Next Article in Journal
Environmental Factors Driving the Spatial Distribution Pattern of Venerable Trees in Sichuan Province, China
Previous Article in Journal
Epigenetic Stress and Long-Read cDNA Sequencing of Sunflower (Helianthus annuus L.) Revealed the Origin of the Plant Retrotranscriptome
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 11
Issue 24
10.3390/plants11243580
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

OsCSLD1 Mediates NH4+-Dependent Root Hair Growth Suppression and AMT1;2 Expression in Rice (Oryza sativa L.)

by
Sujeevan Rajendran
and
Chul Min Kim
*
Department of Horticulture Industry, Wonkwang University, Iksan 54538, Republic of Korea
*
Author to whom correspondence should be addressed.
Plants 2022, 11(24), 3580; https://doi.org/10.3390/plants11243580
Submission received: 9 October 2022 / Revised: 7 December 2022 / Accepted: 13 December 2022 / Published: 19 December 2022
(This article belongs to the Section Plant Development and Morphogenesis)
Browse Figures
Review Reports Versions Notes

Abstract

:
Root hairs play crucial roles in the roots, including nutrient uptake, water assimilation, and anchorage with soil, along with supporting rhizospheric microorganisms. In rice, ammonia uptake is mediated by a specialized ammonium transporter (AMT). AMT1;1, AMT1;2, and AMT1;3 have been extensively studied in relation to nitrogen signaling. Cellulose synthase-like D1 (CSLD1) is essential for cell expansion and is highly specific to root hair cells. csld1 mutants showed successful initiation but failed to elongate. However, when nitrogen was depleted, csld1 root hairs resumed elongation. Further experiments revealed that in the presence of ammonium (NH4+), csld1 roots failed to elongate. csld1 elongated normally in the presence of nitrate (NO3−). Expression analysis showed an increase in root hair-specific AMT1;2 expression in csld1. CSLD1 was positively co-expressed with AMT1;2 changing nitrogen concentration in the growth media. CSLD1 showed increased expression in the presence of both ammonium and nitrate. Methylammonium (MeA) treatment of CSLD1 overexpression lines suggests that CSLD1 does not directly participate in nitrogen transport. Further studies on the root hair elongation mutant sndp1 showed that nitrogen assimilation is unlikely to depend on root hair length. Therefore, these results suggest that CSLD1 is closely involved in nitrogen-dependent root hair elongation and regulation of AMT1;2 expression in rice roots.

1. Introduction

Root hairs are tube-like outgrowths of root epidermal cells, a functionally essential part of the root system in plants that serve as the interface for nutrient uptake, water assimilation, and anchorage with soil. Root hairs aid these functions by effectively increasing the contact surface of the plant with the soil–particle interface [1]. Root hair cells are characterized by the release of organic compounds (exudates) into the rhizosphere, which can shape the microbial community around the plant root [2]. Root hairs develop from a group of specific root epidermal cells called trichoblasts, in contrast to atrichoblasts, which are not involved in their formation [3]. However, the arrangements of these cells are species-dependent and can be classified into three types. Type I, such as in rice, where trichoblasts and atrichoblasts are arranged randomly to facilitate a plastic response under alternating surrounding conditions. Type II patterning can be seen in grasses such as Brachypodium, where trichoblasts are derived from asymmetric cell division, larger cells become non-hair-forming cells and smaller cells live to produce root hair. Type III patterning is widely seen in Brassicaceae species such as Arabidopsis, where the hair-forming and non-hair-forming cells are organized as cell files inter-spread with other cell files [1,4,5]. However, cell patterning and cell fate is defined by positional information, not by cell lineage [6]. Root hair development is regulated by genetic and environmental factors. Root hair development occurs in three steps: root hair cell specification, initiation, and elongation. The process of cell growth or elongation is an expansion of the cell wall relative to the protoplast. During expansion, essential components such as cellulose and hemicellulose are synthesized at the plasma membrane. Pectin and xyloglucan were synthesized in the endomembrane. Synthesized materials are transported to the expansion site by vesicles and released (see review) [7]. The first root hairless mutant, rh2, which has yet to be cloned, could recover partially when applied with exogenous NAA (α-naphthaleneacetic acid), indicating a shortage in the endogenous auxin [8]. OsWOX3A controls root hair formation by regulating the auxin transporters [9]. In contrast, the transcription factor OsRHL1, signaling OsFORMIN HOMOLOGY 1 (OsFH1) [10], expansins such as EXPA17 (OsEXPA17) [11], and phosphatidylinositol transfer protein OsSEC14-nodulin domain-containing protein 1 (OsSNDP1) [12] were also found to regulate root hair development.
Plant cell walls mediate essential activities, such as growth, development, and biotic and abiotic responses, and facilitate the cellular communication [13,14,15]. Cell walls are made of complex interactions of biosynthetic enzymes including glycosyl transferase (GT) enzymes that catalyze the formation of glycoside bonds in cell wall glycan polymers [16]. Cellulose, hemicelluloses, and pectins form a complex network in the primary cell walls of most cells to provide mechanical stability [13,17]. CELLULOSE SYNTHASE- LIKE (CSL) family genes are known to synthesize the backbones of hemicelluloses [18,19,20]. CSL genes are a multigene family of proteins that share sequence similarities with cellulose synthase (CESA). Several CSL genes have been identified in various plant species. However, their role in polysaccharide synthesis is not yet fully understood [21]. Cellulose synthase inhibitors cause the expanding cells to rupture due to the weakness of the expanding cell walls to compensate for the expanding protoplast (see review) [7]. All CSL genes in rice are essential for cell wall biosynthesis. CSLDs belong to cellulose synthase and cellulose synthase-like gene superfamily (CESA/CSL). CSLD1 and CSLD4 showed specific expression in radicle and plumule, respectively. CSLD2 expression was observed in all tissues and CSLD3 showed stamen specific expression [22]. In Arabidopsis, highly coordinated expression of GTs such as CSLDs suggests the importance of GTs in cell plant morphogenesis [23]. CSLD1 mutants exhibited defects in pollen tube [24]. CSLD1 is also expressed in trichoblasts before root hair growth and is essential for root hair elongation. Ectopic expression and mutant analysis showed that root hair specification was independent of CSLD1. Moreover, OsCSLD1 displayed sequence and mutant phenotypic similarity to KOJAK/AtCSLD3. KOJAK mutants fail to cause root hair elongation by failing to transport cell wall-related polymers to the root hair expansion site [25].
Nitrogen use efficiency is critical for the productivity of rice crop and the environment. Most nitrogen fertilizer recommendations are based on NH4+ compounds. Developing genotypes with higher nitrogen use efficiency under low nitrogen level is beneficial for the environment and farm economy [26,27]. Root hair formation is highly responsive to nitrogen availability in the surrounding media. Studies related to N-related root hair growth are rapidly emerging [28]. Recently, higher NO3− levels were shown to increase root hair density by suppressing trichoblast elongation in Arabidopsis. This is achieved by the involvement of NRT1;1 and TGA1/4, which regulate the root hair-specific gene CPC [29]. Ammonium transporters play a crucial role in nitrogen uptake from the soil solution to the roots in the form of NH4+. High-affinity ammonium transporters such as AMT1;1, AMT1;2, and AMT1;3 are known to mediate important morphological and physiological responses under various levels of ammonium ion concentrations [30,31,32]. Rice contains three OsAMT2 gene family members: OsAMT1;1 (identical to OsAMT1,1), OsAMT1;2 (identical to OsAMT1,3), and OsAMT1;3 (identical to OsAMT1,2) [31,33,34]. OsAMT1;1 is highly expressed in shoots and can be induced by soil nitrogen. OsAMT1;2 and OsAMT1;3 are strictly expressed in roots. OsAMT1;2 is induced when ammonium is present and OsAMT1;3 is repressed by NO3−, where OsAMT1;3 acts as a sensor for NH4+ ions. In contrast, only AMT1;1 is expressed in the roots in the presence of NO3− [31,33]. Ammonium transporters AMT1;2 were triggered by the introduction of ammonium ions into the roots. In Arabidopsis, CAP1 has shown to regulate root hair tip growth by regulating cytoplasmic Ca2+ gradients along root hair cells. Mutants of CAP1 did not produce normal root hairs on Murashige and Skoog (MS) medium. However, they resumed regular root hair growth when NH4+ was depleted [35]. Moreover, AMT1;2 expression was increased under phosphorus deficiency which indicates a relationship between nutrient availability and AMT1s [36]. Root-hair-specific oscsld1 mutants also exhibited regular root hair initiation and failed to elongate root hair under regular conditions. In this study, we established a relationship between NH4+ and NO3−-mediated CSLD1-dependent root hair elongation in rice (Oryza sativa L.).

2. Results

2.1. NH4+ Suppresses Root Hair Elongation of csld1

Since csld1 mutants successfully initiated root hairs in the seminal roots and only failed to elongate root hairs [25], csld1 mutants were grown without NH4+ and/or NO3− to examine any effect of CSLD1 on nitrogen-mediated root hair elongation. Initially, root hairs failed to elongate in half-MS media and without CaCl2 (Figure 1A and B) but csld1 root hairs demonstrated an increase in length when the supply of NO3− was depleted (Figure 1C). When NH4+ was absent, the roots of csld1 recovered their length to the wild-type root hairs (Figure 1D).
To verify the effect of NH4+ on csld1 root hairs, mutants were grown in NH4+-deficient media. In the absence of NH4+ alone, root hair length of csld1 significantly increased relative to the standard half-MS media counterpart. However, the wild-type roots did not show significant differences between standard and modified half-MS media (Figure 2A,B). Investigation of the expression levels of CSLD genes by qRT-PCR revealed that in wild-type roots, expression of CSLD3 and CSLD4 expression was increased in the presence of NH4+. In csld1 mutants, the expression of CSLD2, CSLD3, and CSLD4 were significantly increased under normal conditions. In the presence of NH4+, the csld1 mutants did not show any significant differences in expression in any other CSLD genes (Figure 2C).
To distinguish the effects of different nitrogen sources on root hair elongation, csld1 mutants were grown in KNO3 and NH4NO3. In the presence of KNO3, csld1 produced root hairs that were similar in lengths that of the wild-type root hairs. On the other hand, when NH4NO3 was added to the media, csld1 mutants showed significant reduction in root hair length (Figure 3A,B). It is noteworthy that the reduction of root hair length in csld1 mutants in the presence of NH4NO3 was similar to the root hair length of the wild-type root hair grown in KCl.
Following the observation from KNO3 and NH4NO3 treatments, wild-type and mutant seedlings were grown in NH4Cl or KNO3 to distinguish the effect of both NH4+ and NO3−. In the presence of NH4+ csld1 mutants showed significant reduction in root hair length when compared with the wild-type root hairs. However, in the presence of NO3−, both wild-type and csld1 root hairs elongated up to twice that of the wild-type root hairs supplemented with NH4+ and showed significant difference (Figure 4A,B), suggesting that csld1 mutants are not sensitive to NO3− but NH4+ and NO3− have more influence on root hair elongation than NH4+.

2.2. CSLD1 and AMT1:2 Show Close Relationship in Activity under Different NH4+ Concentrations

Differential expression of root specific ammonium transporters such as AMT1;2 under different nutrient states were observed in previous studies. To identify any relationship between CSLD1 and the three AMT1s, the expression levels of AMT1 genes were examined in WT and csld1 mutants. In csld1 mutants, only AMT1;2 showed significant increase in expression compared with the wild-type, indicating a negative relationship between AMT1;2 and CSLD1 (Figure 5A).
Under nitrogen starvation, Arabidopsis root hairs show an increased length [37], suggesting a possible significant correlation between nitrogen signaling and csld1 expression. Expression analyses for CSLD1 and AMT1;2 were performed to determine their expression levels under different nitrogen levels. When seedlings were transplanted to 1 mM NH4+ during nitrogen starvation, the initial expression levels of CSLD1 and AMT1;2 were similar. However, AMT1;2 expression was significantly higher than CSLD1 3 h after transfer. After 6 h, both CSLD1 and AMT1;2 expression levels decreased, while AMT1;2 expression was maintained at higher levels and CSLD1 expression was significantly reduced (Figure 5B). However, CSLD1 and AMT1;2 expression levels increased simultaneously, with significantly (but only diverging in one point i.e., 48 h) increasing expression levels when seedlings were transferred from high to low NH4+ levels (Figure 5C). To visualize the expression of CSLD1 in trichoblasts in the presence of NH4+, GUS expression patterns were observed under CSLD1::Ds/CSLD1::Ds (csld1) background. When NH4Cl or KNO3 was applied to 1/10 Johnson’s solution, GUS expression was increased in trichoblasts relative to the controls (KCl), indicating the induction of CSLD1 expression in the presence of NH4+ and NO3− (Figure 6).

2.3. Ammonium Uptake Is not Directly Correlated with Root Hair Length

Similar to oscsld1 root hairs, ossndp1 mutants also exhibited reduced root hair length caused by the depolarization of root hair growth orientation (Figure 7A) [12]. In order to examine the impact of root hair length and roles of OsCSLD1 and OsSNDP1 mutants related to nitrogen transport, each mutant was treated with the toxic analog of ammonia, methyl ammonium (MeA) in MS media. In the absence of MeA, both csld1 and sndp1 seminal root lengths were similar but significantly shorter than the wild-type. However, in the presence of MeA, csld1 seminal roots resisted the effects of MeA. On the other hand, WT and sndp1 seminal roots were susceptible to MeA and showed reduction in root length (Figure 7B,C). When examined for ammonium concentration in roots in MS media, shorter sndp1 roots showed similar concentrations to that of the wild-type. The csld1 roots contained less ammonium than the WT and sndp1 (Figure 7D).

2.4. CSLD1 Is not Directly Involved in Ammonium Uptake but Involved in Ammonium Response

CSLs are characterized to directly involve in cell wall biosynthesis and patterning. On the other hand, AMTs are the primary transporters of ammonia and nitrate. In order to verify the effect of NH4+ or NO3− on root hair growth in AMT1 RNAi mutants in which AMT1;1, AMT1;2, and AMT1;3 were suppressed, seedlings were germinated and grown in half-MS medium with 0.1 mM NH4+ or NO3− (Figure 8A). Mutants showed significantly strong reductions in root hair length and density (Figure 8B,C). In contrast, seedlings grown in 0.1 mM NO3− failed to show any significant difference in root hair length and density (Figure 8D–E).
To further describe the role of CSLD1 in ammonium signaling, CSLD1:OX (Figure 9A) seedlings were grown in methylammonia (MeA). CSLD1:OX lines were sensitive to MeA showing reduction in length and csld1 seminal roots showed no response to MeA when compared with wild-type seminal roots (Figure 9B,D). However, AMT1;2:OX lines showed a dramatic reduction in seminal root length relative to the wild-type in the presence of MeA (Figure 9C,E). This observation was further validated when csld1 and CSLD1:OX seedlings were grown in MeA where csld1 seminal roots showed relatively long lengths under increasing MeA concentration (Figure S1). This indicates a strong resistance of csld1 for MeA and enhanced susceptibility of CSLD1:OX.

3. Discussion

Among all the mineral necessities plants have developed to adopt, nitrogen plays a key role in all kinds of plant growth and development [38,39,40,41,42]. Among the major N sources in soil, such as nitrate and ammonia, the former tends to be most abundant in aerobic environments, and the latter is abundant in flooded conditions [43]. Higher levels of ammonia in anaerobic soils are highly toxic to plants. Rice plants have developed a well-regulated equilibrium of direct ammonia uptake mechanisms using ammonium transporters (AMT) to avoid the toxic effects of ammonia accumulation [44].
Initial experiments with csld1, NH4+, and NO3− suggested that ammonium ions significantly suppressed root hair elongation and nitrate ions enhanced the elongation of root hair even in the presence of ammonium ions, indicating that CSLD1 promotes root elongation in the presence of NH4+ rather than NO3− (Figure 1 and Figure 2A,B). A similar observation was observed in Arabidopsis Atrop11CA mutants [45]. CSLDs are essential for root hair and pollen tube growth in Arabidopsis and synthesize polysaccharides essential for the cell wall structure in tip-growing cells [24]. Expression analysis of other CSLD genes suggested that CSLD1, CSLD3, and CSLD4 showed increased activity in the absence of NH4+. In csld1 mutants, CSLD2, CSLD3, and CSLD4 showed increased expression but reduced expression when NH4+ was absent (Figure 2C). Based on these results, it is highly likely that CSLD1 promotes the expression of other CSLDs when NH4+ was absent and suppresses other CSLDs when ammonia is present. Moreover, it is possible that CSLD1 does not conduct a regulative process alone. Root morphology can be shaped by the direct and indirect effects of NH4+ and NO3− [46]. When NH4+ and NO3− were present in the media, csld1 mutants showed significant reduction in root hair length. When NO3− was present, root hair length was similar to the wild-type. When NH4+ showed strong suppression of root hair length on csld1 mutants, wild-type root hair also showed significant reduction in length but not up to the degree of csld1 root hair length (Figure 3 and Figure 4A,B). It is evident that both NH4+ and NO3− produce opposite signals for root hair elongation where NH4+ results in suppressing signals and NO3− results in promoting signals. Both signals converge into the same regulatory pathway to elongate root hair in a dose-dependent manner.
AMT1s act as sensors for ammonium sources available in the media [47]. AMT1;1, AMT1;2, and AMT1;3 are the most essential physiological and morphological responses to external N signals. Overexpression of AMT1;1 presented improved growth and yield [33]. In contrast, overexpression of AMT1;3 reduced the performance [48]. Current experiments with AMT1 mutants revealed that the mutants had poorly elongated roots in the presence of NH4+. However, these mutants did not respond to NO3−. Csld1 mutants showed increased expression of AMT1;2, suggesting that CSLD1 is a negative regulator of root hair-specific AMT1;2 expression. The expression dynamics of CSLD1 and AMT1;2 showed similar patterns. When plants were exposed to NH4+ after N starvation, both CSLD1 and AMT1;2 showed higher activity indicating CSLD1 and AMT1;2 coupled response in progress. Similar patterns were observed for CSLD1 and AMT1;2 when plants were transferred from high-to low-N medium, where the expression progressively increased up to 72 h after transfer.
Experiments on roots with GUS staining revealed that when presented with NH4+ or NO3−, CSLD1 showed activity limited to trichoblast cells. This observation is in agreement with previous studies in regular conditions, CSLD1 is expressed in root hair cells [25]. Unlike CSLD1, the short root hair mutant sndp1 [12] showed hindered root hair elongation when grown in MeA media and csld1 showed strong resistance to MeA treatment relative to wild-type. This suggests that CSLD1 is involved in the ammonia response process. It is noteworthy that sndp1 had ammonium concentrations similar to those of the wild-type. csld1 had lower ammonium concentrations, implying that root hair length does not affect ammonium content or ammonium absorption capacity of root hair.
The toxic ammonia analog, methyl-ammonium (MeA), can be used to identify ammonium transport [49,50]. Overexpression of ammonium-inducible AMT1;2 is highly sensitive to MeA. CSLD1 overexpressing lines showed higher degree of susceptibility to MeA and csld1 mutants showed significant resistance to MeA, indicating that CSLD1 is not a part of ammonium uptake (Figure 9). These observations were further validated when csld1 and CSLD1:OX lines were grown in the presence of MeA. In this case, csld1 seminal roots remained longer than wild-type and CSLD1:OX roots when exposed to increasing concentrations of MeA (Figure S1). The results from these experiments suggest that CSLD1 is involved in the response to NH4+-triggered root hair elongation. These results also indicate that, unlike AMT1s, CSLD1 is not directly involved in N signaling in rice. Further studies are necessary to explore the possibility of CSLD1 interacting with AMT1s and the role of N signals in the dynamics of AMT1s and CSLD1 related to root hair elongation. Current experiments suggest that the length of root hair is not related to nitrogen uptake in in vitro conditions. However, the conditions in soil can be different and root hair length may play a significant role in nitrogen uptake in soil. Studies must be also done to explore possible tools increase the nitrogen use efficiency by varying root hair length.

4. Materials and methods

4.1. Mutant Materials

A large-scale Ds transposon population was generated by regenerating gene trap Ds starter lines transferred by Ac via tissue culture [51]. Previously characterized csdl1 and sndp1 seeds from the gene trap mutants were kindly provided by Han’s lab, Gyeongsang University, Republic of Korea [12,25].

4.2. Plant Materials and Growth Conditions

The japonica cultivar Dongjin (WT; Wild-type), csld1, 35s::CSLD1, three 5′ AMT1 RNAi lines (3-1 and 5-2), and sndp1 were used in the experiments. Rice seeds were surface-sterilized with 0.05% SPORTEX and germinated for three days in the dark. Uniformly germinated seedlings were selected and cultured hydroponically in different nutrient solutions [¼ MS (Murashige and Skoog), ¼ KB (Kimura B), and ¼ NS (Nutrient Solution)] containing NH4+ or NO3− as the sole nitrogen source. Media compositions were obtained from previous studies [46,52,53]. Hydroponic nutrient solutions were replaced with fresh media every two days for two weeks. Roots were examined after culturing for 14 days in a growth chamber under the following conditions: 16/8 h light/dark, light intensity 280 μmol m−2 s−1, temperature 26 °C/18 °C, and 70% humidity. To measure the expression levels of three OsAMT1 (1;1, 1;2, and 1;3) and four CSLD (CSLD1, CSLD2, CSLD3, and CSLD4) genes, WT and csld1, seedlings were grown hydroponically in ¼ nutrient medium supplemented with 0.5 mM NO3− or 0.5 mM NH4+ for seven days. Total cellular RNAs were extracted from roots. For the media shift assays, germinated seeds were cultured in modified ¼ NS containing 0.1 mM NH4NO3 for seven days. The samples were transferred and cultured in a nutrient solution containing no NH4NO3 for nitrogen starvation and for moving low to high nitrogen medium. Germinated seeds were first grown in 0.1 mM NH4NO3, moved to 1 mM, and 10 mM NH4NO3 containing media after seven days. The same solutions were replaced with fresh medium every two days.

4.3. Isolation of Full-Length cDNA of CSLD1 and Agrobacterium Transformation

The 4.0-kb full-length OsCSLD1 cDNA was isolated by PCR amplification using primers OsCSLD1-5#SpeI (ACTAGTATGGCGTCGAAGGGCATCCTC-AAG) and OsCSLD1-3#SpeI (ACTAGTCCAGGGGAAAGAGAAGGATCC-TCC). The PCR product was ligated into a pGEM-T vector (Promega; Madison, WI, USA) and sequenced. A 3.4-kb fragment was excised from the vector by SpeI digestion and ligated into the corresponding site of pCAMBIA1302. Full-length OsCSLD1 cDNA was fused with GFP at its 3′ end and expressed under the cauliflower mosaic virus 35S promoter and nopaline synthase 3′ terminator. Calli of rice (Dongjin) were transformed with Agrobacterium LEA4404 carrying pCAMBIA (35S::OsCSLD1). Rice calli (Dongjin) were transformed with T-DNA carrying the hygromycin phosphotransferase gene as previously described method [54], with slight modifications.

4.4. Construction of AMT1 RNAi Vector

To generate AMT1;1 RNAi transgenic plants, 5′ and 3′ fragments of the AMT1;1 ORF were amplified using the following primer sets: Ri5-F (gagctcggtaccctcgccgcgcacgtcatccag) and Ri5-R (gaattcctgcaggcatgtgcttgaggccgaaga) and Ri3-F (gagctcggtaccctcgcggcgcacatcgtgcag) and Ri3-R (gaattcctgcagttacacttggttgttgctgtt), respectively. The PCR products were digested and cloned into EcoRI and SacI sites for sense orientation insertion and KpnI and XhoI sites for antisense orientation insertion in a pBluscript-catalase intron vector. After sequencing, whole inserts were cloned into SacI and KpnI sites of PGA1611 binary vector.

4.5. Generation of AMT1 RNAi Transgenic Lines

AMT1 RNAi transgenic lines were generated from japonica rice cultivar “Dongjin” via Agrobacterium (LBA4404 strain)-mediated transformation using calli derived from dry seeds [55]. The following transgenic lines were selected and propagated: 5′ AMT1 RNAi lines 5-2 (Ri 5-2 and Ri 3-1 respectively).

4.6. Generation of Transgenic Overexpression Plants

To generate plants overexpressing AMT1;2, ORFs were cloned into BamHI and HindIII restriction sites of the pGA1611 binary vector to produce pGA1611-AMT1;2, in which AMT1;2 was expressed under the control of the UBIQUITIN promoter. Rice calli were transformed with pGA1611-AMT1;2 using Agrobacterium-mediated transformation.

4.7. Histochemical Analysis

β-Glucuronidase (GUS) activity was visualized by incubating 5-bromo-4-chloro-3-indoyl glucuronide solution (1 mg mL− 1). The solution contained 50 mM sodium phosphate buffer (pH 7.0), 10 mM EDTA, 0.1% Triton, 2 mM potassium ferrocyanide, and 200 mg/mL chloramphenicol. Samples were incubated at 37 °C for two days in the dark and dehydrated in a 30 to 70% graded ethanol series. GUS-stained samples were dehydrated and embedded in paraffin wax using the method described above. For toluidine blue staining, roots grown on 0.5 X MS medium were stained with 0.1% aqueous toluidine blue for 2 min and washed with distilled water. The roots on the slides were inspected under a light microscope [25].

4.8. RNA Extraction and qRT-PCR

Total cellular RNA was isolated using a Qiagen RNeasy Mini Kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions. RNA concentration was measured using a NanoDrop ND-1000 spectrophotometer. The samples were treated with RQ-RNase-free DNase (Promega, Madison, WI, USA). An RNaseH (Toyobo, https://www.toyobo-global.com/) reverse transcription kit was used to synthesize cDNA, according to the manufacturer’s instructions (Promega). qRT-PCR was performed using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). Amplification and quantification were performed with gene-specific primers using CFX Manager software (Bio-Rad), and values were normalized against internal UBIQ1. Three biological and two technical replicates were used for each analysis [46]. All the primers used for qRT-PCR are listed in Table S1.

4.9. RT-PCR Analysis

To detect OsCSLD1 cDNA from the samples, gene-specific primers (forward 5-TCGCCGCCGAACAAGATC-3 and reverse 5-CGGACCACTTGATCTCCAG-3) were used. RT-PCR was performed at 94 °C for 5 min, followed by 25 cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min. The PCR products were fractionated on agarose gels, stained with ethidium bromide, blotted to Hybond N1 (Amersham Pharmacia Biotech, Amersham, United Kingdom), and hybridized with a 32P-labeled OsCSLD1 probe [25].

4.10. Root Hair Length Measurements

Five-day-old roots of rice plants grown in 1/2 MS solution were observed. The root images were captured with an Olympus SZX12 stereomicroscope system. Images were processed and analyzed using the ImageJ software version 1.53k (National institute of health, Bethesda, MD, USA, http://rsbweb.nih.gov/ij/).

4.11. Ammonium Content Determination

Determination of NH4+ content in the roots by enzymatic digestion was performed using an F-kit (Roche) following the manufacturer’s instructions [56].

4.12. Methylammonium (MeA) Treatment

Evenly germinated seeds were hydroponically grown in modified full nutrient (FN) medium (2 mM NH4NO3, 1 mM KH2PO4, 1 mM MgSO4, 250 mM K2SO4, 250 mM CaCl2, 100 mM NaFe-EDTA, 50 mM KCl, 50 mM H3BO3, 5 mM MnSO4, 1 mM ZnSO4, 1 mM CuSO4, 1 mM NaMoO4, and 1 mM MES, pH 5.8 [KOH]) [57] supplemented with different concentrations of MeA (0, 1, 2.5, and 5.0 mM). Root length, shoot height, and dry weight were analyzed after sampling for 10 days.

4.13. Statistical Analysis

All experiments were completely randomized and at least eight replicates were used for the quantitative experiments. Data shown in the figures are expressed in average ±SD (standard deviations) of each group. Quantitative data were analyzed using the JMP 16.0.0 software package (SAS Institute, Cary, NC, USA). All statistical comparisons were performed using the “Fit Y by X” function. A one-way ANOVA followed by Tukey HSD was used to visualize the significance among the experimental groups means at the probability level of p < 0.05.

5. Conclusions

CSLD1 mediates ammonia-triggered root hair elongation in rice. Moreover, CSLD1 also suppresses root hair-specific AMT1;2 and coexpressed with AMT1;2 when nitrogen concentration regimes change. The expression of CSLD1 is confined to trichoblast cells and occurs under both ammonia and nitrate signals. Results with short root hair mutants, such as sndp1, showed that root hair length did not affect the absorption of nitrogen in root hairs. Further experiments using MeA suggested that CSLD1 does not directly participate in ammonium absorption. However, it is noteworthy that the mutants and overexpression lines of CSLD1 showed minor differences in seminal root length. These results suggest that NH4+ can elongate root hair via CSLD1. Further studies are required to understand the mechanism of ammonia-triggered CSLD1-mediated root hair elongation.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11243580/s1, Table S1. Primers list used for qRT-PCR to quantify transcripts of AMT1s, and OsCSLDs transcript levels. Figure S1: CSLD1:OX lines are sensitive to Methylammonium (MeA). (a) Wild-type, csld1 and CSLD1:OX seedlings grown in MeA free and 2.5 mM MeA treated seminal root lengths. (b) WT, csld1 and CSLD1:OX seminal root lengths in 0 to 5 mM MeA. (c) Relative lengths of MeA treated seminal roots compared to non-treated root lengths. Scale bars = 1cm. line graph show mean values ± standard error of means (n = 10).

Author Contributions

Conceptualization, C.M.K.; formal analysis, C.M.K. and S.R.; investigation, C.M.K. and S.R.; methodology, C.M.K. resources, C.M.K.; supervision, C.M.K..; validation C.M.K. and S.R.; writing, review and editing C.M.K. and S.R. All authors have read and agreed to the published version of the manuscript.

Funding

This paper was supported by Wonkwang University in 2020.

Data Availability Statement

Data are available by contacting the corresponding author.

Acknowledgments

We thank Wonkwang University for supporting this paper.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gilroy, S.; Jones, D.L. Through form to function: Root hair development and nutrient uptake. Trends Plant Sci. 2000, 5, 56–60. [Google Scholar] [CrossRef] [PubMed]
  2. Badri, D.V.; Vivanco, J.M. Regulation and function of root exudates. Plant Cell Environ. 2009, 32, 666–681. [Google Scholar] [CrossRef] [PubMed]
  3. Landsberg, E.C. Hormonal regulation of iron-stress response in sunflower roots: A morphological and cytological investigation. Protoplasma 1996, 194, 69–80. [Google Scholar] [CrossRef]
  4. Salazar-Henao, J.E.; Vélez-Bermúdez, I.C.; Schmidt, W. The regulation and plasticity of root hair patterning and morphogenesis. Development 2016, 143, 1848–1858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Marzec, M.; Melzer, M.; Szarejko, I. The evolutionary context of root epidermis cell patterning in grasses (Poaceae). Plant Signal. Behav. 2014, 9, e27972. [Google Scholar] [CrossRef] [Green Version]
  6. Berger, F.; Hung, C.Y.; Dolan, L.; Schiefelbein, J. Control of cell division in the root epidermis of Arabidopsis thaliana. Dev. Biol. 1998, 194, 235–245. [Google Scholar] [CrossRef] [Green Version]
  7. Foreman, J.; Dolan, L. Root hairs as a model system for studying plant cell growth. Ann. Bot. 2001, 88, 1–7. [Google Scholar] [CrossRef] [Green Version]
  8. Suzuki, N.; Taketa, S.; Ichii, M. Morphological and physiological characteristics of a root-hairless mutant in rice (Oryza sativa L.). Plant Soil 2003, 255, 9–17. [Google Scholar] [CrossRef]
  9. Yoo, S.-C.; Cho, S.-H.; Paek, N.-C. Rice WUSCHEL-related homeobox 3A (OsWOX3A) modulates auxin-transport gene expression in lateral root and root hair development. Plant Signal. Behav. 2013, 8, e25929. [Google Scholar] [CrossRef] [Green Version]
  10. Huang, J.; Kim, C.M.; Xuan, Y.-H.; Liu, J.; Kim, T.H.; Kim, B.-K.; Han, C.-D. Formin homology 1 (OsFH1) regulates root-hair elongation in rice (Oryza sativa). Planta 2013, 237, 1227–1239. [Google Scholar] [CrossRef]
  11. ZhiMing, Y.; Bo, K.; XiaoWei, H.; ShaoLei, L.; YouHuang, B.; WoNa, D.; Ming, C.; Hyung-Taeg, C.; Ping, W. Root hair-specific expansins modulate root hair elongation in rice. Plant J. 2011, 66, 725–734. [Google Scholar] [CrossRef] [PubMed]
  12. Huang, J.; Kim, C.M.; Xuan, Y.-H.; Park, S.J.; Piao, H.L.; Je, B.I.; Liu, J.; Kim, T.H.; Kim, B.-K.; Han, C.-D. OsSNDP1, a Sec14-nodulin domain-containing protein, plays a critical role in root hair elongation in rice. Plant Mol. Biol. 2013, 82, 39–50. [Google Scholar] [CrossRef] [PubMed]
  13. Carpita, N.C.; Gibeaut, D.M. Structural models of primary cell walls in flowering plants: Consistency of molecular structure with the physical properties of the walls during growth. Plant J. 1993, 3, 1–30. [Google Scholar] [CrossRef] [PubMed]
  14. Pauly, M.; Keegstra, K. Plant cell wall polymers as precursors for biofuels. Curr. Opin. Plant Biol. 2010, 13, 304–311. [Google Scholar] [CrossRef] [PubMed]
  15. Malinovsky, F.G.; Fangel, J.U.; Willats, W.G.T. The role of the cell wall in plant immunity. Front. Plant Sci. 2014, 5, 178. [Google Scholar] [CrossRef] [Green Version]
  16. Scheible, W.R.; Pauly, M. Glycosyltransferases and cell wall biosynthesis: Novel players and insights. Curr. Opin. Plant Biol. 2004, 7, 285–295. [Google Scholar] [CrossRef]
  17. Cosgrove, D.J. Growth of the plant cell wall. Nat. Rev. Mol. Cell Biol. 2005, 6, 850–861. [Google Scholar] [CrossRef]
  18. Dhugga, K.S.; Barreiro, R.; Whitten, B.; Stecca, K.; Hazebroek, J.; Randhawa, G.S.; Dolan, M.; Kinney, A.J.; Tomes, D.; Nichols, S.; et al. Guar Seed β-Mannan Synthase Is a Member of the Cellulose Synthase Super Gene Family. Science 2004, 303, 363–366. [Google Scholar] [CrossRef]
  19. Liepman, A.H.; Wilkerson, C.G.; Keegstra, K. Expression of cellulose synthase-like (Csl) genes in insect cells reveals that CslA family members encode mannan synthases. Proc. Natl. Acad. Sci. USA 2005, 102, 2221–2226. [Google Scholar] [CrossRef] [Green Version]
  20. Cocuron, J.C.; Lerouxel, O.; Drakakaki, G.; Alonso, A.P.; Liepman, A.H.; Keegstra, K.; Raikhel, N.; Wilkerson, C.G. A gene from the cellulose synthase-like C family encodes a β-1,4 glucan synthase. Proc. Natl. Acad. Sci. USA 2007, 104, 8550–8555. [Google Scholar] [CrossRef]
  21. Daras, G.; Templalexis, D.; Avgeri, F.; Tsitsekian, D.; Karamanou, K.; Rigas, S. Updating Insights into the Catalytic Domain Properties of Plant Cellulose synthase (CesA) and Cellulose synthase-like (Csl) Proteins. Molecules 2021, 26, 4335. [Google Scholar] [CrossRef] [PubMed]
  22. Wang, L.; Guo, K.; Li, Y.; Tu, Y.; Hu, H.; Wang, B.; Cui, X.; Peng, L. Expression profiling and integrative analysis of the CESA/CSL superfamily in rice. BMC Plant Biol. 2010, 10, 282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Yang, W.; Schuster, C.; Beahan, C.T.; Charoensawan, V.; Peaucelle, A.; Bacic, A.; Doblin, M.S.; Wightman, R.; Meyerowitz, E.M. Regulation of Meristem Morphogenesis by Cell Wall Synthases in Arabidopsis. Curr. Biol. 2016, 26, 1404–1415. [Google Scholar] [CrossRef] [Green Version]
  24. Bernal, A.J.; Yoo, C.M.; Mutwil, M.; Jensen, J.K.; Hou, G.; Blaukopf, C.; Sørensen, I.; Blancaflor, E.B.; Scheller, H.V.; Willats, W.G.T. Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2, and CSLD4 in tip-growing arabidopsis cells. Plant Physiol. 2008, 148, 1238–1253. [Google Scholar] [CrossRef] [Green Version]
  25. Kim, C.M.; Park, S.H.; Je, B.I.; Park, S.H.; Park, S.J.; Piao, H.L.; Eun, M.Y.; Dolan, L.; Han, C.-D. OsCSLD1, a Cellulose Synthase-Like D1 Gene, is Required for Root Hair Morphogenesis in Rice. Plant Physiol. 2007, 143, 1220–1230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Fillery, I.R.P.; Simpson, J.R.; De Datta, S.K. Influence of Field Environment and Fertilizer Management on Ammonia Loss from Flooded Rice. Soil Sci. Soc. Am. J. 1984, 48, 914–920. [Google Scholar] [CrossRef]
  27. Hakeem, K.R.; Ahmad, A.; Iqbal, M.; Gucel, S.; Ozturk, M. Nitrogen-efficient rice cultivars can reduce nitrate pollution. Environ. Sci. Pollut. Res. 2011, 18, 1184–1193. [Google Scholar] [CrossRef]
  28. Jia, Z.; von Wirén, N. Signaling pathways underlying nitrogen-dependent changes in root system architecture: From model to crop species. J. Exp. Bot. 2020, 71, 4393–4404. [Google Scholar] [CrossRef]
  29. Canales, J.; Contreras-López, O.; Álvarez, J.M.; Gutiérrez, R.A. Nitrate induction of root hair density is mediated by TGA1/TGA4 and CPC transcription factors in Arabidopsis thaliana. Plant J. 2017, 92, 305–316. [Google Scholar] [CrossRef] [Green Version]
  30. Britto, D.T.; Kronzucker, H.J. NH4+ toxicity in higher plants: A critical review. J. Plant Physiol. 2002, 159, 567–584. [Google Scholar] [CrossRef]
  31. Suenaga, A.; Moriya, K.; Sonoda, Y.; Ikeda, A.; Von Wirén, N.; Hayakawa, T.; Yamaguchi, J.; Yamaya, T. Constitutive expression of a novel-type ammonium transporter OsAMT2 in rice plants. Plant Cell Physiol. 2003, 44, 206–211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Ranathunge, K.; El-Kereamy, A.; Gidda, S.; Bi, Y.M.; Rothstein, S.J. AMT1;1 transgenic rice plants with enhanced NH4+ permeability show superior growth and higher yield under optimal and suboptimal NH4+ conditions. J. Exp. Bot. 2014, 65, 965–979. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Sonoda, Y.; Ikeda, A.; Saiki, S.; von Wirén, N.; Yamaya, T.; Yamaguchi, J. Distinct expression and function of three ammonium transporter genes (OsAMT1;1–1;3) in rice. Plant Cell Physiol. 2003, 44, 726–734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Gazzarrini, S.; Lejay, L.; Gojon, A.; Ninnemann, O.; Frommer, W.B.; von Wirén, N. Three functional transporters for constitutive, diurnally regulated, and starvation-induced uptake of ammonium into Arabidopsis roots. Plant Cell 1999, 11, 937–947. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Bai, L.; Ma, X.; Zhang, G.; Song, S.; Zhou, Y.; Gao, L.; Miao, Y.; Song, C.-P. A receptor-like kinase mediates ammonium homeostasis and is important for the polar growth of root hairs in Arabidopsis. Plant Cell 2014, 26, 1497–1511. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Tanaka, N.; Kato, M.; Tomioka, R.; Kurata, R.; Fukao, Y.; Aoyama, T.; Maeshima, M. Characteristics of a root hair-less line of Arabidopsis thaliana under physiological stresses. J. Exp. Bot. 2014, 65, 1497–1512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Engineer, C.B.; Kranz, R.G. Reciprocal leaf and root expression of AtAmt1.1 and root architectural changes in response to nitrogen starvation. Plant Physiol. 2007, 143, 236–250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Schachtman, D.P.; Shin, R. Nutrient sensing and signaling: NPKS. Annu. Rev. Plant Biol. 2007, 58, 47–69. [Google Scholar] [CrossRef]
  39. Yuan, L.; Loqué, D.; Kojima, S.; Rauch, S.; Ishiyama, K.; Inoue, E.; Takahashi, H.; von Wirén, N. The organization of high-affinity ammonium uptake in Arabidopsis roots depends on the spatial arrangement and biochemical properties of AMT1-type transporters. Plant Cell 2007, 19, 2636–2652. [Google Scholar] [CrossRef] [Green Version]
  40. Hoffland, E.; Jeger, M.J.; Van Beusichem, M.L. Effect of nitrogen supply rate on disease resistance in tomato depends on the pathogen. Plant Soil 2000, 218, 239–247. [Google Scholar] [CrossRef]
  41. Sinfield, J.V.; Fagerman, D.; Colic, O. Evaluation of sensing technologies for on-the-go detection of macro-nutrients in cultivated soils. Comput. Electron. Agric. 2010, 70, 1–18. [Google Scholar] [CrossRef]
  42. Krouk, G.; Lacombe, B.; Bielach, A.; Perrine-Walker, F.; Malinska, K.; Mounier, E.; Hoyerova, K.; Tillard, P.; Leon, S.; Ljung, K.; et al. Nitrate-regulated auxin transport by NRT1.1 defines a mechanism for nutrient sensing in plants. Dev. Cell 2010, 18, 927–937. [Google Scholar] [CrossRef] [PubMed]
  43. Ho, C.H.; Tsay, Y.F. Nitrate, ammonium, and potassium sensing and signaling. Curr. Opin. Plant Biol. 2010, 13, 604–610. [Google Scholar] [CrossRef] [PubMed]
  44. Britto, D.T.; Siddiqi, M.Y.; Glass, A.D.M.; Kronzucker, H.J. Futile transmembrane NH4+ cycling: A cellular hypothesis to explain ammonium toxicity in plants. Proc. Natl. Acad. Sci. USA 2001, 98, 4255–4258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Bloch, D.; Monshausen, G.; Singer, M.; Gilroy, S.; Yalovsky, S. Nitrogen source interacts with ROP signalling in root hair tip-growth. Plant Cell Environ. 2011, 34, 76–88. [Google Scholar] [CrossRef]
  46. Kumar, V.; Kim, S.H.; Priatama, R.A.; Jeong, J.H.; Adnan, M.R.; Saputra, B.A.; Kim, C.M.; Je, B.I.; Park, S.J.; Jung, K.H.; et al. NH4+ Suppresses NO3—Dependent Lateral Root Growth and Alters Gene Expression and Gravity Response in OsAMT1 RNAi Mutants of Rice (Oryza sativa). J. Plant Biol. 2020, 63, 391–407. [Google Scholar] [CrossRef]
  47. Gaur, V.S.; Singh, U.S.; Gupta, A.K.; Kumar, A. Understanding the differential nitrogen sensing mechanism in rice genotypes through expression analysis of high and low affinity ammonium transporter genes. Mol. Biol. Rep. 2012, 39, 2233–2241. [Google Scholar] [CrossRef]
  48. Bao, A.; Liang, Z.; Zhao, Z.; Cai, H. Overexpressing of OsAMT1-3, a high affinity ammonium transporter gene, modifies rice growth and carbon-nitrogen metabolic status. Int. J. Mol. Sci. 2015, 16, 9037–9063. [Google Scholar] [CrossRef] [Green Version]
  49. Wood, C.C.; Porée, F.; Dreyer, I.; Koehler, G.J.; Udvardi, M.K. Mechanisms of ammonium transport, accumulation, and retention in ooyctes and yeast cells expressing Arabidopsis AtAMT1;1. FEBS Lett. 2006, 580, 3931–3936. [Google Scholar] [CrossRef] [Green Version]
  50. Mayer, M.; Ludewig, U. Role of AMT1;1 in NH4+ acquisition in Arabidopsis thaliana. Plant Biol. 2006, 8, 522–528. [Google Scholar] [CrossRef]
  51. Kim, C.M.; Piao, H.L.; Park, S.J.; Chon, N.S.; Je, B.I.; Sun, B.; Park, S.H.; Park, J.Y.; Lee, E.J.; Kim, M.J.; et al. Rapid, large-scale generation of Ds transposant lines and analysis of the Ds insertion sites in rice. Plant J. 2004, 39, 252–263. [Google Scholar] [CrossRef] [PubMed]
  52. Murashige, T.; Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
  53. Chen, R.F.; Shen, R.F.; Gu, P.; Dong, X.Y.; Du, C.W.; Ma, J.F. Response of rice (Oryza sativa) with root surface iron plaque under aluminium stress. Ann. Bot. 2006, 98, 389–395. [Google Scholar] [CrossRef]
  54. Hiei, Y.; Ohta, S.; Komari, T.; Kumashiro, T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 1994, 6, 271–282. [Google Scholar] [CrossRef] [Green Version]
  55. Chin, H.G.; Choe, M.S.; Lee, S.-H.; Park, S.H.; Park, S.H.; Koo, J.C.; Kim, N.Y.; Lee, J.J.; Oh, B.G.; Yi, G.H.; et al. Molecular analysis of rice plants harboring an Ac/Ds transposable element-mediated gene trapping system. Plant J. 1999, 19, 615–623. [Google Scholar] [CrossRef] [Green Version]
  56. Oliveira, I.C.; Brears, T.; Knight, T.J.; Clark, A.; Coruzzi, G.M. Overexpression of cytosolic glutamine synthetase. Relation to nitrogen, light, and photorespiration. Plant Physiol. 2002, 129, 1170–1180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Chaudhuri, B.; Hörmann, F.; Lalonde, S.; Brady, S.M.; Orlando, D.A.; Benfey, P.; Frommer, W.B. Protonophore- and pH-insensitive glucose and sucrose accumulation detected by FRET nanosensors in Arabidopsis root tips. Plant J. 2008, 56, 948–962. [Google Scholar] [CrossRef]
Plants 11 03580 g001 550
Figure 1. The csld1 mutants were recovered under nitrogen depletion. Root hair length of wild-type (WT) and oscsld1 RNAi mutants grown in (A) Half-MS medium, (B) Half-MS medium without CaCl2, (C) Half-MS medium without KNO3, and (D) Half-MS medium without NH4NO3. Scale bars = 500 μm.
Figure 1. The csld1 mutants were recovered under nitrogen depletion. Root hair length of wild-type (WT) and oscsld1 RNAi mutants grown in (A) Half-MS medium, (B) Half-MS medium without CaCl2, (C) Half-MS medium without KNO3, and (D) Half-MS medium without NH4NO3. Scale bars = 500 μm.
Plants 11 03580 g001
Plants 11 03580 g002 550
Figure 2. CSLD1 mutants showed reduction in root hair length and altered the expressions of CSLD2/3 in the absence of NH4+. (A) and (B) Root hair length of WT and oscsld1 mutants in MS and modified MS medium without NH4+. (C) Relative expression of CSLD1, CSLD2, CSLD3, and CSLD4 in WT and oscsld1 mutants in MS and modified MS medium without NH4+. Scale bars = 500 μm. Bar graphs show mean values ± standard error of means (n = 9). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Figure 2. CSLD1 mutants showed reduction in root hair length and altered the expressions of CSLD2/3 in the absence of NH4+. (A) and (B) Root hair length of WT and oscsld1 mutants in MS and modified MS medium without NH4+. (C) Relative expression of CSLD1, CSLD2, CSLD3, and CSLD4 in WT and oscsld1 mutants in MS and modified MS medium without NH4+. Scale bars = 500 μm. Bar graphs show mean values ± standard error of means (n = 9). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Plants 11 03580 g002
Plants 11 03580 g003 550
Figure 3. csld1 root hair failed to elongate in the presence of NH4+. (A) Seminal roots of wild-type and csld1 mutants grown in 1 mM KCl, KNO3, and NH4NO3, respectively, and (B) quantification of root hair length. Scale bars = 500 μm. Bar graph show mean values ± standard error of means (n = 8). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Figure 3. csld1 root hair failed to elongate in the presence of NH4+. (A) Seminal roots of wild-type and csld1 mutants grown in 1 mM KCl, KNO3, and NH4NO3, respectively, and (B) quantification of root hair length. Scale bars = 500 μm. Bar graph show mean values ± standard error of means (n = 8). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Plants 11 03580 g003
Plants 11 03580 g004 550
Figure 4. CSLD1 promotes root hair elongation in the presence of NH4+. (A) Seminal roots of wild-type and csld1 mutants grown in 1 mM KCl, KNO3, and NH4NO3 and (B) quantification of root hair length. Scale bars = 500 μm. Bar graph show mean values ± standard error of means (n = 8). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Figure 4. CSLD1 promotes root hair elongation in the presence of NH4+. (A) Seminal roots of wild-type and csld1 mutants grown in 1 mM KCl, KNO3, and NH4NO3 and (B) quantification of root hair length. Scale bars = 500 μm. Bar graph show mean values ± standard error of means (n = 8). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Plants 11 03580 g004
Plants 11 03580 g005 550
Figure 5. Ammonium-dependent expression patterns of CSLD1 and AMT1;2. (A) Relative expression patterns of AMT1;1, AMT1;2, and AMT1;3 in root hair in csld1 mutants. (B) Expression pattern of CSLD1 and AMT1;2 when transferred from nitrogen starvation to 1 mM NH4NO3 and (C) when transferred from high (10 mM) to low (1 mM) concentration of NH4NO3. Bar graphs show mean values ± standard error of means (n = 3). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Figure 5. Ammonium-dependent expression patterns of CSLD1 and AMT1;2. (A) Relative expression patterns of AMT1;1, AMT1;2, and AMT1;3 in root hair in csld1 mutants. (B) Expression pattern of CSLD1 and AMT1;2 when transferred from nitrogen starvation to 1 mM NH4NO3 and (C) when transferred from high (10 mM) to low (1 mM) concentration of NH4NO3. Bar graphs show mean values ± standard error of means (n = 3). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Plants 11 03580 g005
Plants 11 03580 g006 550
Figure 6. GUS patterns in CSLD1::Ds/CSLD1::Ds (csld1) roots in different nutrient supplementations. (A) The GUS staining of the whole seminal root supplemented with 1 mM KCl and (B) 100× magnification of KCl-treated seminal root trichoblast cells. (C) Staining of seminal root supplemented with 1 mM NH4Cl and (D) 100× magnification of NH4Cl-treated seminal root trichoblast cells. (E) 100× magnification of KNO3-treated seminal root trichoblast cells. Red bars indicate the root sections which were used to capture magnified images. Scale bars: A,C; 500 μm and B,D,E; 50 μm.
Figure 6. GUS patterns in CSLD1::Ds/CSLD1::Ds (csld1) roots in different nutrient supplementations. (A) The GUS staining of the whole seminal root supplemented with 1 mM KCl and (B) 100× magnification of KCl-treated seminal root trichoblast cells. (C) Staining of seminal root supplemented with 1 mM NH4Cl and (D) 100× magnification of NH4Cl-treated seminal root trichoblast cells. (E) 100× magnification of KNO3-treated seminal root trichoblast cells. Red bars indicate the root sections which were used to capture magnified images. Scale bars: A,C; 500 μm and B,D,E; 50 μm.
Plants 11 03580 g006
Plants 11 03580 g007 550
Figure 7. Differences in root hair length did not affect the nitrogen concentration in roots. (A) Seminal roots of wild-type, csld1, and sndp1 three days after germination. (B) Three-day-old seedlings grown in MS-NH4NO3 with or without Methyl-ammonium (MeA). (C) seminal root lengths of wild-type, csld1 and sndp1 seminal roots with or without methyl-ammonium (MeA) and (D) ammonium concentration of wild-type, csld1 and sndp1 seminal roots. Bar graphs show mean values ± standard error of means (n = 8–12). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Figure 7. Differences in root hair length did not affect the nitrogen concentration in roots. (A) Seminal roots of wild-type, csld1, and sndp1 three days after germination. (B) Three-day-old seedlings grown in MS-NH4NO3 with or without Methyl-ammonium (MeA). (C) seminal root lengths of wild-type, csld1 and sndp1 seminal roots with or without methyl-ammonium (MeA) and (D) ammonium concentration of wild-type, csld1 and sndp1 seminal roots. Bar graphs show mean values ± standard error of means (n = 8–12). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Plants 11 03580 g007
Plants 11 03580 g008 550
Figure 8. AMT1 RNAi displays sensitivity to NH4+ in MS media but not to NO3−. AMT1 RNAi mutants are cultured with 0.1 mM NH4+. (A) Root hair length and (B) root hair density of wild-type (WT) RNAi 5-2 (Ri 5–2) and RNAi 3-1 (Ri 3–1) (C) when cultured with 0.1 mM NH4+. AMT1 RNAi mutants cultured with 0.1 mM NO3−. (D) Root hair length (E) and root hair density of wild-type (WT) RNAi 5-2 (Ri 5–2) and RNAi 3-1 (Ri 3–1) (f) when cultured with 0.1 mM NO3−. Scale bars = 500 μm. Bar graphs show mean values ± standard error of means (n = 10). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Figure 8. AMT1 RNAi displays sensitivity to NH4+ in MS media but not to NO3−. AMT1 RNAi mutants are cultured with 0.1 mM NH4+. (A) Root hair length and (B) root hair density of wild-type (WT) RNAi 5-2 (Ri 5–2) and RNAi 3-1 (Ri 3–1) (C) when cultured with 0.1 mM NH4+. AMT1 RNAi mutants cultured with 0.1 mM NO3−. (D) Root hair length (E) and root hair density of wild-type (WT) RNAi 5-2 (Ri 5–2) and RNAi 3-1 (Ri 3–1) (f) when cultured with 0.1 mM NO3−. Scale bars = 500 μm. Bar graphs show mean values ± standard error of means (n = 10). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Plants 11 03580 g008
Plants 11 03580 g009 550
Figure 9. AMT1;2 overexpressing lines are susceptible to methyl-ammonium (MeA). (A) Expression of CSLD1 overexpressing and mutant lines (left) and AMT1;2 overexpressing lines (right). (B) CSLD1:OX lines and AMT1;2:OX seeds grown in MS-NH4 media without MeA, (C) with MeA, (D) seminal root length of csld1 and CSLD1:OX seedlings grown in MS-NH4 media with/without MeA, and (E) seminal root length of AMT1;2:OX seedlings grown in MS- NH4 media with/without MeA. Scale bars = 1 cm. Bar graphs show mean values ± standard error of means (n = 8). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Figure 9. AMT1;2 overexpressing lines are susceptible to methyl-ammonium (MeA). (A) Expression of CSLD1 overexpressing and mutant lines (left) and AMT1;2 overexpressing lines (right). (B) CSLD1:OX lines and AMT1;2:OX seeds grown in MS-NH4 media without MeA, (C) with MeA, (D) seminal root length of csld1 and CSLD1:OX seedlings grown in MS-NH4 media with/without MeA, and (E) seminal root length of AMT1;2:OX seedlings grown in MS- NH4 media with/without MeA. Scale bars = 1 cm. Bar graphs show mean values ± standard error of means (n = 8). Different letters indicate significant differences between groups according to Tukey’s HSD test (p < 0.05).
Plants 11 03580 g009
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Rajendran, S.; Kim, C.M. OsCSLD1 Mediates NH4+-Dependent Root Hair Growth Suppression and AMT1;2 Expression in Rice (Oryza sativa L.). Plants 2022, 11, 3580. https://doi.org/10.3390/plants11243580

AMA Style

Rajendran S, Kim CM. OsCSLD1 Mediates NH4+-Dependent Root Hair Growth Suppression and AMT1;2 Expression in Rice (Oryza sativa L.). Plants. 2022; 11(24):3580. https://doi.org/10.3390/plants11243580

Chicago/Turabian Style

Rajendran, Sujeevan, and Chul Min Kim. 2022. "OsCSLD1 Mediates NH4+-Dependent Root Hair Growth Suppression and AMT1;2 Expression in Rice (Oryza sativa L.)" Plants 11, no. 24: 3580. https://doi.org/10.3390/plants11243580

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop