Potential of Trichoderma virens HZA14 in Controlling Verticillium Wilt Disease of Eggplant and Analysis of Its Genes Responsible for Microsclerotial Degradation
Abstract
:1. Introduction
2. Results
2.1. Dual Culture Assay
2.2. Effect of Culture Filtrates of Trichoderma Isolates on Mycelial Growth and Conidial Germination of V. dahliae
2.3. Assessment of Siderophore and IAA Production
2.4. Control Efficiency of T. virens HZA14 against Verticillium Wilt
2.5. Plant Growth Promotion (PGP)
2.6. Microsclerotial Degradation of V. dahliae
2.7. Transcriptome Data by Using RNA Sequencing
2.8. Correlation Analysis of RNA-Seq Data
2.9. DEGs Analysis
2.10. Gene Ontology Classification of Differentially Expressed Genes
2.11. KEGG Enrichment Analysis of DEGs
2.12. Analysis of DEGs Related to Enzymes of Microsclerotial Degradation
2.13. Detection of RT-qPCR
3. Discussion
4. Materials and Methods
4.1. Fungal Materials
4.2. Screening of Trichoderma Isolates with Antagonistic Activity against V. dahliae
4.3. Culture Filtrate Activity Produced by Trichoderma Isolates against V. dahliae
4.4. Detection of Siderophore and 3-Indoleacetic Acid (IAA) Production
4.5. Preparation of Fungal Inoculations
4.6. Greenhouse Experiment
4.7. Plant Growth Promotion (PGP) Assay
4.8. RNA Extraction and Purification
4.9. Library Preparation for RNA Sequencing
4.10. Filter of Original Data
4.11. Analysis of Differential Gene Expression
4.12. Analysis of Function Enrichment of Gene Ontology
4.13. Quantitative Reverse Transcription PCR (qRT-PCR)
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Song, R.; Li, J.; Xie, C.; Jian, W.; Yang, X. An overview of the molecular genetics of plant resistance to the Verticillium wilt pathogen Verticillium dahliae. Int. J. Mol. Sci. 2020, 21, 1120. [Google Scholar] [CrossRef]
- Fradin, E.F.; Thomma, B. Physiology and molecular aspects of Verticillium wilt diseases caused by Verticillium dahliae and Verticillium albo-atrum. Mol. Plant Pathol. 2006, 7, 71–86. [Google Scholar] [CrossRef]
- Wilhelm, S. Longevity of the Verticillium wilt fungus in the laboratory and field. Phytopathology 1955, 45, 180–181. [Google Scholar]
- Bell, A.A.; Wheeler, M.H. Biosynthesis and functions of fungal melanins. Annu. Rev. Phytopathol. 1986, 24, 411–451. [Google Scholar] [CrossRef]
- Wheeler, M.H.; Tolmsoff, W.J.; Bell, A.; Mollenhauer, H.H. Ultrastructural and chemical distinction of melanins formed by Verticillium dahliae from (+)-scytalone, 1,8-dihydroxynaphthalene, catechol, and L-3,4-dihydroxyphenylalanine. Can. J. Microbiol. 1978, 24, 289–297. [Google Scholar] [CrossRef]
- Heale, J.B.; Isaac, I. Environmental factors in the production of dark resting structures in Verticillium alboatrum, V. dahliae and V. tricorpus. Trans. Br. Mycol. Soc. 1965, 48, 39–50. [Google Scholar] [CrossRef]
- Klosterman, S.J.; Atallah, Z.K.; Vallad, G.E.; Subbarao, K.V. Diversity, pathogenicity, and management of Verticillium species. Annu. Rev. Phytopathol. 2009, 47, 39–62. [Google Scholar] [CrossRef]
- Carroll, C.L.; Carter, C.A.; Goodhue, R.E.; Lawell, C.L.; Subbarao, K.V. A review of control options and externalities for Verticillium wilts. Phytopathology 2018, 108, 160–171. [Google Scholar] [CrossRef]
- Harman, G.E.; Howell, C.R.; Viterbo, A.; Chet, I.; Lorito, M. Trichoderma species—Opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2004, 2, 43–56. [Google Scholar] [CrossRef]
- Chang, C.; Stewart, R.C. The two-component system: Regulation of diverse signaling pathways in prokaryotes and eukaryotes. Plant Physiol. 1998, 117, 723–731. [Google Scholar] [CrossRef]
- Tronsmo, A. Biological and integrated controls of Botrytis cinerea on apple with Trichoderma harzianum. Biol. Control 1991, 1, 59–62. [Google Scholar] [CrossRef]
- Kubicek, C.P.; Herrera-Estrella, A.; Seidl-Seiboth, V.; Martinez, D.A.; Druzhinina, I.S.; Thon, M.; Zeilinger, S.; Casas-Flores, S.; Horwitz, B.A.; Mukherjee, P.K. Comparative genome sequence analysis underscores mycoparasitism as the ancestral life style of Trichoderma. Genome Biol. 2011, 12, R40. [Google Scholar] [CrossRef]
- Baek, J.; Howell, C.R.; Kenerley, C.M. The role of an extracellular chitinase from Trichoderma virens Gv29-8 in the biocontrol of Rhizoctonia solani. Curr. Genet. 1999, 35, 41–50. [Google Scholar] [CrossRef]
- Djonović, S.; Vittone, G.; Mendoza-Herrera, A.; Kenerley, C.M. Enhanced biocontrol activity of Trichoderma virens transformants constitutively coexpressing β-1,3- and β-1,6-glucanase genes. Mol. Plant Pathol. 2007, 8, 469–480. [Google Scholar] [CrossRef]
- Pozo, M.J.; Baek, J.; Garcıa, J.M.; Kenerley, C.M. Functional analysis of tvsp1, a serine protease-encoding gene in the biocontrol agent Trichoderma virens. Fungal Genet. Biol. 2004, 41, 336–348. [Google Scholar] [CrossRef]
- Reithner, B.; Ibarra-Laclette, E.; Mach, R.L.; Herrera-Estrella, A. Identification of mycoparasitism-related genes in Trichoderma atroviride. Appl. Environ. Microbiol. 2011, 77, 4361–4370. [Google Scholar] [CrossRef]
- Vizcaíno, J.A.; Redondo, J.; Suárez, M.B.; Cardoza, R.E.; Hermosa, R.; González, F.J.; Rey, M.; Monte, E. Generation, annotation, and analysis of ESTs from four different Trichoderma strains grown under conditions related to biocontrol. Appl. Microbiol. Biotechnol. 2007, 75, 853–862. [Google Scholar] [CrossRef]
- Steindorff, A.S.; Ramada, M.H.S.; Coelho, A.S.G.; Miller, R.N.G.; Pappas, G.J.; Ulhoa, C.J.; Noronha, E.F. Identification of mycoparasitism-related genes against the phytopathogen Sclerotinia sclerotiorum through transcriptome and expression profile analysis in Trichoderma harzianum. BMC Genom. 2014, 15, 204. [Google Scholar] [CrossRef]
- Flores, A.; Chet, I.; Herrera-Estrella, A. Improved biocontrol activity of Trichoderma harzianum by over-expression of the proteinase-encoding gene prb1. Curr. Genet. 1997, 31, 30–37. [Google Scholar] [CrossRef]
- Migheli, Q.; González-Candelas, L.; Dealessi, L.; Camponogara, A.; Ramón-Vidal, D. Transformants of Trichoderma longibrachiatum overexpressing the β-1,4-endoglucanase gene egl1 show enhanced biocontrol of Pythium ultimum on cucumber. Phytopathology 1998, 88, 673–677. [Google Scholar] [CrossRef]
- Limón, M.C.; Pintor-Toro, J.A.; Benítez, T. Increased antifungal activity of Trichoderma harzianum transformants that overexpress a 33-kDa chitinase. Phytopathology 1999, 89, 254–261. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Liu, X.; Chen, M.; Tao, N.; Tendu, A.; Yang, Q. A New MiRNA MiRm0002 in Eggplant Participates in the Regulation of Defense Responses to Verticillium Wilt. Plants 2021, 10, 2274. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, M.; Mukherjee, P.K.; Horwitz, B.A.; Zachow, C.; Berg, G.; Zeilinger, S. Trichoderma–plant–pathogen interactions: Advances in genetics of biological control. Indian J. Microbiol. 2012, 52, 522–529. [Google Scholar] [CrossRef] [PubMed]
- Lorito, M.; Farkas, V.; Rebuffat, S.; Bodo, B.; Kubicek, C.P. Cell wall synthesis is a major target of mycoparasitic antagonism by Trichoderma harzianum. J. Bacteriol. 1996, 178, 6382–6385. [Google Scholar] [CrossRef] [PubMed]
- D’ercole, N.; Nipoti, P.; Di Pillo, L.; Gavina, F. In vitro and in vivo tests of Trichoderma spp. as a biocontrol agent of Verticillium dahliae Kleb. in eggplants. In Advances in Verticillium: Research and Disease Management; Tjamos, E.C., Rowe, R.C., Heale, J.B., Fravel, D.R., Eds.; APS Press: St. Paul, MN, USA, 2000; pp. 260–263. [Google Scholar]
- Reghmit, A.; Benzina-tihar, F.; López Escudero, F.J.; Halouane-Sahir, F.; Oukali, Z.; Bensmail, S.; Ghozali, N. Trichoderma spp. isolates from the rhizosphere of healthy olive trees in northern Algeria and their biocontrol potentials against the olive wilt pathogen, Verticillium dahliae. Org. Agric. 2021, 11, 639–657. [Google Scholar] [CrossRef]
- Jabnoun-Khiareddine, H.; Daami-Remadi, M.; Ayed, F.; El Mahjoub, M. Biological control of tomato Verticillium wilt by using indigenous Trichoderma spp. Afr. J. Plant Sci. Biotechnol. 2009, 3, 26–36. [Google Scholar]
- Marques, E.; Martins, I.; Mello, S.C.M. Antifungal potential of crude extracts of Trichoderma spp. Biota Neotrop. 2018, 18, e20170418. [Google Scholar] [CrossRef]
- Anita, S.; Ponmurugan, P.; Babu, R.G. Significance of secondary metabolites and enzymes secreted by Trichoderma atroviride isolates for the biological control of Phomopsis canker disease. Afr. J. Biotechnol. 2012, 11, 10350–10357. [Google Scholar] [CrossRef]
- Fotoohiyan, Z.; Rezaee, S.; Bonjar, G.H.; Mohammadi, A.H.; Moradi, M. Biocontrol potential of Trichoderma harzianum in controlling wilt disease of pistachio caused by Verticillium dahliae. J. Plant Prot. Res. 2017, 57, 185–193. [Google Scholar] [CrossRef]
- Xiaojun, C.; Wongkaew, S.; Jie, Y.; Xuehui, Y.; Haiyong, H.; Shiping, W.; Qigqun, T.; Lishuang, W.; Athinuwat, D.; Buensanteai, N. In vitro inhibition of pathogenic Verticillium dahliae, causal agent of potato wilt disease in China by Trichoderma isolates. Afr. J. Biotechnol. 2014, 13, 3402–3412. [Google Scholar]
- Vinale, F.; Ghisalberti, E.; Sivasithamparam, K.; Marra, R.; Ritieni, A.; Ferracane, R.; Woo, S.; Lorito, M. Factors affecting the production of Trichoderma harzianum secondary metabolites during the interaction with different plant pathogens. Lett. Appl. Microbiol. 2009, 48, 705–711. [Google Scholar] [PubMed]
- Ordentlich, A.; Nachmias, A.; Chet, I. Integrated control of Verticillium dahliae in potato by Trichoderma harzianum and captan. Crop Prot. 1990, 9, 363–366. [Google Scholar] [CrossRef]
- Benouzza, S.; Bellahcene, M.; Fortas, Z. Biocontrol of Verticillium dahliae by native Trichoderma strains isolated from Algeria. Mycopath 2021, 18, 59–70. [Google Scholar]
- Carrero-Carrón, I.; Trapero-Casas, J.L.; Olivares-García, C.; Monte, E.; Hermosa, R.; Jiménez-Díaz, R.M. Trichoderma asperellum is effective for biocontrol of Verticillium wilt in olive caused by the defoliating pathotype of Verticillium dahliae. Crop Prot. 2016, 88, 45–52. [Google Scholar] [CrossRef]
- Woo, S.L.; Ruocco, M.; Vinale, F.; Nigro, M.; Marra, R.; Lombardi, N.; Pascale, A.; Lanzuise, S.; Manganiello, G.; Lorito, M. Trichoderma-based products and their widespread use in agriculture. Open Mycol. J. 2014, 8, 71–126. [Google Scholar] [CrossRef]
- Meszka, B.; Bielenin, A. Bioproducts in control of strawberry Verticillium wilt. Phytopathologia 2009, 52, 21–27. [Google Scholar]
- Yao, X.; Guo, H.; Zhang, K.; Zhao, M.; Ruan, J.; Chen, J. Trichoderma and its role in biological control of plant fungal and nematode disease. Front. Microbiol. 2023, 14, 1160551. [Google Scholar] [CrossRef]
- Bogumił, A.; Paszt, L.S.; Lisek, A.; Trzciński, P.; Harbuzov, A. Identification of new Trichoderma strains with antagonistic activity against Botrytis cinerea. Folia Hortic. 2013, 25, 123–132. [Google Scholar] [CrossRef]
- Srivastava, M.P.; Gupta, S.; Sharm, Y.K. Detection of siderophore production from different cultural variables by CAS-agar plate assay. Asian J. Pharm. Pharmacol. 2018, 4, 66–69. [Google Scholar] [CrossRef]
- Sood, M.; Kapoor, D.; Kumar, V.; Sheteiwy, M.S.; Ramakrishnan, M.; Landi, M.; Araniti, F.; Sharma, A. Trichoderma: The “secrets” of a multitalented biocontrol agent. Plants 2020, 9, 762. [Google Scholar] [CrossRef]
- Nieto-Jacobo, M.F.; Steyaert, J.M.; Salazar-Badillo, F.B.; Nguyen, D.V.; Rostás, M.; Braithwaite, M.; De Souza, J.T.; Jimenez-Bremont, J.F.; Ohkura, M.; Stewart, A. Environmental growth conditions of Trichoderma spp. affects indole acetic acid derivatives, volatile organic compounds, and plant growth promotion. Front. Plant Sci. 2017, 8, 102. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Wang, Y.; Kong, S. Effects of Trichoderma asperellum and its siderophores on endogenous auxin in Arabidopsis thaliana under iron-deficiency stress. Int. Microbiol. 2020, 23, 501–509. [Google Scholar] [CrossRef] [PubMed]
- Hoyos-Carvajal, L.; Orduz, S.; Bissett, J. Growth stimulation in bean (Phaseolus vulgaris L.) by Trichoderma. Biol. Control 2009, 51, 409–416. [Google Scholar] [CrossRef]
- Yadav, M.; Divyanshu, K.; Dubey, M.K.; Rai, A.; Kumar, S.; Tripathi, Y.N.; Shukla, V.; Upadhyay, R.S. Plant growth promotion and differential expression of defense genes in chilli pepper against Colletotrichum truncatum induced by Trichoderma asperellum and T. harzianum. BMC Microbiol. 2023, 23, 54. [Google Scholar] [CrossRef]
- Tjamos, E.C.; Fravel, D.R. Detrimental effects of sublethal heating and Talaromyces flavus on microsclerotia of Verticillium dahliae. Phytopathology 1995, 85, 388–392. [Google Scholar] [CrossRef]
- Duressa, D.; Anchieta, A.; Chen, D.; Klimes, A.; Garcia-Pedrajas, M.D.; Dobinson, K.F.; Klosterman, S.J. RNA-seq analyses of gene expression in the microsclerotia of Verticillium dahliae. BMC Genom. 2013, 14, 607. [Google Scholar] [CrossRef]
- Griffiths, D.A. The fine structure of developing microsclerotia of Verticillium dahliae Kleb. Arch. Mikrobiol. 1970, 74, 207–212. [Google Scholar] [CrossRef]
- Zhu, Y.; Zhao, M.; Li, T.; Wang, L.; Liao, C.; Liu, D.; Zhang, H.; Zhao, Y.; Liu, L.; Ge, X. Interactions between Verticillium dahliae and cotton: Pathogenic mechanism and cotton resistance mechanism to Verticillium wilt. Front. Plant Sci. 2023, 14, 1174281. [Google Scholar] [CrossRef]
- Gruber, S.; Zeilinger, S. The transcription factor Ste12 mediates the regulatory role of the Tmk1 MAP kinase in mycoparasitism and vegetative hyphal fusion in the filamentous fungus Trichoderma atroviride. PLoS ONE 2014, 9, e111636. [Google Scholar] [CrossRef]
- Mukherjee, P.K.; Mendoza-Mendoza, A.; Zeilinger, S.; Horwitz, B.A. Mycoparasitism as a mechanism of Trichoderma-mediated suppression of plant diseases. Fungal Biol. Rev. 2022, 39, 15–33. [Google Scholar] [CrossRef]
- Lam, S.T.; Gaffney, T.D. Biological activities of bacteria used in plant pathogen control. In Biotechnology in Plant Disease Control; Chet, I., Ed.; John Wiley: New York, NY, USA, 1993; Volume 1993, pp. 291–320. [Google Scholar]
- Halifu, S.; Deng, X.; Song, X.; Song, R.; Liang, X. Inhibitory mechanism of Trichoderma virens ZT05 on Rhizoctonia solani. Plants 2020, 9, 912. [Google Scholar] [CrossRef] [PubMed]
- Atanasova, L.; Crom, S.L.; Gruber, S.; Coulpier, F.; Seidl-Seiboth, V.; Kubicek, C.P.; Druzhinina, I.S. Comparative transcriptomics reveals different strategies of Trichoderma mycoparasitism. BMC Genom. 2013, 14, 121. [Google Scholar] [CrossRef] [PubMed]
- Ji, S.; Liu, Z.; Liu, B.; Wang, Y. Comparative analysis of biocontrol agent Trichoderma asperellum ACCC30536 transcriptome during its interaction with Populus davidiana× P. alba var. pyramidalis. Microbiol. Res. 2019, 227, 126294. [Google Scholar] [CrossRef] [PubMed]
- Shentu, X.P.; Liu, W.P.; Zhan, X.H.; Xu, Y.P.; Xu, J.F.; Yu, X.P.; Zhang, C.X. Transcriptome sequencing and gene expression analysis of Trichoderma brevicompactum under different culture conditions. PLoS ONE 2014, 9, e94203. [Google Scholar] [CrossRef] [PubMed]
- Morán-Diez, M.E.; Carrero-Carrón, I.; Rubio, M.B.; Jiménez-Díaz, R.M.; Monte, E.; Hermosa, R. Transcriptomic analysis of Trichoderma atroviride overgrowing plant-wilting Verticillium dahliae reveals the role of a new M14 metallocarboxypeptidase CPA1 in biocontrol. Front. Microbiol. 2019, 10, 1120. [Google Scholar] [CrossRef]
- Yuan, M.; Zuo, C.; Xu, W.; Zhang, L.; Guo, X.; Yan, X.; Li, S.; Li, Y.; Zhang, L.; Geng, J. Transcriptome Analysis Deciphers Trichoderma koningiopsis C5-9 Strategies against Plant Pathogen Botrytis cinerea. Microbiol. Res. 2023, 14, 977–992. [Google Scholar] [CrossRef]
- Wang, Y.; Zhu, X.; Wang, J.; Shen, C.; Wang, W. Identification of Mycoparasitism-Related Genes against the Phytopathogen Botrytis cinerea via Transcriptome Analysis of Trichoderma harzianum T4. J. Fungi 2023, 9, 324. [Google Scholar] [CrossRef]
- Vieira, P.M.; Coelho, A.S.G.; Steindorff, A.S.; de Siqueira, S.J.L.; Silva, R.; Ulhoa, C.J. Identification of differentially expressed genes from Trichoderma harzianum during growth on cell wall of Fusarium solani as a tool for biotechnological application. BMC Genom. 2013, 14, 117. [Google Scholar] [CrossRef]
- Qian, X.; Jin, H.; Chen, Z.; Dai, Q.; Sarsaiya, S.; Qin, Y.; Jia, Q.; Jin, L.; Chen, J. Comparative transcriptome analysis of genes involved in sesquiterpene alkaloid biosynthesis in Trichoderma longibrachiatum MD33 and UN32. Front. Microbiol. 2021, 12, 800125. [Google Scholar] [CrossRef]
- Steyaert, J.M.; Ridgway, H.J.; Elad, Y.; Stewart, A. Genetic basis of mycoparasitism: A mechanism of biological control by species of Trichoderma. N. Z. J. Crop Hortic. Sci. 2003, 31, 281–291. [Google Scholar] [CrossRef]
- Caseiro, C.; Dias, J.N.; de Andrade Fontes, C.M.; Bule, P. From cancer therapy to winemaking: The molecular structure and applications of β-glucans and β-1,3-glucanases. Int. J. Mol. Sci. 2022, 23, 3156. [Google Scholar] [CrossRef]
- Li, J.; Kong, L.; Ma, C.; Bao, Z.; Zhang, D.; Chen, Y.; Wang, C. A chitinase involved in the mycoparasitism of Trichoderma atroviride on aeciospores of Cronartium ribicola. J. Phytopathol. 2022, 170, 209–213. [Google Scholar] [CrossRef]
- Catalano, V.; Vergara, M.; Hauzenberger, J.R.; Seiboth, B.; Sarrocco, S.; Vannacci, G.; Kubicek, C.P.; Seidl-Seiboth, V. Use of a non-homologous end-joining-deficient strain (delta-ku70) of the biocontrol fungus Trichoderma virens to investigate the function of the laccase gene lcc1 in sclerotia degradation. Curr. Genet. 2011, 57, 13–23. [Google Scholar] [CrossRef] [PubMed]
- Giardina, P.; Faraco, V.; Pezzella, C.; Piscitelli, A.; Vanhulle, S.; Sannia, G. Laccases: A never-ending story. Cell. Mol. Life Sci. 2010, 67, 369–385. [Google Scholar] [CrossRef] [PubMed]
- Seidl, V.; Song, L.; Lindquist, E.; Gruber, S.; Koptchinskiy, A.; Zeilinger, S.; Schmoll, M.; Martínez, P.; Sun, J.; Grigoriev, I. Transcriptomic response of the mycoparasitic fungus Trichoderma atroviride to the presence of a fungal prey. BMC Genom. 2009, 10, 567. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.T.; Lu, X.Y.; Zhang, J.Z.; Zhu, S. Identification of pathotype of Verticillium dahliae isolates on cotton in Zhejiang Province and phenotypic analysis on inhibitory effect by high temperature. J. Zhejiang Univ. (Agric. Life Sci.) 2016, 42, 671–678. [Google Scholar]
- Jiang, H.; Zhang, L.; Zhang, J.; Ojaghian, M.R.; Hyde, K.D. Antagonistic interaction between Trichoderma asperellum and Phytophthora capsici in vitro. J. Zhejiang Univ.-Sci. B 2016, 17, 271–281. [Google Scholar] [CrossRef]
- Abuduaini, X.; Aili, A.; Lin, R.; Song, G.; Huang, Y.; Chen, Z.; Zhao, H.; Luo, Q.; Zhao, H. The lethal effect of Bacillus subtilis z15 secondary metabolites on Verticillium dahliae. Nat. Prod. Commun. 2021, 16, 1934578X20986728. [Google Scholar]
- Milagres, A.M.F.; Machuca, A.; Napoleao, D. Detection of siderophore production from several fungi and bacteria by a modification of chrome azurol S (CAS) agar plate assay. J. Microbiol. Methods 1999, 37, 1–6. [Google Scholar] [CrossRef]
- Schwyn, B.; Neilands, J.B. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 1987, 160, 47–56. [Google Scholar] [CrossRef]
- Glickmann, E.; Dessaux, Y. A critical examination of the specificity of the Salkowski reagent for indolic compounds produced by phytopathogenic bacteria. Appl. Environ. Microbiol. 1995, 61, 793–796. [Google Scholar] [CrossRef] [PubMed]
- Gravel, V.; Antoun, H.; Tweddell, R.J. Growth stimulation and fruit yield improvement of greenhouse tomato plants by inoculation with Pseudomonas putida or Trichoderma atroviride: Possible role of indole acetic acid (IAA). Soil Biol. Biochem. 2007, 39, 1968–1977. [Google Scholar] [CrossRef]
- Zhang, F.; Zhu, Z.; Yang, X.; Ran, W.; Shen, Q. Trichoderma harzianum T-E5 significantly affects cucumber root exudates and fungal community in the cucumber rhizosphere. Appl. Soil Ecol. 2013, 72, 41–48. [Google Scholar] [CrossRef]
- Hu, X.; Bai, Y.; Chen, T.; Hu, D.; Yang, J.; Xu, X. An optimized method for in vitro production of Verticillium dahliae microsclerotia. Eur. J. Plant Pathol. 2013, 136, 225–229. [Google Scholar] [CrossRef]
- Atibalentja, N.; Eastburn, D.M. Evaluation of inoculation methods for screening horseradish cultivars for resistance to Verticillium dahliae. Plant Dis. 1997, 81, 356–362. [Google Scholar] [CrossRef] [PubMed]
- Nelson, P.E.; Wilhelm, S. Thermal death range of Verticillium albo-atrum. Phytopathology 1958, 48, 613–616. [Google Scholar]
- Mirmajlessi, S.M.; MÄND, M.; Najdabbasi, N.; Larena, I.; Loit, E. Screening of native Trichoderma harzianum isolates for their ability to control Verticillium wilt of strawberry. Zemdirbyste 2016, 103, 397–404. [Google Scholar] [CrossRef]
- Lan, X.; Zhang, J.; Zong, Z.; Ma, Q.; Wang, Y. Evaluation of the biocontrol potential of Purpureocillium lilacinum QLP12 against Verticillium dahliae in eggplant. BioMed Res. Int. 2017, 2017, 4101357. [Google Scholar] [CrossRef]
- Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef]
- Thorvaldsdóttir, H.; Robinson, J.T.; Mesirov, J.P. Integrative Genomics Viewer (IGV): High-performance genomics data visualization and exploration. Brief. Bioinform. 2013, 14, 178–192. [Google Scholar] [CrossRef]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef] [PubMed]
- Trapnell, C.; Roberts, A.; Goff, L.; Pertea, G.; Kim, D.; Kelley, D.R.; Pimentel, H.; Salzberg, S.L.; Rinn, J.L.; Pachter, L. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 2012, 7, 562–578. [Google Scholar] [CrossRef] [PubMed]
- Kloepper, J.W.; Schroth, M.N. Development of a powder formulation of rhizobacteria for inoculation of potato seed pieces. Phytopathology 1981, 71, 590–592. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Concentration of CF 1 | PIRMG 2 (%) | IZD 3 (mm) |
---|---|---|
100% | 100.00 ± 0.0 a | 10.13 ± 0.3 a |
50% | 65.51 ± 8.9 b | 3.49 ± 0.1 b |
25% | 50.71 ± 2.9 c | 1.48 ± 0.1 c |
0 | ---------- | 0.00 ± 0.0 d |
Periods/Days | Disease Severity (%) | Control Efficacy (%) | |
---|---|---|---|
V. dahliae Alone | T. virens + V. dahliae | ||
10 | 72.96 ± 2.62 a | 44.43 ± 0.95 c | 39.10 ± 1.30 c |
20 | 74.63 ± 0.96 a | 23.88 ± 0.62 b | 67.99 ± 0.83 b |
30 | 71.48 ± 1.91 a | 2.77 ± 0.62 a | 96.59 ± 0.76 a |
Average | 75.69 | 23.69 | 67.89 |
Treatments | Measured Parameters | |||||
---|---|---|---|---|---|---|
Stem Length (cm) | Stem Fresh Weight (g) | Stem Dry Weight (g) | Root Length (cm) | Root Fresh Weight (g) | Root Dry Weight (g) | |
HZA14 | 15.58 ± 0.47 a | 8.04 ± 0.39 a | 0.77 ± 0.01 a | 14.29 ± 0.26 a | 0.64 ± 0.029 a | 0.17 ± 0.013 a |
Control | 13.37 ± 0.43 b | 6.86 ± 0.38 b | 0.64 ± 0.02 b | 12.59 ± 0.21 b | 0.50 ± 0.022 b | 0.11 ± 0.011 b |
GPE (%) | 16.54 | 17.20 | 20.31 | 13.50 | 28.00 | 54.55 |
Gene Name | Forward and Reverse of Primers (5′ to 3′) |
---|---|
Endo-1,3-beta-glucanase | F: CACACCACCGTCCTCAAGGGCTCCG R: GTGGGTGAATCGGGCGACAATGAGA |
Endochitinase A1 | F: ACCCCGTAACTGGCTTGCCCACACA R:TGGAAGGGAAGAGAGTAGAGTTGCT |
Endochitinase 3 | F: CTACCCTCCGTCCCTTTGGCACTGT R: GGCGTCGGGAAAGGGGCACTGGGGA |
Alpha-N-acetylglucosaminidase | F: ATTCGTCCCCCGCAACATCTCTCGC R: CCACTGAGGAGCGGATTCGGCAAAC |
Laccase-1 | F: TGAGGGGCACGAGGACGATGATGAG R: GCGTTAGGATAAAATAGCAGAGGGT |
Peroxidase | F: TCCGACGCCTGGGACGCCCTCACTG R: CGAAGTAGCGGAAGCCCTGGGTGTC |
Actin | F: GGTCAGGTCATCACCATCGGCAACG R: GCTGCTGTGTGAATGGATGGGAAAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tomah, A.A.; Alamer, I.S.A.; Khattak, A.A.; Ahmed, T.; Hatamleh, A.A.; Al-Dosary, M.A.; Ali, H.M.; Wang, D.; Zhang, J.; Xu, L.; et al. Potential of Trichoderma virens HZA14 in Controlling Verticillium Wilt Disease of Eggplant and Analysis of Its Genes Responsible for Microsclerotial Degradation. Plants 2023, 12, 3761. https://doi.org/10.3390/plants12213761
Tomah AA, Alamer ISA, Khattak AA, Ahmed T, Hatamleh AA, Al-Dosary MA, Ali HM, Wang D, Zhang J, Xu L, et al. Potential of Trichoderma virens HZA14 in Controlling Verticillium Wilt Disease of Eggplant and Analysis of Its Genes Responsible for Microsclerotial Degradation. Plants. 2023; 12(21):3761. https://doi.org/10.3390/plants12213761
Chicago/Turabian StyleTomah, Ali Athafah, Iman Sabah Abd Alamer, Arif Ali Khattak, Temoor Ahmed, Ashraf Atef Hatamleh, Munirah Abdullah Al-Dosary, Hayssam M. Ali, Daoze Wang, Jingze Zhang, Lihui Xu, and et al. 2023. "Potential of Trichoderma virens HZA14 in Controlling Verticillium Wilt Disease of Eggplant and Analysis of Its Genes Responsible for Microsclerotial Degradation" Plants 12, no. 21: 3761. https://doi.org/10.3390/plants12213761