, F.; Roméo, C. An in vitro blood-brain barrier model for high throughput (HTS) toxicological screening. Toxicol. Vitr. 2008, 22, 799–811. [Google Scholar]
- Van Hove, I.; Lemmens, K.; Van de Velde, S.; Verslegers, M.; Moons, L. Matrix metalloproteinase-3 in the central nervous system: A look on the bright side. J. Neurochem. 2012, 123, 203–216. [Google Scholar] [CrossRef]
- Wu, C.-Y.; Hsieh, H.-L.; Jou, M.-J.; Yang, C.-M. Involvement of p42/p44 MAPK, p38 MAPK, JNK and nuclear factor-kappa B in interleukin-1β-induced matrix metalloproteinase-9 expression in rat brain astrocytes. J. Neurochem. 2004, 90, 1477–1488. [Google Scholar] [CrossRef]
- Kaczmarek, L.; Lapinska-Dzwonek, J.; Szymczak, S. Matrix metalloproteinases in the adult brain physiology: A link between c-Fos, AP-1 and remodeling of neuronal connections? EMBO J. 2002, 21, 6643–6648. [Google Scholar] [CrossRef]
- Zhao, W.; Han, L.; Bae, Y.; Manickam, D.S. Lucifer Yellow—A Robust Paracellular Permeability Marker in a Cell Model of the Human Blood-brain Barrier. J. Vis. Exp. 2019, 150, e58900. [Google Scholar] [CrossRef]
- Poller, B.; Gutmann, H.; Krähenbühl, S.; Weksler, B.; Romero, I.; Couraud, P.-O.; Tuffin, G.; Drewe, J.; Huwyler, J. The human brain endothelial cell line hCMEC/D3 as a human blood-brain barrier model for drug transport studies. J. Neurochem. 2008, 107, 1358–1368. [Google Scholar] [CrossRef]
- Eigenmann, D.E.; Xue, G.; Kim, K.S.; Moses, A.V.; Hamburger, M.; Oufir, M. Comparative study of four immortalized human brain capillary endothelial cell lines, hCMEC/D3, hBMEC, TY10, and BB19, and optimization of culture conditions, for an in vitro blood–brain barrier model for drug permeability studies. Fluids Barriers CNS 2013, 10, 33. [Google Scholar] [CrossRef]
- Vezzani, A.; Aronica, E.; Mazarati, A.; Pittman, Q.J. Epilepsy and brain inflammation. Exp. Neurol. 2013, 244, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Broekaart, D.W.M.; Korotkov, A.; Gorter, J.A.; van Vliet, E.A. Perivascular Inflammation and Extracellular Matrix Alterations in Blood-Brain Barrier Dysfunction and Epilepsy. In Inflammation and Epilepsy: New Vistas; Janigro, D., Nehlig, A., Marchi, N., Eds.; Springer International Publishing: Cham, Switzerland, 2021; pp. 71–106. [Google Scholar]
- Buscemi, L.; Price, M.; Bezzi, P.; Hirt, L. Spatio-temporal overview of neuroinflammation in an experimental mouse stroke model. Sci. Rep. 2019, 9, 507. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takahashi, D.K.; Vargas, J.R.; Wilcox, K.S. Increased coupling and altered glutamate transport currents in astrocytes following kainic-acid-induced status epilepticus. Neurobiol. Dis. 2010, 40, 573–585. [Google Scholar] [CrossRef] [PubMed]
- Coulter, D.A.; Steinhauser, C. Role of astrocytes in epilepsy. Cold Spring Harb. Perspect. Med. 2015, 5, a022434. [Google Scholar] [CrossRef] [PubMed]
- Drion, C.M.; Kooijman, L.; Aronica, E.; van Vliet, E.A.; Wadman, W.J.; Chameau, P.; Gorter, J.A. Curcumin reduces development of seizurelike events in the hippocampal-entorhinal cortex slice culture model for epileptogenesis. Epilepsia 2019, 60, 605–614. [Google Scholar] [CrossRef]
- Escartin, C.; Galea, E.; Lakatos, A.; O’Callaghan, J.P.; Petzold, G.C.; Serrano-Pozo, A.; Steinhäuser, C.; Volterra, A.; Carmignoto, G.; Agarwal, A.; et al. Reactive astrocyte nomenclature, definitions, and future directions. Nat. Neurosci. 2021, 24, 312–325. [Google Scholar] [CrossRef]
- Gorter, J.A.; van Vliet, E.A.; Lopes da Silva, F.H.; Isom, L.L.; Aronica, E. Sodium channel beta1-subunit expression is increased in reactive astrocytes in a rat model for mesial temporal lobe epilepsy. Eur. J. Neurosci. 2002, 16, 360–364. [Google Scholar] [CrossRef]
- Liddelow, S.A.; Barres, B.A. Reactive Astrocytes: Production, Function, and Therapeutic Potential. Immunity 2017, 46, 957–967. [Google Scholar] [CrossRef]
- Walker, E.J.; Rosenberg, G.A. Divergent role for MMP-2 in myelin breakdown and oligodendrocyte death following transient global ischemia. J. Neurosci. Res. 2010, 88, 764–773. [Google Scholar] [CrossRef]
- Lee, E.-J.; Choi, M.-J.; Lee, G.; Prasad Gaire, B.; Woong Choi, J.; Kim, H.-S. Regulation of neuroinflammation by matrix metalloproteinase-8 inhibitor derivatives in activated microglia and astrocytes. Oncotarget 2017, 8, 78677–78690. [Google Scholar] [CrossRef]
- Wang, X.; Ji, S.; Ma, Y.; Xing, X.; Zhou, Y.; Xu, X.; Song, J.; Wang, S.; Jiang, W.; Wang, X.; et al. Vimentin plays an important role in the promotion of breast cancer cell migration and invasion by leucine aminopeptidase 3. Cytotechnology 2020, 72, 639–647. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.-Y.; Tsai, P.-H.; Kandaswami, C.C.; Lee, P.-P.; Huang, C.-J.; Hwang, J.-J.; Lee, M.-T. Matrix metalloproteinase-9 cooperates with transcription factor Snail to induce epithelial–mesenchymal transition. Cancer Sci. 2011, 102, 815–827. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; He, J.; Wang, F.; Wang, X.; Yang, F.; Zhao, C.; Feng, C.; Li, T. Role of MMP-9 in epithelial-mesenchymal transition of thyroid cancer. World J. Surg. Oncol. 2020, 18, 181. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Kim, J.-H.; Do, J.Y.; Lee, J.Y.; Yanai, R.; Lee, I.-k.; Suk, K.; Park, D.H. Key Role of Microglial Matrix Metalloproteinases in Choroidal Neovascularization. Front. Cell. Neurosci. 2021, 15, 638098. [Google Scholar] [CrossRef]
- Kim, T.; Jeon, J.; Park, J.S.; Park, Y.; Kim, J.; Noh, H.; Kim, H.S.; Seo, H. Matrix Metalloproteinase-8 Inhibitor Ameliorates Inflammatory Responses and Behavioral Deficits in LRRK2 G2019S Parkinson’s Disease Model Mice. Biomol. Ther. 2021, 29, 483–491. [Google Scholar] [CrossRef]
- Racine, R.J. Modification of seizure activity by electrical stimulation. II. Motor seizure. Electroencephalogr. Clin. Neurophysiol. 1972, 32, 281–294. [Google Scholar] [CrossRef]
- Courtney, C.D.; Christian-Hinman, C. Assessin’ the Vexin’ Connexin Between Severity of Epilepsy and Hippocampal Gliosis. Epilepsy Curr. 2020, 20, 294–296. [Google Scholar] [CrossRef]
- Beurel, E.; Harrington, L.E.; Buchser, W.; Lemmon, V.; Jope, R.S. Astrocytes Modulate the Polarization of CD4+ T Cells to Th1 Cells. PLoS ONE 2014, 9, e86257. [Google Scholar]
- Savarin, C.; Hinton, D.R.; Valentin-Torres, A.; Chen, Z.; Trapp, B.D.; Bergmann, C.C.; Stohlman, S.A. Astrocyte response to IFN-γ limits IL-6-mediated microglia activation and progressive autoimmune encephalomyelitis. J. Neuroinflamm. 2015, 12, 79. [Google Scholar] [CrossRef]
- Hu, M.H.; Zheng, Q.F.; Jia, X.Z.; Li, Y.; Dong, Y.C.; Wang, C.Y.; Lin, Q.Y.; Zhang, F.Y.; Zhao, R.B.; Xu, H.W.; et al. Neuroprotection effect of interleukin (IL)-17 secreted by reactive astrocytes is emerged from a high-level IL-17-containing environment during acute neuroinflammation. Clin. Exp. Immunol. 2014, 175, 268–284. [Google Scholar] [CrossRef]
- Malik, A.R.; Lips, J.; Gorniak-Walas, M.; Broekaart, D.W.M.; Asaro, A.; Kuffner, M.T.C.; Hoffmann, C.J.; Kikhia, M.; Dopatka, M.; Boehm-Sturm, P.; et al. SorCS2 facilitates release of endostatin from astrocytes and controls post-stroke angiogenesis. Glia 2020, 68, 1304–1316. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, C.A.; Simon, A.; van der Meer, J.W.M. Treating inflammation by blocking interleukin-1 in a broad spectrum of diseases. Nat. Rev. Drug Discov. 2012, 11, 633–652. [Google Scholar] [CrossRef] [PubMed]
- Vezzani, A.; Friedman, A.; Dingledine, R.J. The role of inflammation in epileptogenesis. Neuropharmacology 2013, 69, 16–24. [Google Scholar] [CrossRef] [Green Version]
- Becher, B.; Spath, S.; Goverman, J. Cytokine networks in neuroinflammation. Nat. Rev. Immunol. 2017, 17, 49–59. [Google Scholar] [CrossRef] [PubMed]
- Pugazhenthi, S.; Zhang, Y.; Bouchard, R.; Mahaffey, G. Induction of an inflammatory loop by interleukin-1β and tumor necrosis factor-α involves NF-kB and STAT-1 in differentiated human neuroprogenitor cells. PLoS ONE 2013, 8, e69585. [Google Scholar]
- Glass, C.K.; Saijo, K.; Winner, B.; Marchetto, M.C.; Gage, F.H. Mechanisms underlying inflammation in neurodegeneration. Cell 2010, 140, 918–934. [Google Scholar] [CrossRef]
- Allan, S.M.; Tyrrell, P.J.; Rothwell, N.J. Interleukin-1 and neuronal injury. Nat. Rev. Immunol. 2005, 5, 629–640. [Google Scholar] [CrossRef]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef]
- West, P.K.; Viengkhou, B.; Campbell, I.L.; Hofer, M.J. Microglia responses to interleukin-6 and type I interferons in neuroinflammatory disease. Glia 2019, 67, 1821–1841. [Google Scholar] [CrossRef]
- Klein, M.A.; Möller, J.C.; Jones, L.L.; Bluethmann, H.; Kreutzberg, G.W.; Raivich, G. Impaired neuroglial activation in interleukin-6 deficient mice. Glia 1997, 19, 227–233. [Google Scholar] [CrossRef]
- Rothaug, M.; Becker-Pauly, C.; Rose-John, S. The role of interleukin-6 signaling in nervous tissue. Biochim. Et Biophys. Acta (BBA)-Mol. Cell Res. 2016, 1863, 1218–1227. [Google Scholar]
- Fang, X.-X.; Jiang, X.-L.; Han, X.-H.; Peng, Y.-P.; Qiu, Y.-H. Neuroprotection of Interleukin-6 Against NMDA-induced Neurotoxicity is Mediated by JAK/STAT3, MAPK/ERK, and PI3K/AKT Signaling Pathways. Cell. Mol. Neurobiol. 2013, 33, 241–251. [Google Scholar] [PubMed]
- Yang, P.; Wen, H.; Ou, S.; Cui, J.; Fan, D. IL-6 promotes regeneration and functional recovery after cortical spinal tract injury by reactivating intrinsic growth program of neurons and enhancing synapse formation. Exp. Neurol. 2012, 236, 19–27. [Google Scholar] [PubMed]
- Samoilova, E.B.; Horton, J.L.; Hilliard, B.; Liu, T.-S.T.; Chen, Y. IL-6-Deficient Mice Are Resistant to Experimental Autoimmune Encephalomyelitis: Roles of IL-6 in the Activation and Differentiation of Autoreactive T Cells. J. Immunol. 1998, 161, 6480–6486. [Google Scholar] [PubMed]
- Bustamante, A.; Sobrino, T.; Giralt, D.; García-Berrocoso, T.; Llombart, V.; Ugarriza, I.; Espadaler, M.; Rodríguez, N.; Sudlow, C.; Castellanos, M.; et al. Prognostic value of blood interleukin-6 in the prediction of functional outcome after stroke: A systematic review and meta-analysis. J. Neuroimmunol. 2014, 274, 215–224. [Google Scholar]
- Kang, S.; Kishimoto, T. Interplay between interleukin-6 signaling and the vascular endothelium in cytokine storms. Exp. Mol. Med. 2021, 53, 1116–1123. [Google Scholar]
- Ferrari, G.; Cook, B.D.; Terushkin, V.; Pintucci, G.; Mignatti, P. Transforming growth factor-beta 1 (TGF-beta1) induces angiogenesis through vascular endothelial growth factor (VEGF)-mediated apoptosis. J. Cell. Physiol. 2009, 219, 449–458. [Google Scholar]
- Nakagawa, T.; Li, J.H.; Garcia, G.; Mu, W.; Piek, E.; Böttinger, E.P.; Chen, Y.; Zhu, H.J.; Kang, D.-H.; Schreiner, G.F.; et al. TGF-β induces proangiogenic and antiangiogenic factorsvia parallel but distinct Smad pathways1. Kidney Int. 2004, 66, 605–613. [Google Scholar]
- Stipursky, J.; Francis, D.; Gomes, F.C. Activation of MAPK/PI3K/SMAD pathways by TGF-β(1) controls differentiation of radial glia into astrocytes in vitro. Dev. Neurosci. 2012, 34, 68–81. [Google Scholar]
- Stipursky, J.; Francis, D.; Dezonne, R.S.; Bérgamo de Araújo, A.P.; Souza, L.; Moraes, C.A.; Alcantara Gomes, F.C. TGF-β1 promotes cerebral cortex radial glia-astrocyte differentiation in vivo. Front. Cell. Neurosci. 2014, 8, 393. [Google Scholar]
- Diniz, L.P.; Matias, I.; Siqueira, M.; Stipursky, J.; Gomes, F.C.A. Astrocytes and the TGF-β1 Pathway in the Healthy and Diseased Brain: A Double-Edged Sword. Mol. Neurobiol. 2019, 56, 4653–4679. [Google Scholar] [PubMed]
- Cekanaviciute, E.; Fathali, N.; Doyle, K.P.; Williams, A.M.; Han, J.; Buckwalter, M.S. Astrocytic transforming growth factor-beta signaling reduces subacute neuroinflammation after stroke in mice. Glia 2014, 62, 1227–1240. [Google Scholar] [PubMed]
- Cekanaviciute, E.; Dietrich, H.K.; Axtell, R.C.; Williams, A.M.; Egusquiza, R.; Wai, K.M.; Koshy, A.A.; Buckwalter, M.S. Astrocytic TGF-β signaling limits inflammation and reduces neuronal damage during central nervous system Toxoplasma infection. J. Immunol. 2014, 193, 139–149. [Google Scholar] [PubMed]
- Romão, L.F.; Sousa Vde, O.; Neto, V.M.; Gomes, F.C. Glutamate activates GFAP gene promoter from cultured astrocytes through TGF-beta1 pathways. J. Neurochem. 2008, 106, 746–756. [Google Scholar] [PubMed]
- Sousa Vde, O.; Romão, L.; Neto, V.M.; Gomes, F.C. Glial fibrillary acidic protein gene promoter is differently modulated by transforming growth factor-beta 1 in astrocytes from distinct brain regions. Eur. J. Neurosci. 2004, 19, 1721–1730. [Google Scholar] [PubMed]
- Weissberg, I.; Wood, L.; Kamintsky, L.; Vazquez, O.; Milikovsky, D.Z.; Alexander, A.; Oppenheim, H.; Ardizzone, C.; Becker, A.; Frigerio, F.; et al. Albumin induces excitatory synaptogenesis through astrocytic TGF-beta/ALK5 signaling in a model of acquired epilepsy following blood-brain barrier dysfunction. Neurobiol. Dis. 2015, 78, 115–125. [Google Scholar]
- Impellizzeri, D.; Siracusa, R.; Cordaro, M.; Crupi, R.; Peritore, A.F.; Gugliandolo, E.; D’Amico, R.; Petrosino, S.; Evangelista, M.; Di Paola, R.; et al. N-Palmitoylethanolamine-oxazoline (PEA-OXA): A new therapeutic strategy to reduce neuroinflammation, oxidative stress associated to vascular dementia in an experimental model of repeated bilateral common carotid arteries occlusion. Neurobiol. Dis. 2019, 125, 77–91. [Google Scholar]
- Derada Troletti, C.; de Goede, P.; Kamermans, A.; de Vries, H.E. Molecular alterations of the blood–brain barrier under inflammatory conditions: The role of endothelial to mesenchymal transition. Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 2016, 1862, 452–460. [Google Scholar]
- de Vries, H.E.; Kooij, G.; Frenkel, D.; Georgopoulos, S.; Monsonego, A.; Janigro, D. Inflammatory events at blood-brain barrier in neuroinflammatory and neurodegenerative disorders: Implications for clinical disease. Epilepsia 2012, 53 (Suppl. S6), 45–52. [Google Scholar]
- Neumann, F.J.; Ott, I.; Marx, N.; Luther, T.; Kenngott, S.; Gawaz, M.; Kotzsch, M.; Schömig, A. Effect of human recombinant interleukin-6 and interleukin-8 on monocyte procoagulant activity. Arter. Thromb. Vasc. Biol. 1997, 17, 3399–3405. [Google Scholar]
- Kang, S.; Tanaka, T.; Inoue, H.; Ono, C.; Hashimoto, S.; Kioi, Y.; Matsumoto, H.; Matsuura, H.; Matsubara, T.; Shimizu, K.; et al. IL-6 trans-signaling induces plasminogen activator inhibitor-1 from vascular endothelial cells in cytokine release syndrome. Proc. Natl. Acad. Sci. USA 2020, 117, 22351–22356. [Google Scholar] [PubMed]
- Caughey, G.E.; Cleland, L.G.; Penglis, P.S.; Gamble, J.R.; James, M.J. Roles of cyclooxygenase (COX)-1 and COX-2 in prostanoid production by human endothelial cells: Selective up-regulation of prostacyclin synthesis by COX-2. J. Immunol. 2001, 167, 2831–2838. [Google Scholar] [PubMed]
- Russell-Puleri, S.; dela Paz, N.G.; Adams, D.; Chattopadhyay, M.; Cancel, L.; Ebong, E.; Orr, A.W.; Frangos, J.A.; Tarbell, J.M. Fluid shear stress induces upregulation of COX-2 and PGI2 release in endothelial cells via a pathway involving PECAM-1, PI3K, FAK, and p38. Am. J. Physiol.-Heart Circ. Physiol. 2017, 312, H485–H500. [Google Scholar]
- Minghetti, L. Cyclooxygenase-2 (COX-2) in inflammatory and degenerative brain diseases. J. Neuropathol. Exp. Neurol. 2004, 63, 901–910. [Google Scholar] [PubMed]
- Lin, C.-C.; Hsieh, H.-L.; Shih, R.-H.; Chi, P.-L.; Cheng, S.-E.; Yang, C.-M. Up-regulation of COX-2/PGE2 by endothelin-1 via MAPK-dependent NF-κB pathway in mouse brain microvascular endothelial cells. Cell Commun. Signal. 2013, 11, 8. [Google Scholar]
- Goumans, M.J.; Liu, Z.; ten Dijke, P. TGF-beta signaling in vascular biology and dysfunction. Cell Res. 2009, 19, 116–127. [Google Scholar]
- Goumans, M.J.; Valdimarsdottir, G.; Itoh, S.; Rosendahl, A.; Sideras, P.; ten Dijke, P. Balancing the activation state of the endothelium via two distinct TGF-beta type I receptors. EMBO J. 2002, 21, 1743–1753. [Google Scholar]
- Wyss-Coray, T.; Lin, C.; von Euw, D.; Masliah, E.; Mucke, L.; Lacombe, P. Alzheimer’s disease-like cerebrovascular pathology in transforming growth factor-beta 1 transgenic mice and functional metabolic correlates. Ann. N. Y. Acad. Sci. 2000, 903, 317–323. [Google Scholar] [CrossRef]
- Lifshitz, V.; Weiss, R.; Benromano, T.; Kfir, E.; Blumenfeld-Katzir, T.; Tempel-Brami, C.; Assaf, Y.; Xia, W.; Wyss-Coray, T.; Weiner, H.L.; et al. Immunotherapy of cerebrovascular amyloidosis in a transgenic mouse model. Neurobiol. Aging 2012, 33, e1–e432. [Google Scholar]
- Obermeier, B.; Daneman, R.; Ransohoff, R.M. Development, maintenance and disruption of the blood-brain barrier. Nat. Med. 2013, 19, 1584–1596. [Google Scholar]
- Greenwood, J.; Amos, C.L.; Walters, C.E.; Couraud, P.O.; Lyck, R.; Engelhardt, B.; Adamson, P. Intracellular domain of brain endothelial intercellular adhesion molecule-1 is essential for T lymphocyte-mediated signaling and migration. J. Immunol. 2003, 171, 2099–2108. [Google Scholar] [CrossRef] [PubMed]
- Reglero-Real, N.; Colom, B.; Bodkin, J.V.; Nourshargh, S. Endothelial Cell Junctional Adhesion Molecules: Role and Regulation of Expression in Inflammation. Arter. Thromb. Vasc. Biol. 2016, 36, 2048–2057. [Google Scholar]
- Yang, C.; Hawkins, K.E.; Doré, S.; Candelario-Jalil, E. Neuroinflammatory mechanisms of blood-brain barrier damage in ischemic stroke. Am. J. Physiol.-Cell Physiol. 2019, 316, C135–C153. [Google Scholar] [CrossRef]
- Moon, S.K.; Cha, B.Y.; Kim, C.H. ERK1/2 mediates TNF-alpha-induced matrix metalloproteinase-9 expression in human vascular smooth muscle cells via the regulation of NF-kappaB and AP-1: Involvement of the ras dependent pathway. J. Cell. Physiol. 2004, 198, 417–427. [Google Scholar] [PubMed]
- Vincenti, M.P. The matrix metalloproteinase (MMP) and tissue inhibitor of metalloproteinase (TIMP) genes. Transcriptional and posttranscriptional regulation, signal transduction and cell-type-specific expression. Methods Mol. Biol. 2001, 151, 121–148. [Google Scholar] [PubMed]
- Crocker, S.J.; Milner, R.; Pham-Mitchell, N.; Campbell, I.L. Cell and agonist-specific regulation of genes for matrix metalloproteinases and their tissue inhibitors by primary glial cells. J. Neurochem. 2006, 98, 812–823. [Google Scholar] [CrossRef]
- Ameyar, M.; Wisniewska, M.; Weitzman, J.B. A role for AP-1 in apoptosis: The case for and against. Biochimie 2003, 85, 747–752. [Google Scholar] [CrossRef]
- Benbow, U.; Brinckerhoff, C.E. The AP-1 site and MMP gene regulation: What is all the fuss about? Matrix Biol. J. Int. Soc. Matrix Biol. 1997, 15, 519–526. [Google Scholar]
- Van den Steen, P.E.; Proost, P.; Wuyts, A.; Van Damme, J.; Opdenakker, G. Neutrophil gelatinase B potentiates interleukin-8 tenfold by aminoterminal processing, whereas it degrades CTAP-III, PF-4, and GRO-alpha and leaves RANTES and MCP-2 intact. Blood 2000, 96, 2673–2681. [Google Scholar]
- Schonbeck, U.; Mach, F.; Libby, P. Generation of biologically active IL-1 beta by matrix metalloproteinases: A novel caspase-1-independent pathway of IL-1 beta processing. J. Immunol. 1998, 161, 3340–3346. [Google Scholar]
- Mohan, M.J.; Seaton, T.; Mitchell, J.; Howe, A.; Blackburn, K.; Burkhart, W.; Moyer, M.; Patel, I.; Waitt, G.M.; Becherer, J.D.; et al. The tumor necrosis factor-alpha converting enzyme (TACE): A unique metalloproteinase with highly defined substrate selectivity. Biochemistry 2002, 41, 9462–9469. [Google Scholar] [CrossRef]
- Dityatev, A. Remodeling of extracellular matrix and epileptogenesis. Epilepsia 2010, 51 (Suppl 3), 61–65. [Google Scholar] [CrossRef] [PubMed]
- Dityatev, A.; Schachner, M.; Sonderegger, P. The dual role of the extracellular matrix in synaptic plasticity and homeostasis. Nat. Rev. Neurosci. 2010, 11, 735–746. [Google Scholar] [CrossRef]
- Gorter, J.A.; van Vliet, E.A.; Aronica, E. Status epilepticus, blood-brain barrier disruption, inflammation, and epileptogenesis. Epilepsy Behav. 2015, 49, 13–16. [Google Scholar] [CrossRef] [PubMed]
- Marchi, N.; Angelov, L.; Masaryk, T.; Fazio, V.; Granata, T.; Hernandez, N.; Hallene, K.; Diglaw, T.; Franic, L.; Najm, I.; et al. Seizure-Promoting Effect of Blood-Brain Barrier Disruption. Epilepsia 2007, 48, 732–742. [Google Scholar] [CrossRef]
- Marchi, N.; Granata, T.; Ghosh, C.; Janigro, D. Blood-brain barrier dysfunction and epilepsy: Pathophysiologic role and therapeutic approaches. Epilepsia 2012, 53, 1877–1886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marchi, N.; Tierney, W.; Alexopoulos, A.V.; Puvenna, V.; Granata, T.; Janigro, D. The etiological role of blood-brain barrier dysfunction in seizure disorders. Cardiovasc. Psychiatry Neurol. 2011, 2011, 482415. [Google Scholar] [CrossRef] [PubMed]
- van Vliet, E.A.; Aronica, E.; Gorter, J.A. Blood-brain barrier dysfunction, seizures and epilepsy. Semin. Cell Dev. Biol. 2015, 38, 26–34. [Google Scholar] [CrossRef]
- van Vliet, E.A.; Otte, W.M.; Wadman, W.J.; Aronica, E.; Kooij, G.; de Vries, H.E.; Dijkhuizen, R.M.; Gorter, J.A. Blood-brain barrier leakage after status epilepticus in rapamycin-treated rats I: Magnetic resonance imaging. Epilepsia 2016, 57, 59–69. [Google Scholar] [CrossRef] [PubMed]
- Feng, S.; Cen, J.; Huang, Y.; Shen, H.; Yao, L.; Wang, Y.; Chen, Z. Matrix metalloproteinase-2 and -9 secreted by leukemic cells increase the permeability of blood-brain barrier by disrupting tight junction proteins. PLoS ONE 2011, 6, e20599. [Google Scholar] [CrossRef]
- Dejana, E.; Orsenigo, F. Endothelial adherens junctions at a glance. J. Cell Sci 2013, 126 Pt 12, 2545–2549. [Google Scholar] [CrossRef] [PubMed]
- Gu, Y.; Zheng, G.; Xu, M.; Li, Y.; Chen, X.; Zhu, W.; Tong, Y.; Chung, S.K.; Liu, K.J.; Shen, J. Caveolin-1 regulates nitric oxide-mediated matrix metalloproteinases activity and blood-brain barrier permeability in focal cerebral ischemia and reperfusion injury. J. Neurochem. 2012, 120, 147–156. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Estrada, E.Y.; Thompson, J.F.; Liu, W.; Rosenberg, G.A. Matrix Metalloproteinase-Mediated Disruption of Tight Junction Proteins in Cerebral Vessels is Reversed by Synthetic Matrix Metalloproteinase Inhibitor in Focal Ischemia in Rat. J. Cereb. Blood Flow Metab. 2007, 27, 697–709. [Google Scholar] [CrossRef] [PubMed]
- Reijerkerk, A.; Kooij, G.; van der Pol, S.M.; Khazen, S.; Dijkstra, C.D.; de Vries, H.E. Diapedesis of monocytes is associated with MMP-mediated occludin disappearance in brain endothelial cells. FASEB J. 2006, 20, 2550–2552. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Name | Forward | Reverse |
---|---|---|---|
EF1α | Elongation factor 1 alpha | ATCCACCTTTGGGTCGCTTT | CCGCAACTGTCTGTCTCATATCAC |
C1orf43 | Chromosome 1 open reading frame 43 | GATTTCCCTGGGTTTCCAGT | ATTCGACTCTCCAGGGTTCA |
GAPDH | Glyceraldehyde 3-phosphate dehydrogenase | AGGCAACTAGGATGGTGTGG | TTGATTTTGGAGGGATCTCG |
IL-1β | Interleukin 1 beta | GCATCCAGCTACGAATCTCC | GAACCAGCATCTTCCTCAGC |
IL-6 | Interleukin 6 beta | CTCAGCCCTGAGAAAGGAGA | TTTCAGCCATCTTTGGAAGG |
TNFα | Tumor necrosis factor alpha | CCCCAGGGACCTCTCTCTAA | CAGCTTGAGGGTTTGCTACA |
COX2 | Cyclo-oxygenase 2 | GAATGGGGTGATGAGCAGTT | GCCACTCAAGTGTTGCACAT |
TGFβ | Transforming growth factor beta | GTGGAAACCCACAACGAAAT | CGGAGCTCTGATGTGTTGAA |
TGFβ-R1 | Transforming growth factor beta receptor 1 | AAGAACGTTCGTGGTTCCGT | CACCAACCAGAGCTGAGTCC |
TGFβ-R2 | Transforming growth factor beta receptor 2 | CCACCGCACGTTCAGAAGTC | GTCCTATTACAGCTGGGGCA |
ICAM1 | Intracellular adhesion molecule 1 | AGCTTCGTGTCCTGTATGGC | TTTTCTGGCCACGTCCAGTT |
PECAM1 | Platelet and endothelial cell adhesion molecule 1 (CD31) | GGAAGTTCAAGTGTCCTCAGC | GGAGCCTTCCGTTCTAGAGT |
MMP2 | Matrix metalloproteinase 2 | ATAACCTGGATGCCGTCGT | AGGCACCCTTGAAGAAGTAGC |
MMP3 | Matrix metalloproteinase 2 | CTCCAACCGTGAGGAAAATC | CATGGAATTTCTCTTCTCATCAAA |
MMP9 | Matrix metalloproteinase 3 | GAACCAATCTCACCGACAGG | GCCACCCGAGTGTAACCATA |
cFOS | Activator protein-1 subunit cFOS | GGAGAATCCGAAGGGAAAGGA | GCAAAGCAGACTTCTCATCTTCT |
cJUN | Activator protein-1 subunit cJUN | CCAACTCATGCTAACGCAGC | TCTCTCCGTCGCAACTTGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Broekaart, D.W.M.; Zimmer, T.S.; Cohen, S.T.; Tessers, R.; Anink, J.J.; de Vries, H.E.; Gorter, J.A.; Prades, R.; Aronica, E.; van Vliet, E.A. The Gelatinase Inhibitor ACT-03 Reduces Gliosis in the Rapid Kindling Rat Model of Epilepsy, and Attenuates Inflammation and Loss of Barrier Integrity In Vitro. Biomedicines 2022, 10, 2117. https://doi.org/10.3390/biomedicines10092117
Broekaart DWM, Zimmer TS, Cohen ST, Tessers R, Anink JJ, de Vries HE, Gorter JA, Prades R, Aronica E, van Vliet EA. The Gelatinase Inhibitor ACT-03 Reduces Gliosis in the Rapid Kindling Rat Model of Epilepsy, and Attenuates Inflammation and Loss of Barrier Integrity In Vitro. Biomedicines. 2022; 10(9):2117. https://doi.org/10.3390/biomedicines10092117
Chicago/Turabian StyleBroekaart, Diede W. M., Till S. Zimmer, Sophie T. Cohen, Rianne Tessers, Jasper J. Anink, Helga E. de Vries, Jan A. Gorter, Roger Prades, Eleonora Aronica, and Erwin A. van Vliet. 2022. "The Gelatinase Inhibitor ACT-03 Reduces Gliosis in the Rapid Kindling Rat Model of Epilepsy, and Attenuates Inflammation and Loss of Barrier Integrity In Vitro" Biomedicines 10, no. 9: 2117. https://doi.org/10.3390/biomedicines10092117