Next Article in Journal
Genome-Wide Development of Polymorphic Microsatellite Markers and Genetic Diversity Analysis for the Halophyte Suaeda aralocaspica (Amaranthaceae)
Next Article in Special Issue
Chemical Identification of Secondary Metabolites from Rhizospheric Actinomycetes Using LC-MS Analysis: In Silico Antifungal Evaluation and Growth-Promoting Effects
Previous Article in Journal
Sensitivity of the Photosynthetic Apparatus in Maize and Sorghum under Different Drought Levels
Previous Article in Special Issue
Exploring the Biocontrol Efficacy of Trichoderma spp. against Rigidoporus microporus, the Causal Agent of White Root Rot Disease in Rubber Trees (Hevea brasiliensis)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 9
10.3390/plants12091864
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Native Trichoderma Induced the Defense-Related Enzymes and Genes in Rice against Xanthomonas oryzae pv. oryzae (Xoo)

by
Md. Rashidul Islam
1,*,
Rabin Chowdhury
1,†,
Arpita Saha Roy
1,†,
Md. Nazmul Islam
1,†,
Mamuna Mahjabin Mita
1,
Samrin Bashar
1,
Plabon Saha
1,
Ridwan Ahmed Rahat
2,
Mehedi Hasan
2,
Mst. Arjina Akter
1,
Md. Zahangir Alam
1 and
Md. Abdul Latif
3
1
Plant Bacteriology and Biotechnology Laboratory, Department of Plant Pathology, Bangladesh Agricultural University, Mymensingh 2202, Bangladesh
2
Faculty of Agriculture, Bangladesh Agricultural University, Mymensingh 2202, Bangladesh
3
Plant Pathology Division, Bangladesh Rice Research Institute, Joydebpur, Gazipur 1701, Bangladesh
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2023, 12(9), 1864; https://doi.org/10.3390/plants12091864
Submission received: 29 January 2023 / Revised: 16 February 2023 / Accepted: 27 February 2023 / Published: 30 April 2023
(This article belongs to the Special Issue Biological Control of Plant Diseases Caused by Pathogenic Microorganisms)
Browse Figures
Versions Notes

Abstract

:
The application of Trichoderma is a form of biological control that has been effective in combating Xanthomonas oryzae pv. oryzae, the causative agent of the devastating disease known as bacterial blight of rice. In this present study, four strains of Trichoderma, viz., T. paraviridescens (BDISOF67), T. erinaceum (BDISOF91), T. asperellum (BDISOF08), and T. asperellum (BDISOF09), were collected from the rice rhizosphere and used to test their potentiality in reducing bacterial blight. The expression patterns of several core defense-related enzymes and genes related to SA and JA pathways were studied to explore the mechanism of induced resistance by those Trichoderma strains. The results primarily indicated that all Trichoderma were significantly efficient in reducing the lesion length of the leaf over rice check variety (IR24) through enhancing the expression of core defense-related enzymes, such as PAL, PPO, CAT, and POD activities by 4.27, 1.77, 3.53, and 1.57-fold, respectively, over control. Moreover, the results of qRT-PCR exhibited an upregulation of genes OsPR1, OsPR10, OsWRKY45, OsWRKY62, OsWRKY71, OsHI-LOX, and OsACS2 after 24 h of inoculation with all tested Trichoderma strains. However, in the case of RT-PCR, no major changes in OsPR1 and OsPR10 expression were observed in plants treated with different Trichoderma strains during different courses of time. Collectively, Trichoderma induced resistance in rice against X. oryzae pv. oryzae by triggering these core defense-related enzymes and genes associated with SA and JA pathways.

1. Introduction

Rice (Oryzae sativa L.) is one of the major cereal crops belonging to the Poaceae family, especially in Asian countries including China, India, Bangladesh, Thailand, and Vietnam [1,2]. With a constantly rising production of 3.6 crore tons of rice, Bangladesh stands in the third position globally in rice production after China and India [3]. However, bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae (Xoo) is among the thirty-two rice diseases reported in Bangladesh, which can cause 5.8–30.4% yield loss depending on the crop stage and environmental factors [4,5]. For systemic bacterial blight infection, X. oryzae pv. oryzae enters the rice leaf generally by wounds or water pores of wavy leaf edges, multiplies in the intercellular spaces of the underlying epithelial tissues, and then moves to the xylem vessels [6].“Within a few days bacterial cells and EPS fill the xylem vessels and ooze out from hydathodes, forming beads or strands of exudate on the leaf surface, a characteristic sign of the disease and a source of secondary inoculum” [7].
Chemical management, biological control, and genetic resistance have all been used to manage bacterial leaf blight disease in rice plants. Despite the fact that the rising population encourages the use of more chemical inputs, such management strategies are not rewarding due to their adverse effect on the consumers, ecosystem, land productivity, and the variable susceptibility of different pathogenic races to the chemicals used to control them [8,9,10]. This study aimed to develop environment-friendly sustainable control measures against the bacterial blight of rice. A good number of Trichoderma strains have been found to be effective as biocontrol agents against X. oryzae pv. oryzae under greenhouse and field conditions [11,12,13]. Recently, Mishra et al. have shown that T. atroviride induces rice plant growth and suppresses the in vitro growth of X. oryzae pv. oryzae [14]. The mechanism by which Trichoderma induces resistance against biotic and abiotic stresses is through the direct release of certain chemical compounds, antibiotics, lytic enzymes, and hormones, or indirectly by competing for a niche or nutrients and inducing systemic resistance (ISR) [11,15,16,17]. Studies have shown that talc-based powder formulations of Trichoderma were used for field evaluation and showed a significant result in controlling BB of rice [18,19].
The pathogenicity of X. oryzae pv. oryzae largely depends on the coordinated expression of host-induced genes/proteins, including systemic signals such as salicylic acid (SA) and jasmonic acid (JA) in vivo and in vitro [20,21]. Recent studies showed that Trichoderma sp. induces systemic acquired resistance (SAR) through SA, and induced systemic resistance (ISR) through JA and ethylene (ET) signal pathways, which are associated with the activation of plant defense mechanisms [22,23,24,25,26]. These mechanisms include changes in biochemistry [27], activation of multiple defense-related enzymes [28], and induction of pathogenesis-related (PR) proteins [29]. Peroxidase (POD) is one of the fast-responding defense-related enzymes against plant pathogens which are precisely involved in lignification, suberification, polymerization of hydroxyproline-rich glycoproteins, regulation of cell wall elongation, wound healing, and resistance against pathogens in plants [28,30]. Catalase (CAT) is an oxygen-scavenging enzyme that protects cells from the toxic effects of H2O2 during development by converting it to water and molecular oxygen [31,32]. Polyphenol oxidase (PPO) is an enzyme in plants that regulates feeding and growth, and plays a major role in plant defense against biotic and abiotic stresses [33]. Phenylalanine ammonia-lyase (PAL) appears to be one of the vital elements of ISR, the biosynthesis of SA, an essential signal involved in induced systemic resistance [34], and plays a significant role in the synthesis of several defense-related secondary compounds such as phenols and lignin [35,36]. Therefore, Trichoderma can induce plant resistance through ISR, which further increases the activity of the POD, PPO, CAT, and PAL enzymes in rice leaves [37,38,39,40,41].
An important characteristic of induced resistance is the phenomenon of priming, in which rice plants exhibit a more rapid and elevated expression of defense responses upon bacterial pathogen infection compared to untreated rice plants [42]. As part of induced resistance, systemic signals such as SA and JA influence the pathogen’s virulence machinery. Studies reported that the OsPR1, OsPR10, OsWRKY45, OsWRKY62, OsWRKY71, OsHI-LOX, and OsACS2 genes relevantly upregulated in rice plants were found to develop resistance to X. oryzae pv. oryzae [20,41,43,44,45,46,47,48,49]. However, OsPR1 and OsPR10 are well-known pathogenesis-related genes of rice that are induced by high SA levels [50,51]. In addition, the rice genome contains more than 100 WRKY genes, and OsWRKY45, OsWRKY62, and OsWRKY71 play important roles in the monitoring of genes involved in pathogen-induced defense responses [52,53,54,55,56]. BB resistance tests also showed that OsACS2 (1-aminocyclopropane-1-carboxylic acid synthase) is a key enzyme of ET biosynthesis under the control of a strong pathogen-inducible promoter. Trichoderma activates the octadecanoic pathway in plant roots with Lox1 being activated immediately, which apparently leads to the production of JA signals [38]. However, this present study was carried out to evaluate the potentiality of Trichoderma isolates in controlling BB of rice. Moreover, we assessed the expression patterns of several core defense-related enzymes and genes which are related to SA and JA pathways to explore the mechanism of induced systemic resistance by Trichoderma strains in controlling X. oryzae pv. oryzae.

2. Results

2.1. Antagonistic Activity of Some Fungal Isolates against X. oryzae pv. oryzae

A total of 200 fungal isolates were isolated and purified from the rice rhizosphere. Out of these, four fungal isolates, viz., BDISOF67R, BDISOF91R, BDISOF08R, and BDISOF09R, were identified as antagonists against X. oryzae pv. oryzae (Figure 1A) that inhibited the growth of X. oryzae pv. oryzae by 67.51%, 52.19%, 24.06%, and 23.33%, respectively, over control (Figure 1B).

2.2. Molecular Identification of Fungal Isolates BDISOF67R, BDISOF91R, BDISOF08R, and BDISOF09R

Fungal isolates BDISOF67R, BDISOF91R, BDISOF08R, and BDISOF09R were identified by PCR amplification of the internal transcribed spacer (ITS) region using ITS-1 and ITS-4 primers and PCR products were then sequenced. The results of PCR showed an amplification size of 600 bp and confirmed that the antagonist organisms are fungi (Figure 2).
Analysis of sequencing data of the amplified ITS region using BLAST program revealed that BDISOF67R, BDISOF91R, BDISOF08R, and BDISOF09R showed the highest homology with Trichoderma paraviridescens strain 36114DRJ (accession #MF782827.1), Trichoderma erinaceum strain QT22079 (accession #KY225644.1), Trichoderma asperellum bio-material USM (accession #KU878976.1), and Trichoderma asperellum isolate 20B (accession #MZ044276.1), which confirmed that the fungal species are Trichoderma paraviridescens (BDISOF67R) (accession # OP456159), Trichoderma erinaceum (BDISOF91R) (accession # OP456160), Trichoderma asperellum (BDISOF08R) (accession # OP456157), and Trichoderma asperellum (BDISOF09R) (accession # OP456158), respectively (Table 1).

2.3. Effect of Some Selected Antagonistic Trichoderma Isolates on the Reduction of Lesion Length in Susceptible Check Cultivar (IR24) Caused by X. oryzae pv. oryzae

The results of plant inoculation (rice seeds first treated with Trichoderma formulations and then foliar application of Trichoderma spp.) showed a significant reduction of lesion length in plants sprayed with formulated Trichoderma spp. as compared with untreated control (Figure 3; Table 2).
The minimum (3.83 mm) lesion length was observed in plants sprayed with BDISOF08 (T. asperellum), followed by BDISOF67 (T. paraviridescens) (5.50 mm), BDISOF91 (T. erinaceum) (10.83 mm), and BDISOF09 (T. asperellum) (15.50 mm), while the maximum (87%) reduction of lesion length was observed in plants sprayed with BDISOF08 (T. asperellum), followed by BDISOB45R (T. paraviridescens) (75.00%), and BDISOF91 (T. erinaceum) (60.42%). The minimum (31.25%) reduction of lesion length was observed in plants sprayed with BDISOF09 (T. asperellum).

2.4. Differential Expression of Some Defense-Related Enzymes in Rice Induced by Selected Trichoderma Isolates in Response to X. oryzae pv. oryzae

2.4.1. Effect of Selected Trichoderma Isolates on Phenylalanine Ammonia-Lyase (PAL) Activity in Response to X. oryzae pv. oryzae

As Table 3 shows, plants treated with BDISOF67 (T. paraviridescens) showed the maximum (609 μmol transcinnamic acid min−1 g−1 protein) PAL activity at 48 HAI, while the minimum (527 μmol transcinnamic acid min−1 g−1 protein) PAL activity was recorded at 72 HAI, which were 2.55 and 3.33 times higher over control, respectively.
On the other hand, the maximum (647 μmol transcinnamic acid min−1 g−1 protein) PAL activity was recorded for plants treated with BDISOF91 (T. erinaceum) at 72 HAI, while the minimum (555 μmol transcinnamic acid min−1 g−1 protein) PAL activity was at 48 HAI, which showed 4.05 and 2.32 times more PAL activity over control, respectively. However, plants treated with BDISOF08 (T. asperellum) showed the maximum (706 μmol transcinnamic acid min−1 g−1 protein) PAL activity at 24 HAI, while the minimum (530 μmol transcinnamic acid min−1 g−1 protein) PAL activity was recorded at 72 HAI, which were 2.85 and 3.32 times higher over control, respectively. Lastly, plants treated with BDISOF09 (T. asperellum) accounted for the maximum (682 μmol transcinnamic acid min−1 g−1 protein) PAL activity at 72 HAI, while the minimum (556 μmol transcinnamic acid min−1 g−1 protein) PAL activity was recorded at 24 HAI, which demonstrated 4.27 and 2.25 times higher PAL activity over control, respectively.

2.4.2. Influence of Selected Trichoderma Isolates in Induction of Catalase (CAT) Activity in Response to X. oryzae pv. oryzae

From Table 4, plants treated with BDISOF67 (T. paraviridescens) showed the maximum (273 µmol H2O2 min−1 g−1) CAT activity at 24 HAI, while the minimum (162 µmol H2O2 min−1 g−1) CAT activity was recorded at 72 HAI, which were 5.46 and 1.34 times higher over control, respectively.
On the other hand, the maximum (264 µmol H2O2 min−1 g−1) CAT activity was recorded for plants treated with BDISOF91 (T. erinaceum) at 24 HAI, while the minimum (118 µmol H2O2 min−1 g−1) CAT activity was at 48 HAI, which showed 5.28 and 0.98 times more CAT activity over control, respectively. However, plants treated with BDISOF08 (T. asperellum) showed the maximum (201 µmol H2O2 min−1 g−1) CAT activity at 144 HAI, while the minimum (59 µmol H2O2 min−1 g−1) CAT activity was recorded at 72 HAI, which were 1.94 and 0.49 times higher over control, respectively. Lastly, plants treated with BDISOF09 (T. asperellum) accounted for the maximum (367 µmol H2O2 min−1 g−1) CAT activity at 144 HAI, while the minimum (78 µmol H2O2 min−1 g−1) CAT activity was recorded at 72 HAI, which demonstrated 3.53 and 0.64 times higher CAT activity over control, respectively.

2.4.3. Effect of Selected Trichoderma Isolates in Induction of Polyphenoloxidase (PPO) Activity in Response to X. oryzae pv. oryzae

As is illustrated by Table 5, plants treated with BDISOF67 (T. paraviridescens) showed the maximum (454 units g−1 min−1 FW) PPO activity at 24 HAI, while the minimum (247 units g−1 min−1 FW) PPO activity was recorded at 72 HAI, which were 1.77 and 1.55 times higher over control, respectively.
On the other hand, the maximum (434 units g−1 min−1 FW) PPO activity was recorded for plants treated with BDISOF91 (T. erinaceum) at 24 HAI, while the minimum (271 units g−1 min−1 FW) PPO activity was at 72 HAI, which showed 0.95 and 1.7 times more PPO activity over control, respectively. However, plants treated with BDISOF08 (T. asperellum) showed the maximum (428 units g−1 min−1 FW) PPO activity at 24 HAI, while the minimum (222 units g−1 min−1 FW) PPO activity was recorded at 144 HAI, which were 0.98 and 0.82 times higher over control, respectively. Lastly, plants treated with BDISOF09 (T. asperellum) accounted for the maximum (403 units g−1 min−1 FW) PPO activity at 24 HAI, while the minimum (284 units g−1 min−1 FW) PPO activity was recorded at 48 HAI, which demonstrated 0.94 and 1.19 times higher PPO activity over control, respectively.

2.4.4. Influence of Selected Trichoderma Isolates in Induction of Peroxidase (POD) Activity in Response to X. oryzae pv. oryzae

Table 6 indicates that plants treated with BDISOF67 (T. paraviridescens) showed the maximum (1751 units min−1 g−1 FW) POD activity at 144 HAI, while the minimum (850 units min−1 g−1 FW) POD activity was recorded at 24 HAI, which were 1.47 and 1.12 times higher over control, respectively.
On the other hand, the maximum (1866 units min−1 g−1 FW) POD activity was recorded for plants treated with BDISOF91 (T. erinaceum) at 144 HAI, while the minimum (831 units min−1 g−1 FW) POD activity was at 24 HAI, which showed 1.57 and 1.09 times more POD activity over control, respectively. However, plants treated with BDISOF08 (T. asperellum) showed the maximum (1809 units min−1 g−1 FW) POD activity at 144 HAI, while the minimum (697 units min−1 g−1 FW) POD activity was recorded at 72 HAI, which were 1.52 and 0.69 times higher over control, respectively. Lastly, plants treated with BDISOF09 (T. asperellum) accounted for the maximum (1704 units min−1 g−1 FW) POD activity at 72 HAI, while the minimum (762 units min−1 g−1 FW) POD activity was recorded at 48 HAI, which demonstrated 1.69 and 1.06 times higher POD activity over control, respectively.

2.5. Differential Expression of Some SA and JA Pathway Related Genes in Plants Treated with Trichoderma

2.5.1. Expression Levels of Some Selected Defense Related Genes Involved in Salicylic (SA) and Jasmonic (JA) Acid Pathways by RT-PCR

No major changes in OsPR1 and OsPR10 expression were observed in plants treated with different Trichoderma strains as compared with untreated and positive control at 144 HAI (Figure 4).
However, when BDISOF67 (T. paraviridescens), BDISOF91 (T. erinaceum), BDISOF08 (T. asperellum), and BDISOF09 (T. asperellum) were sprayed on plants, levels of OsWRKY45, OsWRKY62, and OsWRKY71 expression were found to be elevated at 144 HAI as compared with untreated and positive control (Figure 4). Furthermore, there was an increase in OsACS2 and OsHI-LOX expression in plants sprayed with T. paraviridescens (BDISOF67) and T. asperellum (BDISOF09) at 144 HAI (Figure 4). However, plants treated with T. erinaceum (BDISOF91) did not show any expression of OsHI-LOX genes at 144 HAI, but were found to be elevated in the case of OsACS2 genes at 144 HAI as compared with untreated control (Figure 4). On the other hand, OsHI-LOX expression level was found to be elevated at 144 HAI when plants were treated with T. asperellum (BDISOF08) as compared to untreated control, but did not get expressed in the case of OsACS2 genes at the same period (Figure 4). To summarize, these results primarily indicated that Trichoderma spp. reduced bacterial blight severity in rice by inducing the expression of some selected SA and JA pathway-related genes (Figure 4).

2.5.2. Expression Levels of Some Selected Defense-Related Genes Involved in Salicylic (SA) and Jasmonic (JA) Acid Pathways by Real-Time PCR (q-PCR)

OsPR1 showed maximum (2.6) levels of relative expression when plants were treated with BDISOF91 (T. erinaceum), followed by BDISOF67 (T. paraviridescens), BDISOF08 (T. asperellum), and BDISOF09 (T. asperellum) at 144, 72, 24, and 24 HAI, respectively, as compared to control (Figure 5A). The highest (6.63) expression of OsPR10 was recorded in BDISOF91 (T. erinaceum), followed by BDISOF08 (T. asperellum), BDISOF09 (T. asperellum), and BDISOF67 (T. paraviridescens) at 48, 48, 24, and 24 HAI, respectively, as compared to control (Figure 5B). On the other hand, OsWRKY45 showed maximum (7.91) levels of relative expression when plants were treated with BDISOF67 (T. paraviridescens), BDISOF09 (T. asperellum), BDISOF08 (T. asperellum), and BDISOF91 (T. erinaceum) at 24 HAI for each treatment as compared to control (Figure 5C), while the highest (2.98) expression of OsWRKY62 was recorded in BDISOF91 (T. erinaceum), followed by BDISOF09 (T. asperellum), BDISOF08 (T. asperellum), and BDISOF67 (T. paraviridescens) at 144, 24, 24, and 144 HAI, respectively, as compared to control (Figure 5D). Moreover, OsWRKY71 showed maximum (6.69) levels of relative expression when plants were treated with BDISOF91 (T. erinaceum), followed by BDISOF09 (T. asperellum), BDISOF67 (T. paraviridescens), and BDISOF08 (T. asperellum) at 24 HAI for each treatment as compared to control (Figure 5E). The highest (6.54) expression of OsHI-LOX was recorded in BDISOF08 (T. asperellum), followed by BDISOF09 (T. asperellum), BDISOF91 (T. erinaceum), and BDISOF67 (T. paraviridescens) at 24 HAI for each treatment as compared to control (Figure 5F). Furthermore, OsACS2 showed maximum (4.81) levels of relative expression when plants were treated with BDISOF67 (T. paraviridescens), followed by BDISOF08 (T. asperellum), BDISOF09 (T. asperellum), and BDISOF91 (T. erinaceum) at 48 HAI for each treatment as compared to control (Figure 5G). These results could somewhat indicate the systemic protection of rice plants against X. oryzae pv. oryzae due to the induction of resistance by different Trichoderma strains, and an increase in the above defense-related genes related to the SA and JA pathways.

3. Discussion

Rhizosphere microorganisms that are beneficial to plants can greatly enhance their resistance to pathogens by inducing the production of defense genes and proteins [11,15,39,40,57]. Trichoderma isolates in plants have been shown to protect plants from biotic stressors by, among other mechanisms, inducing systemic resistance, programmed cell death, triggering signaling cascades, callose deposition, induction of phytoalexins and other secondary metabolites, and producing antibacterial reactive oxygen species [13,58,59,60]. The findings of this study show that when infected with X. oryzae pv. oryzae, rice plants primed with beneficial Trichoderma strains had higher activity of defense-related enzymes and genes related to SA and JA pathways in leaves compared to control plants.
In the current study, the lesion length of rice leaves was reduced, ranging from 31.25% (BDISOF09: T. asperellum) to 87.5% (BDISOF08: T. asperellum) in plants treated with Trichoderma isolates. This significant reduction in lesion development in the in vitro pathogenicity assay signifies that the rice plants primed with Trichoderma successfully protected against the development of bacterial blight disease. The findings of this study correlate with the reports from Jambhulkar et al., Gangwar (2013), and Manmeet and Thind, who reported that Trichoderma species were found to reduce the lesion length as well as the severity of bacterial blight diseases in rice plants [18,19,61]. However, Divya et al. revealed that a T. asperellum isolate was 17.20% more effective in controlling lesion length development than T. atroviride [57]. Meanwhile, T. harzianum was found to be the best in managing bacterial blight, giving 52.66% and 26.66% reduction in disease severity and incidence, respectively [62]. In another study, Kariuki et al. found that Trichoderma isolate T1 was found to be the most effective in reducing bacterial wilt incidence by more than 61.66% compared to the control [63]. Interestingly, T. paraviridescens (BDISOF67) and T. erinaceum (BDISOF91) were able to significantly reduce the radial growth of X. oryzae pv. oryzae before coming in direct contact with Trichoderma strains. This might be because of the fact that Trichoderma strains release antimicrobial compounds in the medium, which in turn reduces or stops the multiplication rate of X. oryzae pv. oryzae in vitro [11,64,65,66]. A similar report by Gangwar and Sinha demonstrated that Trichoderma spp. was able to inhibit the radial growth of X. oryzae pv. oryzae at a maximum of 100% [13]. As stated by Kannan et al., among different isolates of Trichoderma, TAIK 1 was found to significantly inhibit more than 40% growth of X. oryzae pv. oryzae in vitro [8]. A similar trend was observed by Rubio et al., who revealed that T. parareesei showed antagonistic action against Pythium irregulare due to its production of cellulolytic enzymes, which break down the cellulose-based cell walls of the fungus [67].
A key discovery of this research is the mechanism by which Trichoderma strains reduce the bacterial blight of rice by inducing resistance against X. oryzae pv. oryzae. We noticed an enhanced activity of defense-related enzymes, viz. PAL, CAT, PPO, and POD, in rice on seed priming with Trichoderma strains. Upregulation of these enzymes leads to the production of signaling molecules, like SA and JA, and metabolites with defense functions, including phenols, phytoalexins, lignin, as well as flavonoids, and antimicrobial activities in plants [34,59,68,69]. Our results show PAL activity was upregulated a maximum of four times over control at 72 HAI when plants were treated with T. erinaceum and T. asperellum. These findings, on the whole, are in agreement with the findings of [39,70,71,72]. Enhanced activity of defense-related enzymes was also reported by Adss et al., who showed that POD, PPO, and PAL activity were significantly increased over control in all treatments after treating A. solani with T. harzianum [37]. Similar outcomes were observed while inducing the activity of PPO and POD in chickpeas [22] and rice [40] treated with T. harzianum and Bacillus spp., respectively, against Sclerotium rolfsii and Pyricularia oryzae infection. Mei et al. discovered that cucumbers treated with Trichoderma strains against Fusarium wilt had a higher CAT expression level [73]. In contrast, plants inoculated with T. asperellum for this study expressed elevated levels of catalase enzyme in leaves at 24 HAI over control, which coincides with Samal et al., who reported that biopriming with T. erinaceum resulted in reduced bacterial blight by inducing CAT activity in rice against X. oryzae pv. oryzae [38]. These findings clearly support that PAL, CAT, PPO, and POD activity might be significant enzymes for the induction of disease resistance to X. oryzae pv. oryzae in rice plants. The next step of our research is to investigate the expression of other defense-related enzymes in rice plants treated with Trichoderma strains.
RT-PCR was employed in this study to evaluate the expression patterns of several defense-related genes (OsPR1, OsPR10, OsWRKY45, OsWRKY62, OsWRKY71, OsHI-LOX, and OsACS2) that were reported to be induced by niclosamide, a chemical inducer in rice plants treated with different Trichoderma strains [41]. Our results clearly indicate that the expression of the genes, viz., OsWRKY45, OsWRKY62, OsWRKY71, OsHI-LOX, and OsACS2, were significantly higher at 144 HAI after X. oryzae pv. oryzae infection, in contrast to other time course expressions, suggesting that they might be responsible for the enhanced resistance to bacterial blight in rice plants. No major changes in OsPR1 and OsPR10 expression were observed in plants treated with different Trichoderma strains, indicating that these genes might not be primarily responsible for the enhanced resistance of rice plants to bacterial blight. These results are consistent with those reported by [41,46,49,67,74]. Meanwhile, Contreras-Cornejo et al. revealed that the expression of Lox2 A genes in response to T. virens or T. atroviride indicated the involvement of SA and/or JA pathways in the defense signaling pathway activated by those fungi [49]. However, our analysis revealed an antagonistic relationship between the genes of the SA and JA synthesis pathways, in which the presence of OsHI-LOX and OsACS2 in the JA assay suppressed the expression of OsPR1 and OsPR10 in the SA assay. This strategy is backed up by Mur et al., who reported that SA and JA act antagonistically when used in higher concentrations [75]. In contrast, De Vleesschauwer et al. developed a model that shows how SA and JA pathways might combine to form a shared defense mechanism that is effective against various sorts of invaders [76].
Confirmation through the endpoint of qRT-PCR complements the expression of defense-related genes involved in SA and JA acid pathways as the maximum expression after 24 h of inoculation with all tested Trichoderma strains. This strategy is also supported by Ding et al., who showed that PR-1.1 was induced in response to treatments with SA or methyl jasmonate (MeJA), while PR3 and LOX2 responded positively to MeJA treatment after 24 h [47]. In addition, overexpression of LOX genes has been demonstrated to be necessary for giving resistance to diseases caused by bacteria [44,45,77]. In another study, Uji et al. stated that the Trichoderma strain induced the expression of Lox1 genes against the rice bacterial blight pathogen X. oryzae pv. oryzae [78]. In our study, higher levels of expression of the OsWRKY45, OsWRKY62, and OsWRKY71 genes were observed in plants raised from treated seeds and sprayed with different Trichoderma strains. These findings are totally in agreement with Kim et al., who demonstrated that niclosamide blocks the development of rice leaf blight by inducing the expression of defense-related genes, including OsPR1, OsPR10, OsWRKY45, OsWRKY62, OsWRKY71, OsHI-LOX, and OsACS2 [38]. However, some studies show that multiple members of the WRKY gene family involved in JA response pathways, such as WRKY, bZIP [20], OsWRKY80, OsWRKY4 [48], OsWRKY9, OsWRKY45, OsWRKY5, OsWRKY28, OsWRKY29 [79], WRKY18, WRKY40 [80], and OsWRKY45 [81] activated the defense response in the interaction with the beneficial fungus Trichoderma species on susceptible rice plants. Together with the findings, we support that rice plants treated with beneficial Trichoderma species can significantly induce resistance against X. oryzae pv. oryzae by the up-regulation of defense-related enzymes and marker genes of the SA and JA pathways. Conversely, it would be interesting for our study to test the SA and JA levels in Trichoderma-treated rice plants.

4. Materials and Methods

4.1. Identification of Trichoderma Species Antagonistic to X. oryzae pv. oryzae

To identify the Trichoderma species antagonistic to X. oryzae pv. oryzae, rice plant samples with root systems were collected from 40 rice growing districts, representing 30 agro-ecological zones of Bangladesh. The Trichoderma species were then isolated following the dilution plate technique (up to 10−3 concentration) on PDA (Potato Dextrose Agar; Difco™) plates at a temperature of 28 °C. To assess the antagonistic activity of Trichoderma species against X. oryzae pv. oryzae, in vitro growth assay was performed as described by Tian et al. [82] with slight modifications. Briefly, X. oryzae pv. oryzae inocula were prepared from 48 h old cultures and a 100 µL bacterial cell suspension (1 × 108 cells/ml) was spread on NBY (Nutrient Broth Yeast) plates. A 5 mm mycelial block of Trichoderma species was then placed at the centre of the plate and incubated at 28 °C for 3 days. The growth inhibition of X. oryzae pv. oryzae by the isolates of Trichoderma as indicated by clear halo zones were then recorded and expressed in percentage over control using the following formula:
%   G r o w t h   I n h i b i t i o n = Diameter   of   fungal   colony   with   clear   halo   zone   −   Diameter   of   the   fungal   colony Diameter   of   fungal   colony   with   clear   halo   zone
The genomic DNA of these Trichoderma isolates was then extracted by using Wizard® Genomic DNA Purification Kit solution (Promega, Madison, WI, USA) according to the manufacturer’s instructions. PCR reactions were performed with the universal primer sets ITS 1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS 4 (5′TCCTCCGCTTATTGATATGC-3′) according to White et al. [83]. The PCR amplification was performed in a T100 thermal cycler (BioRed) using the initial denaturation at 95 °C for 5 min, denaturation at 95 °C for 30 s, annealing at 55 °C for 1 min, extension at 72 °C for 1 min for 35 cycles and final extension at 72 °C for 6 min. The molecular size of the resulting PCR product was analyzed on a 1.0% agarose gel. PCR-amplified internal transcribed spacer (ITS) regions were then subjected to partial nucleotide sequencing using forward primer ITS1 in the Macrogen Lab, South Korea, via Biotech Concern Bangladesh. The DNA sequences were then compared using the BLAST (Basic Local Alignment Search Tool) program to identify their closest relatives.

4.2. Formulation of Trichoderma Species, Seed Priming, and Foliar Spray of Formulated Trichoderma Species

A mycelial disc (5 mm diameter) of each Trichoderma isolate was inoculated in 100 mL PDB broth. The number of colony-forming units was counted after 7 days. The mycelial mat along with conidia from potato dextrose broth (PDB) was mixed thoroughly with autoclaved talcum powder pretreated with 0.5% carboxy methyl cellulose (CMC) (5 g CMC dissolved in 100 mL water mixed with 1 kg talcum powder). The mixture was air-dried in a laminar flow hood and kept in plastic bags at 30% moisture content. The formulated fungal antagonists were then kept at 4–8 °C in the refrigerator. The rice seeds of IR24 were then treated with Trichoderma formulations at 10 g per kg rice seeds for half an hour. Treated seeds were sown in the earthen pots, and then 30 days old seedlings were transplanted in the pot following a completely randomized design (CRD) with 3 replications. The Trichoderma formulations were then sprayed at 40, 50, 65, and 75 days after transplanting (DAT). Formulated fungal powders were suspended in water to prepare the fungal solution at 0.5%, i.e., 5 g/L water and sprayed on the plant surface with the help of a sprayer.

4.3. Inoculation of Rice Plants with X. oryzae pv. oryzae

The X. oryzae pv. oryzae was cultured in NBY agar medium at 28 °C for 48 h and then resuspended in sterile distilled water at a cell density of 5 × 108 cells/ml measured by Spectrophotometer. The leaves of each hill in each replication were inoculated by the clip-inoculation method of Kauffman [84]. Artificial inoculation of X. oryzae pv. oryzae was done at 60 DAT. After inoculating, the pots were transferred to an artificial growth chamber maintaining temperature (28 °C) and relative humidity (90%). Data was collected on lesion length at 7, 14, and 21 days after inoculation (DAI). The best or potential Trichoderma antagonistic to X. oryzae pv. oryzae was identified by the data analysis.

4.4. Expression Analysis of Some Defense-Related Enzymes in Rice in Response to X. oryzae pv. oryzae

Ten rice leaf samples for each treatment were collected at 24, 48, 72, and 144 h after inoculation (HAI) in zipper bags. The collected leaf samples were frozen with liquid nitrogen and ground into powder for either RNA extraction immediately, or the ground samples were stored at −80 °C for future use. Then, to explore the mechanism of Trichoderma mediated induced resistance in rice against X. oryzae pv. oryzae, the activities of core defense-related enzymes, viz., PAL, CAT, PPO, and POD, were assessed.

4.4.1. Phenylalanine Ammonia-Lyase (PAL)

The PAL activity was analyzed at 290 nm wavelength by measuring the conversion of L-phenylalanine into ammonia and trans-cinnamic acid [85]. For this, 1 g rice leaves was homogenized in 5 mL of 0.1 M borate buffer, pH 7.0, containing 0.1 g polyvinyl polypyrrolindone (PVP) at 4 °C with a pestle and mortar. The homogenate was centrifuged at 10,000× g for 30 min at 4 °C. The supernatant was collected and used in the enzyme assay. The reaction mixture included 0.4 mL of enzyme extract, 0.5 mL of 0.1 M borate buffer (pH 8.8), and 0.5 mL of 12 nm L-phenylalanine in the same buffer. The reaction mixture was incubated at 30 °C for 30 min in a water bath. The reference cell was 0.4 mL of enzyme extract and 1.0 mL of borate buffer. The amount of trans-cinnamic acid synthesized was calculated using its absorption coefficient of 9630 µmol s−1 g−1.

4.4.2. Catalase (CAT)

To study the CAT activity, the decreased amount of hydrogen peroxide (H2O2) was determined at 240 nm wavelength [86]. “The CAT assay mixture of 3 mL consisted of 0.05 mL extract, 1.5 mL phosphate buffer (100 mM buffer, pH 7.0), 0.5 mL H2O2, and 0.95 ml distilled water. A decrease in the absorbance was recorded at 240 nm. The CAT activity was expressed as μmol of H2O2 oxidized per minute per gram FW”.

4.4.3. Polyphenol Oxidase (PPO)

The PPO was determined at 280 nm wavelength using L-tyrosine as the substrate [87]. For this, 0.5 mL of leaf extracts were used for the PPO (catechol oxidase) assay. It was mixed with 250 μL of 50 mM sodium phosphate buffer. The rate of increase in absorbance at 525 nm was measured for 2 min after the addition of 500 μL 0.1 M catechol. The OD525 was measured using a T80 UV/VIS Spectrophotometer (pg instruments). There were 3 replications for each sample. One unit of the enzyme was defined as the amount of enzyme that increases the OD525 value by 0.01.

4.4.4. Peroxidase (POD)

The POD was assayed using guaiacol as a substrate at 470 nm wavelength and expressed as changes in absorbance min−1 g−1 fresh wt of tissue [88]. Rice leaves (1 g) were homogenized in 5 mL 0.1M phosphate buffer (pH 7.0) at 4 °C. Then it was centrifuged at 10,000× g for 20 min at 4 °C and supernatant was collected. In a sample cuvette of the spectrophotometer, 1.5 mL of 0.05M pyrogallol and 0.1 mL of enzyme extract were added. The absorbance reading will be adjusted to zero at 420 nm in the T80 UV/VIS Spectrophotometer (pg instruments). To initiate the reaction, 0.1 mL of 1% H2O2 was added to the sample cuvette. The changes in absorbance were recorded at 30 s intervals.

4.5. Assessment of Differential Expression in Plants Treated with Trichoderma

To study the Salicylic acid (SA) and Jasmonic acid (JA) pathway-mediated induced resistance in rice by Trichoderma, a susceptible check variety (IR24) was used. Seven genes were selected for their induced expression by Trichoderma which were shown to be induced resistance in rice against BB.

4.6. RNA Extraction and cDNA Synthesis

Total RNA was extracted from 30–50 mg of ground rice leaf tissues using the kit SB total RNA isolation system (Promega, Madison, WI, USA) according to the manufacturer’s instructions. First-strand complementary DNA was then synthesized using 5 μg of total RNA using Go-script reverse transcriptase (Promega, Madison, WI, USA) and primers [Oligo(dT) 15 (0.5 µg/reaction) and/or Random Primer (0.5 µg/reaction) or gene-specific primer (10–20 pmol/reaction)]. The following procedures were carried out: primer annealing at 25 °C for 5 min, DNA polymerization at 42 °C for up to 1 h, and deactivation of reverse transcriptase at 70 °C for 15 min.

4.7. Primer and Reverse Transcription (RT)-PCR

RT-PCR was performed using Hot-start Go Taq master mix (Promega, Madison, WI, USA) following the instruction of the kit’s manual. The following primers (Table 7) were used for the analyses of the expression of some selected marker genes of SA and JA pathways.
The PCR amplification reaction was performed under the following thermal cycling conditions: 95 °C for 10 min, 45 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 10 s. The expression level of different defense-related genes was compared based on the intensity of the band as compared with the untreated control. The 18S rRNA gene was used as the internal control. The following primers were used (Table 7).

4.8. Real-Time qPCR Assay

The q-PCR assay was performed using Luna q-PCR universal master mix (New England Biolab, London, UK). PCR reaction mix contained Luna universal q-PCR (4.5 µL), forward primer 0.25 µL (10 µm), reverse primer 0.25 µL (10 µm), template cDNA 1 µL, and nuclease-free water 4.0 µL were used for quantification of relative expression. The PCR conditions were as follows: initial denaturation was done at 95 °C for 60 s in one cycle. The denaturation was done at 95 °C for 15 s, extension at 60 °C for 30 s in 40–45 cycles, annealing at 60 °C for 10 s, and melt curve for 60–95 °C for various seconds in one cycle. The relative expression was calculated using the following formula: Relative   expression   value = 2 − Δ Δ C T [89]. CT value of the target gene was normalized using the CT value of 18S rDNA.

4.9. Statistical Analysis

The data were subjected to analysis of variance, and Duncan’s multiple range test was used to differentiate means at 5%. The error bars in all figures indicate the standard error of the mean. For data analysis, Minitab (version 17) software was used.

5. Conclusions

Our study offers a glimpse into the molecular mechanism of Xoo-rice interactions with Trichoderma isolates, and reveals the upregulated expression of the selected defense related enzymes and genes related to the SA and JA pathways. Based on the key findings, Trichoderma mediated induced resistance in rice against Xoo was summarized using the following proposed model (Figure 6).
In this proposed model (Figure 6), Trichoderma triggers the SA and JA pathways and enhances the expression of some SA and JA responsive genes, and thus induced resistance in rice against Xoo. All four Trichoderma strains used in this study also enhance the expression of WRKY factors which might be either SA/JA-dependent or independent (Figure 6). However, expression levels of PR1 and PR10 genes primarily indicated a weak antagonism of SA and JA pathways in rice against Xoo (Figure 6). Therefore, an RNA-seq study is required to understand the underlying mechanisms by which these Trichoderma strains promote induced system resistance (Figure 6).

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants12091864/s1.

Author Contributions

Conceptualization, M.R.I.; Methodology, M.R.I., M.N.I., A.S.R., R.C., M.H. and M.A.A.; Software, M.N.I. and M.M.M.; Validation, M.R.I.; Formal Analysis, M.R.I., M.N.I., A.S.R. and R.C.; Investigation, M.R.I., M.N.I., A.S.R. and R.C.; Resources, M.R.I.; Data Curation, M.N.I., A.S.R. and R.C.; Writing—Original Draft Preparation, M.M.M. and M.N.I.; Writing—Review and Editing, M.R.I., R.A.R., S.B., P.S., M.M.M., M.H., M.Z.A., M.A.L. and M.A.A.; Visualization, M.M.M., P.S.; Supervision, M.R.I.; Project Administration, M.R.I.; Funding Acquisition, M.R.I. All authors have read and agreed to the published version of the manuscript.

Funding

This research work was financially supported by Program Based Research Grant (PBRG), National Agricultural Technology-2 (NATP-2), BARC, Farmgate, Dhaka granted to Md. Rashidul Islam (ID No: 091), a World Bank and IFAD Funded Project, and “The article processing charge (APC) was funded by all the authors”.

Data Availability Statement

The data is contained within the article and the Supplementary Materials.

Conflicts of Interest

The authors declare that there are no potential conflict of interest from any perspective.

References

  1. Vaughan, D.A.; Morishima, H.; Kadowaki, K. Diversity in the Oryza genus. Curr. Opin. Plant Biol. 2003, 6, 139–146. [Google Scholar] [CrossRef] [PubMed]
  2. Szareski, V.J.; Carvalho, I.R.; da Rosa, T.C.; Dellagostin, S.M.; de Pelegrin, A.J.; Barbosa, M.H.; dos Santos, O.P.; Muraro, D.S.; de Souza, V.Q.; Pedó, T. Oryza Wild Species: An alternative for rice breeding under abiotic stress conditions. Am. J. Plant Sci. 2018, 9, 1093. [Google Scholar] [CrossRef]
  3. BBS (Bangladesh Bureau of Statistics). 2020: Yearbook of Agricultural Statistics; 40th Series; Bureau of Statistics and Informatics Division (SID), Ministry of Planning, Government of the People ‘s Republic of Bangladesh: Dhaka, Bangladesh, 2020. [Google Scholar]
  4. Ansari, T.H.; Ahmed, M.; Akter, S.; Mian, M.S.; Latif, M.A.; Tomita, M. Estimation of rice yield loss using a simple linear regression model for bacterial blight disease. Bangladesh Rice J. 2019, 23, 73–79. [Google Scholar] [CrossRef]
  5. Haq, M.; Mia, M.A.T.; Rabbi, M.F.; Ali, M.A. Incidence and severity of rice diseases and insect pests in relation to climate change. In Climate Change and Food Security in South Asia; Lal, R., Sivakumar, M.V.K., Faiz, M.A., Rahman, A.H.M.M., Islam, K.R., Eds.; Springer: Dordrecht, The Netherlands, 2010; pp. 445–457. [Google Scholar]
  6. Niño-Liu, D.O.; Ronald, P.C.; Bogdanove, A.J. Xanthomonas oryzae pathovars: Model pathogens of a model crop. Mol. Plant Pathol. 2006, 7, 303–324. [Google Scholar] [CrossRef]
  7. Mew, T.W.; Alvarez, A.M.; Leach, J.E.; Swings, J. Focus on bacterial blight of rice. Plant Dis. 1993, 77, 5–12. [Google Scholar] [CrossRef]
  8. Chukwu, S.C.; Rafii, M.Y.; Ramlee, S.I.; Ismail, S.I.; Hasan, M.M.; Oladosu, Y.A.; Magaji, U.G.; Akos, I.; Olalekan, K.K. Bacterial leaf blight resistance in rice: A review of conventional breeding to molecular approach. Mol. Biol. Rep. 2019, 46, 1519–1532. [Google Scholar] [CrossRef]
  9. Yasmin, S.; Hafeez, F.Y.; Mirza, M.S.; Rasul, M.; Arshad, H.M.; Zubair, M.; Iqbal, M. Biocontrol of bacterial leaf blight of rice and profiling of secondary metabolites produced by rhizospheric Pseudomonas aeruginosa BRp3. Front Microbiol. 2017, 8, 1895. [Google Scholar] [CrossRef]
  10. Kumari, K.A.; Kumar, K.N.R.; Rao, C.N. Adverse effect of chemical fertilizers and pesticides on human health and environment. J. Chem. Pharmaceut. Sci. 2014, 31, 50–151. [Google Scholar]
  11. Kannan, C.; Mishra, D.; Rekha, G.; Maruthi, P.; Shaik, H.; Sundaram, R.M. Diversity analysis of antagonistic microbes against bacterial leaf and fungal sheath blight diseases of rice. Egypt. J. Biol. Pest Control. 2021, 31, 1–16. [Google Scholar] [CrossRef]
  12. Shobha, B.; Lakshmeesha, T.R.; Ansari, M.A.; Almatroudi, A.; Alzohairy, M.A.; Basavaraju, S.; Alurappa, R.; Niranjana, S.R.; Chowdappa, S. Mycosynthesis of ZnO nanoparticles using Trichoderma spp. isolated from rhizosphere soils and its synergistic antibacterial effect against Xanthomonas oryzae pv. oryzae. J. Fungi 2020, 6, 181. [Google Scholar] [CrossRef]
  13. Gangwar, G.P.; Sinha, A.P. Evaluation of Trichoderma spp. and fluorescent pseudomonads for the management of bacterial leaf blight of rice. Indian Phytopath. 2012, 65, 89–91. [Google Scholar]
  14. Mishra, D.; Rajeswari, B.; Rao, P.R.; Maheswari, T.U.; Kannan, C. Friendly microbes help rice to grow and suppress its pathogens: Trichoderma and Bacillus Vs Xanthomonas in rice. Environ. Conserv. J. 2021, 22, 197–209. [Google Scholar] [CrossRef]
  15. Jain, A.; Chatterjee, A.; Das, S. Synergistic consortium of beneficial microorganisms in rice rhizosphere promotes host defense to blight-causing Xanthomonas oryzae pv. oryzae. Planta 2020, 252, 1–25. [Google Scholar] [CrossRef] [PubMed]
  16. Abo-Elyousr, K.A.; Khalil Bagy, H.M.; Hashem, M.; Alamri, S.A.; Mostafa, Y.S. Biological control of the tomato wilt caused by Clavibacter michiganensis subsp. michiganensis using formulated plant growth-promoting bacteria. Egypt. J. Biol. Pest Control. 2019, 29, 1–8. [Google Scholar] [CrossRef]
  17. Wilson, M.; Lindow, S.E. Release of recombinant microorganisms. Annu. Rev. Microbial. 1993, 47, 913–944. [Google Scholar] [CrossRef] [PubMed]
  18. Jambhulkar, P.P.; Sharma, P.; Manokaran, R.; Lakshman, D.K.; Rokadia, P.; Jambhulkar, N. Assessing synergism of combined applications of Trichoderma harzianum and Pseudomonas fluorescens to control blast and bacterial leaf blight of rice. Eur. J. Plant Pathol. 2018, 152, 747–757. [Google Scholar] [CrossRef]
  19. Gangwar, G.P. Field efficacy of formulation of fungal bioagents against bacterial leaf blight of rice caused by Xanthomonas oryzae pv. oryzae (Uyeda and Ishiyama) Dowson. J. Appl. Nat. Sci. 2013, 5, 423–426. [Google Scholar] [CrossRef]
  20. Wu, G.; Zhang, Y.; Wang, B.; Li, K.; Lou, Y.; Zhao, Y.; Liu, F. Proteomic and Transcriptomic Analyses Provide Novel Insights into the Crucial Roles of Host-Induced Carbohydrate Metabolism Enzymes in Xanthomonas oryzae pv. oryzae Virulence and Rice-Xoo Interaction. Rice 2021, 14, 1–22. [Google Scholar] [CrossRef]
  21. Ryan, E.P.; Heuberger, A.L.; Weir, T.L.; Barnett, B.; Broeckling, C.D.; Prenni, J.E. Rice bran fermented with Saccharomyces boulardii generates novel metabolite profiles with bioactivity. J. Agric. Food Chem. 2011, 59, 1862–1870. [Google Scholar] [CrossRef]
  22. Singh, R.R.; Chinnasri, B.; De Smet, L.; Haeck, A.; Demeestere, K.; Van Cutsem, P.; Van Aubel, G.; Gheysen, G.; Kyndt, T. Systemic defense activation by COS-OGA in rice against root-knot nematodes depends on stimulation of the phenylpropanoid pathway. Plant Physiol. Biochem. 2019, 142, 202–210. [Google Scholar] [CrossRef]
  23. Kloepper, J.W.; Tuzun, S.; Liu, L.; Wei, G. Plant growth-promoting rhizobacteria as inducers of systemic disease resistance. Pest Manag. Biol. Based Technologies. Am. Chem. Soc. Books Wash. DC 1993, 156–165. [Google Scholar]
  24. Pieterse, C.M.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.; Bakker, P.A. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef] [PubMed]
  25. Sticher, L.; Mauch-Mani, B.; Métraux, A.J. Systemic acquired resistance. Annu. Rev. Phytopathol. 1997, 35, 235–270. [Google Scholar] [CrossRef]
  26. Kessler, A.; Halitschke, R.; Baldwin, I.T. Silencing the jasmonate cascade: Induced plant defenses and insect populations. Science 2004, 305, 665–668. [Google Scholar] [CrossRef] [PubMed]
  27. Van Loon, L.C. Plant responses to plant growth-promoting rhizobacteria. In New Perspectives and Approaches in Plant Growth-Promoting Rhizobacteria Research; Springer: Berlin/Heidelberg, Germany, 2007; pp. 243–254. [Google Scholar]
  28. Maksimov, I.V.; Valeev, A.S.; Cherepanova, E.A.; Burkhanova, G.F. Effect of chitooligosaccharides with different degrees of acetylation on the activity of wheat pathogen-inducible anionic peroxidase. Appl. Biochem. Microbiol. 2014, 50, 82–87. [Google Scholar] [CrossRef]
  29. van Loon, L.C.; Rep, M.; Pieterse, C.M. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef]
  30. Hammond-Kosack, K.E.; Jones, J.D.G. Resistance gene-dependent plant defense responses. Plant Cell Rep. 1996, 8, 1773. [Google Scholar]
  31. Choodamani, M.S.; Hariprasad, P.; Sateesh, M.K.; Umesha, S. Involvement of catalase in bacterial blight disease development of rice caused by Xanthomonas oryzae pv. oryzae. Int. J. Pest Manag. 2009, 55, 121–127. [Google Scholar] [CrossRef]
  32. Sofo, A.; Scopa, A.; Nuzzaci, M.; Vitti, A. Ascorbate peroxidase and catalase activities and their genetic regulation in plants subjected to drought and salinity stresses. Int. J. Mol. Sci. 2015, 16, 13561–13578. [Google Scholar] [CrossRef]
  33. Sharma, S.D.; Kumar, P.; Raj, H.; Bhardwaj, S.K. Isolation of arbuscular mycorrhizal fungi and Azotobacter chroococcum from local litchi orchards and evaluation of their activity in the air-layers system. Sci. Hortic. 2009, 123, 117–123. [Google Scholar] [CrossRef]
  34. Kim, D.S.; Hwang, B.K. An important role of the pepper phenylalanine ammonia-lyase gene (PAL1) in salicylic acid-dependent signalling of the defence response to microbial pathogens. J. Exp. Bot. 2014, 65, 2295–2306. [Google Scholar] [CrossRef] [PubMed]
  35. Hemm, M.R.; Rider, S.D.; Ogas, J.; Murry, D.J.; Chapple, C. Light induces phenylpropanoid metabolism in Arabidopsis roots. Plant J. 2004, 38, 765–778. [Google Scholar] [CrossRef]
  36. Tahsili, J.; Sharifi, M.; Safaie, N.; Esmaeilzadeh-Bahabadi, S.; Behmanesh, M. Induction of lignans and phenolic compounds in cell culture of Linum album by culture filtrate of Fusarium graminearum. J. Plant Interact. 2014, 9, 412–417. [Google Scholar] [CrossRef]
  37. Adss, I.A.; Amer, G.; Bayoumy, S.R.; Eid, R. Effect of abscisic acid, salicylic acid, potassium silicate, and Trichoderma harzianum as biocontrol agent to induce the tomato resistance against early blight disease caused by Alternaria solani. Alex. Sci. Exch. J. 2021, 42, 773–787. [Google Scholar] [CrossRef]
  38. Samal, P.; Mohapatra, P.K.; Naik, S.K.; Mukherjee, A.K. Improved photosystem II and defense enzymes activity in rice (Oryza sativa) by biopriming against Xanthomonas oryzae pv. oryzae. Funct. Plant Biol. 2020, 48, 298–311. [Google Scholar]
  39. Zhang, F.; Wang, Y.; Liu, C.; Chen, F.; Ge, H.; Tian, F.; Yang, T.; Ma, K.; Zhang, Y. Trichoderma harzianum mitigates salt stress in cucumber via multiple responses. Ecotoxicol. Environ. Saf. 2019, 170, 436–445. [Google Scholar] [CrossRef]
  40. Rais, A.; Jabeen, Z.; Shair, F.; Hafeez, F.Y.; Hassan, M.N. Bacillus spp., a bio-control agent enhances the activity of antioxidant defense enzymes in rice against Pyricularia oryzae. PLoS ONE 2017, 12, e0187412. [Google Scholar] [CrossRef]
  41. Kim, S.I.; Song, J.T.; Jeong, J.Y.; Seo, H.S. Niclosamide inhibits leaf blight caused by Xanthomonas oryzae in rice. Sci. Rep. 2016, 6, 1–13. [Google Scholar] [CrossRef]
  42. Conrath, U.; Beckers, G.J.; Flors, V.; García-Agustín, P.; Jakab, G.; Mauch, F.; Newman, M.A.; Pieterse, C.M.; Poinssot, B.; Pozo, M.J.; et al. Priming: Getting ready for battle. Mol. Plant-Microbe Interact. 2006, 19, 1062–1071. [Google Scholar] [CrossRef]
  43. Im, J.H.; Choi, C.; Park, S.R.; Hwang, D.J. The OsWRKY6 transcriptional cascade functions in basal defense and Xa1-mediated defense of rice against Xanthomonas oryzae pv. oryzae. Planta 2022, 255, 1–10. [Google Scholar] [CrossRef]
  44. Moon, H.; Jeong, A.R.; Kwon, O.K.; Park, C.J. Oryza-Specific Orphan Protein Triggers Enhanced Resistance to Xanthomonas oryzae pv. oryzae in Rice. Front. Plant Sci. 2022, 13, 859375. [Google Scholar] [CrossRef]
  45. Yang, J.; Duan, G.; Li, C.; Liu, L.; Han, G.; Zhang, Y.; Wang, C. The crosstalks between jasmonic acid and other plant hormone signaling highlight the involvement of jasmonic acid as a core component in plant response to biotic and abiotic stresses. Front. Plant Sci. 2019, 10, 1349. [Google Scholar] [CrossRef] [PubMed]
  46. Saxena, A.; Mishra, S.; Ray, S.; Raghuwanshi, R.; Singh, H.B. Differential reprogramming of defense network in Capsicum annum L. plants against colletotrichum truncatum infection by phyllospheric and rhizospheric trichoderma strains. J. Plant Growth Regul. 2020, 39, 751–763. [Google Scholar] [CrossRef]
  47. Ding, L.N.; Yang, G.X.; Yang, R.Y.; Cao, J.; Zhou, Y. Investigating interactions of salicylic acid and jasmonic acid signaling pathways in monocots wheat. Physiol. Mol. Plant Pathol. 2016, 93, 67–74. [Google Scholar] [CrossRef]
  48. Peng, X.; Wang, H.; Jang, J.C.; Xiao, T.; He, H.; Jiang, D.; Tang, X. OsWRKY80-OsWRKY4 module as a positive regulatory circuit in rice resistance against Rhizoctonia solani. Rice 2016, 9, 1–14. [Google Scholar] [CrossRef]
  49. Contreras-Cornejo, H.A.; Macías-Rodríguez, L.; Beltrán-Peña, E.; Herrera-Estrella, A.; López-Bucio, J. Trichoderma-induced plant immunity likely involves both hormonal-and camalexin-dependent mechanisms in Arabidopsis thaliana and confers resistance against necrotrophic fungi Botrytis cinerea. Plant Signal. Behave. 2011, 6, 1554–1563. [Google Scholar] [CrossRef]
  50. Mitsuhara, I.; Iwai, T.; Seo, S.; Yanagawa, Y.; Kawahigasi, H.; Hirose, S.; Ohkawa, Y.; Ohashi, Y. Characteristic expression of twelve rice PR1 family genes in response to pathogen infection, wounding, and defense-related signal compounds (121/180). Mol. Genet. Genom. 2008, 279, 415–427. [Google Scholar] [CrossRef]
  51. Hwang, S.H.; Lee, I.A.; Yie, S.W.; Hwang, D.J. Identification of an OsPR10a promoter region responsive to salicylic acid. Planta 2008, 227, 1141–1150. [Google Scholar] [CrossRef] [PubMed]
  52. Fukushima, S.; Mori, M.; Sugano, S.; Takatsuji, H. Transcription factor WRKY62 plays a role in pathogen defense and hypoxia-responsive gene expression in rice. Plant Cell Physiol. 2016, 57, 2541–2551. [Google Scholar] [CrossRef] [PubMed]
  53. Qiu, D.; Xiao, J.; Xie, W.; Cheng, H.; Li, X.; Wang, S. Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice. BMC Plant Biol. 2009, 9, 1–12. [Google Scholar] [CrossRef]
  54. Ross, C.A.; Liu, Y.; Shen, Q.J. The WRKY gene family in rice (Oryza sativa). J. Integr. Plant Biol. 2007, 49, 827–842. [Google Scholar] [CrossRef]
  55. Wu, K.L.; Guo, Z.J.; Wang, H.H.; Li, J. The WRKY family of transcription factors in rice and Arabidopsis and their origins. DNA Res. 2005, 12, 9–26. [Google Scholar] [CrossRef]
  56. Zhang, Y.; Wang, L. The WRKY transcription factor superfamily: Its origin in eukaryotes and expansion in plants. BMC Evol. Biol. 2005, 5, 1–12. [Google Scholar] [CrossRef]
  57. Divya, M.; Rajeswari, B.; Raghuveer Rao, P.; Maheswari, U.T.; Kannan, C. Biological control of bacterial blight of rice using native isolates of Trichoderma and Bacillus in rice cultivar Telangana Sona (RNR 15048). 2021. [Google Scholar]
  58. Jain, A.; Singh, A.; Singh, S.; Sarma, B.K.; Singh, H.B. Biocontrol agents-mediated suppression of oxalic acid induced cell death during Sclerotinia sclerotiorum–pea interaction. J. Basic Microbiol. 2015, 55, 601–606. Available online: http://epubs.icar.org.in/ejournal/index.php/IJPP/article/view/119311 (accessed on 22 December 2021). [CrossRef]
  59. Yang, S.M.; Shim, G.Y.; Kim, B.G.; Ahn, J.H. Biological synthesis of coumarins in Escherichia coli. Microb. Cell Factories 2015, 14, 1–12. [Google Scholar] [CrossRef]
  60. Shoresh, M.; Harman, G.E.; Mastouri, F. Induced systemic resistance and plant responses to fungal biocontrol agents. Annu Rev. Phytopathol. 2010, 48, 21–43. [Google Scholar] [CrossRef] [PubMed]
  61. Manav, M.; Thind, B.S. Management of bacterial blight of rice with bioagents. Plant Dis. Res.-Ludhiana 2002, 17, 21–28. [Google Scholar]
  62. Khan, A.A.; Rajbir, S. Influence of zinc on Trichoderma harzianum and sheath blight of rice under glasshouse conditions. Int. J. Plant Protect. 2015, 8, 303–306. [Google Scholar] [CrossRef]
  63. Kariuki, C.K.; Mutitu, E.W.; Muiru, W.M. Effect of Bacillus and Trichoderma species in the management of the bacterial wilt of tomato (Lycopersicum esculentum) in the field. Egypt. J. Biol. Pest Control. 2020, 30, 1–8. [Google Scholar] [CrossRef]
  64. Angraini, E.; Angraeni, D.N.; Umami, S.S.; Sumiati, E.; Taufiqurokhman, T. Antagonism of Lentinus Cladopus Lc4 Extract, Trichoderma sp. Jpa Extract on Bacillus sp., Xanthomonas sp. and E. coli. Int. J. Phys. Conf. Ser. 2019, 1155, 012057. [Google Scholar]
  65. Reino, J.L.; Guerrero, R.F.; Hernández-Galán, R.; Collado, I.G. Secondary metabolites from species of the biocontrol agent Trichoderma. Phytochem. Rev. 2008, 7, 89–123. [Google Scholar] [CrossRef]
  66. Verma, M.; Brar, S.K.; Tyagi, R.D.; Surampalli, R.N.; Valero, J. Antagonistic fungi, Trichoderma spp.: Panoply of biological control. Biochem. Eng. J. 2007, 37, 1–20. [Google Scholar] [CrossRef]
  67. Rubio, M.B.; Quijada, N.M.; Pérez, E.; Domínguez, S.; Monte, E.; Hermosa, R. Identifying beneficial qualities of Trichoderma parareesei for plants. Appl. Environ. Microbiol. 2014, 80, 1864–1873. [Google Scholar] [CrossRef] [PubMed]
  68. Shoresh, M.; Yedidia, I.; Chet, I. Involvement of jasmonic acid/ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T203. Phytopathology 2005, 95, 76–84. [Google Scholar] [CrossRef] [PubMed]
  69. Chaman, M.E.; Copaja, S.V.; Argandoña, V.H. Relationships between salicylic acid content, phenylalanine ammonia-lyase (PAL) activity, and resistance of barley to aphid infestation. J. Agric. Food Chem. 2003, 51, 2227–2231. [Google Scholar] [CrossRef] [PubMed]
  70. Prathuangwong, S.; Buensanteai, N. Bacillus amyloliquefaciens induced systemic resistance against bacterial pustule pathogen with increased phenols, phenylalanine ammonia lyase, peroxidases and 1, 3-β-glucanases in soybean plants. Acta Phytopathol. Entomol. Hung. 2007, 42, 321–330. [Google Scholar] [CrossRef]
  71. Li, S.B.; Fang, M.; Zhou, R.C.; Huang, J. Characterization and evaluation of the endophyte Bacillus B014 as a potential biocontrol agent for the control of Xanthomonas axonopodis pv. dieffenbachiae–Induced blight of Anthurium. Biol. Control. 2012, 63, 9–16. [Google Scholar] [CrossRef]
  72. Li, Y.; Gu, Y.; Li, J.; Xu, M.; Wei, Q.; Wang, Y. Biocontrol agent Bacillus amyloliquefaciens LJ02 induces systemic resistance against cucurbits powdery mildew. Front. Microbiol. 2015, 6, 883. [Google Scholar] [CrossRef]
  73. Mei, L.I.; Hua, L.I.; Su, X.L.; Ying, T.I.; Huang, W.K.; Jie, M.E.; Jiang, X.L. The effects of Trichoderma on preventing cucumber fusarium wilt and regulating cucumber physiology. J. Integr. Agric. 2019, 18, 607–617. [Google Scholar]
  74. Peng, X.; Hu, Y.; Tang, X.; Zhou, P.; Deng, X.; Wang, H.; Guo, Z. Constitutive expression of rice WRKY30 gene increases the endogenous jasmonic acid accumulation, PR gene expression and resistance to fungal pathogens in rice. Planta 2012, 236, 1485–1498. [Google Scholar] [CrossRef]
  75. Mur, L.A.; Kenton, P.; Atzorn, R.; Miersch, O.; Wasternack, C. The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol. 2006, 140, 249–262. [Google Scholar] [CrossRef]
  76. De Vleesschauwer, D.; Xu, J.; Höfte, M. Making sense of hormone-mediated defense networking: From rice to Arabidopsis. Front. Plant Sci. 2014, 5, 611. [Google Scholar] [CrossRef] [PubMed]
  77. Vidhyasekaran, P. Bioengineering and Molecular Manipulation of Jasmonate Signaling System to Activate Plant Immune System for Crop Disease Management. In Plant Innate Immunity Signals and Signaling Systems; Springer: Dordrecht, The Netherlands, 2020; pp. 223–248. [Google Scholar]
  78. Uji, Y.; Taniguchi, S.; Tamaoki, D.; Shishido, H.; Akimitsu, K.; Gomi, K. Overexpression of OsMYC2 results in the up-regulation of early JA-rresponsive genes and bacterial blight resistance in rice. Plant Cell Physiol. 2016, 57, 1814–1827. [Google Scholar] [CrossRef] [PubMed]
  79. Satoh, K.; Kondoh, H.; De Leon, T.B.; Macalalad, R.J.; Cabunagan, R.C.; Cabauatan, P.Q.; Mauleon, R.; Kikuchi, S.; Choi, I.R. Gene expression responses to Rice tungro spherical virus in susceptible and resistant near-isogenic rice plants. Virus Res. 2013, 171, 111–120. [Google Scholar] [CrossRef] [PubMed]
  80. Brotman, Y.; Landau, U.; Cuadros-Inostroza, A.; Takayuki, T.; Fernie, A.R.; Chet, I.; Viterbo, A.; Willmitzer, L. Trichoderma-plant root colonization: Escaping early plant defense responses and activation of the antioxidant machinery for saline stress tolerance. PLoS Pathog. 2013, 9, e1003221. [Google Scholar] [CrossRef]
  81. Qiu, Y.; Yu, D. Over-expression of the stress-induced OsWRKY45 enhances disease resistance and drought tolerance in Arabidopsis. Environ. Exp. Bot. 2009, 65, 35–47. [Google Scholar] [CrossRef]
  82. Tian, X.L.; Cao, L.X.; Tan, H.M.; Zeng, Q.G.; Jia, Y.Y.; Han, W.Q.; Zhou, S.N. Study on the communities of endophytic fungi and endophytic actinomycetes from rice and their antipathogenic activities in vitro. World J. Microbiol. Biotechnol. 2004, 20, 303–309. [Google Scholar] [CrossRef]
  83. White, T.J.; Bruns, T.; Lee, S.J.W.T.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. A Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
  84. Kauffman, H.E. An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis. Rep. 1973, 57, 537–541. [Google Scholar]
  85. Dickerson, D.P.; Pascholati, S.F.; Hagerman, A.E.; Butler, L.G.; Nicholson, R.L. Phenylalanine ammonia-lyase and hydroxycinnamate: CoA ligase in maize mesocotyls inoculated with Helminthosporium maydis or Helminthosporium carbonum. Physiol. Plant Pathol. 1984, 25, 111–123. [Google Scholar] [CrossRef]
  86. Aebi, H. Catalase in vitro. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1984; Volume 105, pp. 121–126. [Google Scholar]
  87. Zhu, G.L.; Zhong, H.W.; Zhang, A.Q. Plant Physiological Experimentation; Peking Univ. Press: Beijing, China, 1990; pp. 37–39. [Google Scholar]
  88. Hammerschmidt, R.; Nuckles, E.M.; Kuć, J. Association of enhanced peroxidase activity with induced systemic resistance of cucumber to Colletotrichum lagenarium. Physiol. Plant Pathol. 1982, 20, 73–82. [Google Scholar]
  89. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Plants 12 01864 g001 550
Figure 1. (A) In vitro growth inhibition of X. oryzae pv. oryzae by antagonistic fungal isolates (BDISOF67R: obtained from rice rhizosphere from Bogura; BDISOF91R: obtained from rice rhizosphere from Hobigonj; BDISOF08R and BDISOF09R: both obtained from rice rhizosphere from Jashore) (Photographs taken after 72 h of inoculation). (B). Error bar chart of percent growth inhibition of X. oryzae pv. oryzae by antagonistic fungal isolates. (* represents significance at 5% level of significance. Similar letters at the top of bars indicate the treatment means are statistically similar).
Figure 1. (A) In vitro growth inhibition of X. oryzae pv. oryzae by antagonistic fungal isolates (BDISOF67R: obtained from rice rhizosphere from Bogura; BDISOF91R: obtained from rice rhizosphere from Hobigonj; BDISOF08R and BDISOF09R: both obtained from rice rhizosphere from Jashore) (Photographs taken after 72 h of inoculation). (B). Error bar chart of percent growth inhibition of X. oryzae pv. oryzae by antagonistic fungal isolates. (* represents significance at 5% level of significance. Similar letters at the top of bars indicate the treatment means are statistically similar).
Plants 12 01864 g001
Plants 12 01864 g002 550
Figure 2. PCR confirmation by amplification of the ITS region of the beneficial fungi identified from rhizosphere samples collected in Boro season 2019 that inhibit the growth of X. oryzae pv. oryzae. (M: DNA ladder; W: Water control; 1: T. paraviridescens (BDISOF67); 2: T. erinaceum (BDISOF91); 3: T. asperellum (BDISOF08); 4: T. asperellum (BDISOF09)).
Figure 2. PCR confirmation by amplification of the ITS region of the beneficial fungi identified from rhizosphere samples collected in Boro season 2019 that inhibit the growth of X. oryzae pv. oryzae. (M: DNA ladder; W: Water control; 1: T. paraviridescens (BDISOF67); 2: T. erinaceum (BDISOF91); 3: T. asperellum (BDISOF08); 4: T. asperellum (BDISOF09)).
Plants 12 01864 g002
Plants 12 01864 g003 550
Figure 3. Photograph showing the reduction of lesion length caused by X. oryzae pv. oryzae by Trichoderma isolates in susceptible check cultivar (IR24). Photographs were taken at 14 days after inoculation with X. oryzae pv. oryzae by leaf clipping method. Untreated control: seed treatment with only distilled water.
Figure 3. Photograph showing the reduction of lesion length caused by X. oryzae pv. oryzae by Trichoderma isolates in susceptible check cultivar (IR24). Photographs were taken at 14 days after inoculation with X. oryzae pv. oryzae by leaf clipping method. Untreated control: seed treatment with only distilled water.
Plants 12 01864 g003
Plants 12 01864 g004 550
Figure 4. Expression levels of some selected marker genes involved in SA and JA acid pathways by RT-PCR. Total RNA was extracted from rice leaves and cDNA was synthesized. PCR was performed using cDNA as template. (A) untreated control; (B) seed priming; (C) T. paraviridescens (BDISOF67); (D) T. erinaceum (BDISOF91); (E) T. asperellum (BDISOF08); (F) T. asperellum (BDISOF09). Original images for RT-PCR image are provided in Supplementary Figures S1–S4.
Figure 4. Expression levels of some selected marker genes involved in SA and JA acid pathways by RT-PCR. Total RNA was extracted from rice leaves and cDNA was synthesized. PCR was performed using cDNA as template. (A) untreated control; (B) seed priming; (C) T. paraviridescens (BDISOF67); (D) T. erinaceum (BDISOF91); (E) T. asperellum (BDISOF08); (F) T. asperellum (BDISOF09). Original images for RT-PCR image are provided in Supplementary Figures S1–S4.
Plants 12 01864 g004
Plants 12 01864 g005 550
Figure 5. Expression levels of (A) OsPR1, (B) OsPR10, (C) OsWRKY45, (D) OsWRKY62, (E) OsWRKY71, (F) OsHI-LOX, and (G) OsACS2 involved in SA and JA acid pathways by q-PCR in rice treated with Trichoderma in response to X. oryzae pv. oryzae over untreated control. Untreated control: seed treatment with only distilled water (T. paraviridescens (BDISOF67), T. erinaceum (BDISOF91), T. asperellum (BDISOF08), and T. asperellum (BDISOF09), respectively). * represents significance at 5% level of significance. Similar letters at the top of bars indicate the treatment means are statistically similar.
Figure 5. Expression levels of (A) OsPR1, (B) OsPR10, (C) OsWRKY45, (D) OsWRKY62, (E) OsWRKY71, (F) OsHI-LOX, and (G) OsACS2 involved in SA and JA acid pathways by q-PCR in rice treated with Trichoderma in response to X. oryzae pv. oryzae over untreated control. Untreated control: seed treatment with only distilled water (T. paraviridescens (BDISOF67), T. erinaceum (BDISOF91), T. asperellum (BDISOF08), and T. asperellum (BDISOF09), respectively). * represents significance at 5% level of significance. Similar letters at the top of bars indicate the treatment means are statistically similar.
Plants 12 01864 g005
Plants 12 01864 g006 550
Figure 6. A proposed model illustrating Trichoderma mediated induced resistance in rice against X. oryzae pv. oryzae through triggering the SA and JA pathway related genes and WRKY factors.
Figure 6. A proposed model illustrating Trichoderma mediated induced resistance in rice against X. oryzae pv. oryzae through triggering the SA and JA pathway related genes and WRKY factors.
Plants 12 01864 g006
Table
Table 1. Closest relatives of the beneficial fungi obtained from rhizosphere samples collected in Boro season 2019 using sequences of the ITS region by Blast program.
Table 1. Closest relatives of the beneficial fungi obtained from rhizosphere samples collected in Boro season 2019 using sequences of the ITS region by Blast program.
Isolate ID Accession No.Closest RelativesAccession No.AlignmentHomology
BDFISO67ROP456159T. paraviridescens strain 36114DRJMF782827.1 602/60599
T. erinaceum strain CIB T72EU280106.1602/60599
BDFISO91R T. erinaceum strain QT22079KY225644.1 605/61099
OP456160 T. erinaceum strain QT22077 KY225643.1605/61299
T. erinaceum strain CIB T72 EU280106.1602/60599
BDISOF08R OP456157T. asperellum bio-material USMKU878976.1 298/31894
BDISOF09R OP456158T. asperellum isolate 20BMZ044276.1359/40988
Table
Table 2. Effect of some selected antagonistic Trichoderma isolates on the reduction of lesion length in IR24 (a susceptible check variety) caused by X. oryzae pv. oryzae.
Table 2. Effect of some selected antagonistic Trichoderma isolates on the reduction of lesion length in IR24 (a susceptible check variety) caused by X. oryzae pv. oryzae.
TreatmentsLesion Length (mm)Reduction of Lesion Length (%)
Untreated control23.67a0.00
Seed priming6.33d75.00
T. paraviridescens5.50de75.00
T. erinaceum10.83c60.42
T. asperellum3.83e87.50
T. asperellum15.50b31.25
Level of significance*-
CV (%)10.31-
* Represents significance at 5% level of significance. Means were compared by Duncan’s Multiple Range Test (DMRT). Values with the same letters are statistically similar. Lesion lengths were measured at 14 DAI. Data are averages of three replications. Untreated control: seed treatment with only distilled water.
Table
Table 3. Effect of selected Trichoderma isolates on the induction of Phenylalanine ammonia-lyase (PAL) activity when applied as seed treatment and foliar spray.
Table 3. Effect of selected Trichoderma isolates on the induction of Phenylalanine ammonia-lyase (PAL) activity when applied as seed treatment and foliar spray.
TreatmentPAL Activities (µmol s−1 g−1 *)Times Increase over Control
Hours after Inoculation (HAI)
244872144244872144
Untreated control247 ± 26239 ± 2159 ± 3269.5 ± 5
Seed priming257 ± 8286 ± 5353 ± 25313.5 ± 51.041.22.221.16
T. paraviridescens600 ± 309609 ± 368527 ± 281599 ± 3622.422.553.32.22
T. erinaceum587 ± 225555 ± 199647 ± 352605 ± 2692.372.324.052.25
T. asperellum706 ± 345622 ± 384530 ± 288546 ± 3752.852.63.322.03
T. asperellum556 ± 249611 ± 300682 ± 289608 ± 3142.252.564.272.26
Level of significanceNSNSNSNS
CV (%)173173173173
* µmol trans-cinamic acid s−1 g−1 protein; means were compared by Duncan’s Multiple Range Test (DMRT). Data are averages of three replications. Untreated control: seed treatment with only distilled water.
Table
Table 4. Effect of selected Trichoderma isolates on the induction of Catalase (CAT) activity when applied as seed treatment and foliar spray.
Table 4. Effect of selected Trichoderma isolates on the induction of Catalase (CAT) activity when applied as seed treatment and foliar spray.
TreatmentCAT Activities (µmol H2O2 min−1 g−1)Times Increase over Control
Hours after Inoculation (HAI)
244872144244872144
Untreated control50 ± 5b150 ± 5bc121 ± 5a104 ± 5a
Seed priming135 ± 5ab247 ± 5a128 ± 5a53 ± 62b2.71.651.060.51
T. paraviridescens273 ± 595a174 ± 2bc162 ± 46a218 ± 49b5.461.161.342.1
T. erinaceum264 ± 88ab223 ± 45b118 ± 4a158 ± 16b5.281.490.981.52
T. asperellum164 ± 29ab170 ± 3b59 ± 23a201 ± 26b3.281.130.491.94
T. asperellum271 ± 90ab113 ± 8c78 ± 14a367 ± 19b5.420.750.643.53
CV (%)48.7512.3518.2229.71
Level of Significance**NS*
* Represents significance at 5% level of significance. Means were compared by Duncan’s Multiple Range Test (DMRT). Values with the same letter are statistically similar. Data are averages of three replications. Untreated control: seed treatment with only distilled water.
Table
Table 5. Effect of selected Trichoderma isolates on the induction of Polyphenoloxidase (PPO) activity when applied as seed treatment and foliar spray.
Table 5. Effect of selected Trichoderma isolates on the induction of Polyphenoloxidase (PPO) activity when applied as seed treatment and foliar spray.
TreatmentPPO Activities (Units g−1 min−1 FW)Times Increase over Control
Hours after Inoculation (HAI)
244872144244872144
Untreated control247 ± 26b239 ± 2159 ± 3c269 ± 5ab
Seed priming257 ± 8b286 ± 5353 ± 25a313 ± 5a1.031.22.211.16
T. paraviridescens454 ± 92a257 ± 15247 ± 1b254 ± 17ab1.771.071.550.94
T. erinaceum434 ± 71ab311 ± 45271 ± 24ab296 ± 40ab0.951.31.71.10
T. asperellum428 ± 67ab276 ± 38250 ± 7b222 ± 50b0.981.151.580.82
T. asperellum403 ± 96ab284 ± 27324 ± 69ab274 ± 20ab0.941.192.031.01
LSD61.0424.4128.2425.49
CV (%)173.25173.13173.48173.32
Level of Significance*NS**
* Represents significance at 5% level of significance. Values with the same letters are statistically similar. Data are averages of three replications. Untreated control: seed treatment with only distilled water.
Table
Table 6. Effect of selected Trichoderma isolates on the induction of Peroxidase (POD) activity when applied as seed treatment and foliar spray.
Table 6. Effect of selected Trichoderma isolates on the induction of Peroxidase (POD) activity when applied as seed treatment and foliar spray.
TreatmentPOD Activities (Units min−1 g−1 FW)Times Increase over Control
Hours after Inoculation (HAI)
244872144244872144
Untreated control760 ± 60b721 ± 551009 ± 29ab1191 ± 55
Seed priming759 ± 55b851 ± 451186 ± 100ab1224 ± 00.991.181.171.03
T. paraviridescens850 ± 99b1118 ± 281503 ± 232ab1751 ± 10041.121.551.491.47
T. erinaceum831 ± 138b880 ± 2811375 ± 486ab1866 ± 7941.091.221.361.57
T. asperellum847 ± 237b736 ± 138697 ± 425b1809 ± 1511.111.020.691.52
T. asperellum1239 ± 109.5a762 ± 2881704 ± 42a1338 ± 6921.631.061.691.12
CV (%)107.35162.37285.25460.37
Level of Significance*NS*NS
* Represents significance at 5% level of significance. Means were compared by Duncan’s Multiple Range Test (DMRT). Values with the same letters are statistically similar. Data are averages of three replications. Untreated control: seed treatment with only distilled water.
Table
Table 7. List of primers for the expression study of some selected defense-related genes of rice against X. oryzae pv. oryzae.
Table 7. List of primers for the expression study of some selected defense-related genes of rice against X. oryzae pv. oryzae.
GenesPrimer NameSequence (5′-3′)Marker Gene
OsPR1OsPR1forwardTTATCCTGCTGCTTGCTGGTSA pathway
OsPR1 reverseGATGTTCTCGCCGTACTTCC
OsPR10 OsPR10 forwardGGCACCATCTACACCATGAASA pathway
OsPR10 reverseTTGTCGG CTGTGATGA ATGT
OsWRKY45OsWRKY45 forwardCCGGCATGGAGTTCTTCAAGSA pathway
OsWRKY45 reverseTATTT CTGTACACACGCGTGGAA
OsWRKY62OsWRKY62 forwardAGGATGGGTACCAATGGASA pathway
OsWR KY62 reverseACGAGTTGATGGAGATGGA
OsWRKY71OsWRKY71 forwardAGCCCAA GA TCTCC AAGCTCSA pathway
OsWRKY71 reverseACGAGGATCGTGTTGTCCTC
OsACS2OsACS2 forwardGGAATAAAGCTGC TGCCGATSA pathway
OsACS2 reverseTGAGCCTGAAG TCGTTGAAGC
OsHI-LOX OsHI-LOX forwardGCATCCCCAACAGCACATCJA Pathway
OsHI-LOX reverseAATAAAGATTTGGGA GTGACATATTGG
18S rRNA18S rRNA Forward CTACGTCCCTGCCCTTTGTACA
18S rRNA Reverse ACACTTCACCGGACCATTCAA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Islam, M.R.; Chowdhury, R.; Roy, A.S.; Islam, M.N.; Mita, M.M.; Bashar, S.; Saha, P.; Rahat, R.A.; Hasan, M.; Akter, M.A.; et al. Native Trichoderma Induced the Defense-Related Enzymes and Genes in Rice against Xanthomonas oryzae pv. oryzae (Xoo). Plants 2023, 12, 1864. https://doi.org/10.3390/plants12091864

AMA Style

Islam MR, Chowdhury R, Roy AS, Islam MN, Mita MM, Bashar S, Saha P, Rahat RA, Hasan M, Akter MA, et al. Native Trichoderma Induced the Defense-Related Enzymes and Genes in Rice against Xanthomonas oryzae pv. oryzae (Xoo). Plants. 2023; 12(9):1864. https://doi.org/10.3390/plants12091864

Chicago/Turabian Style

Islam, Md. Rashidul, Rabin Chowdhury, Arpita Saha Roy, Md. Nazmul Islam, Mamuna Mahjabin Mita, Samrin Bashar, Plabon Saha, Ridwan Ahmed Rahat, Mehedi Hasan, Mst. Arjina Akter, and et al. 2023. "Native Trichoderma Induced the Defense-Related Enzymes and Genes in Rice against Xanthomonas oryzae pv. oryzae (Xoo)" Plants 12, no. 9: 1864. https://doi.org/10.3390/plants12091864

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop