Next Article in Journal
Triterpenoid Saponins from Washnut (Sapindus mukorossi Gaertn.)—A Source of Natural Surfactants and Other Active Components
Next Article in Special Issue
Plant Development and Crop Yield: The Role of Gibberellins
Previous Article in Journal
Essential Oils from Cameroonian Aromatic Plants as Effective Insecticides against Mosquitoes, Houseflies, and Moths
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 11
Issue 18
10.3390/plants11182354
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Abscisic Acid Induces Adventitious Rooting in Cucumber (Cucumis sativus L.) by Enhancing Sugar Synthesis

by
Changxia Li
1,
Meiling Zhang
2,
Nana Qi
1,
Huwei Liu
1,
Zongxi Zhao
1,
Panpan Huang
1 and
Weibiao Liao
1,*
1
College of Horticulture, Gansu Agricultural University, 1 Yinmen Village, Anning District, Lanzhou 730070, China
2
College of Science, Gansu Agricultural University, Lanzhou 730070, China
*
Author to whom correspondence should be addressed.
Plants 2022, 11(18), 2354; https://doi.org/10.3390/plants11182354
Submission received: 11 June 2022 / Revised: 3 September 2022 / Accepted: 4 September 2022 / Published: 9 September 2022
(This article belongs to the Special Issue Characterization of Signal Transduction in the Plant Hormone)
Browse Figures
Versions Notes

Abstract

:
Abscisic acid (ABA) affects many important plant processes, such as seed germination, root elongation and stomatal movement. However, little information is available about the relationship between ABA and sugar synthesis during adventitious root formation. The aim of this study was to evaluate the effect of ABA on adventitious root formation in cucumber and whether the effect of this plant hormone on sugar synthesis could be included as a causative factor for adventitious root development. We determined the contents of glucose, sucrose, starch, total sugar and sugar-related enzymes, including sucrose synthase (SS), sucrose phosphate synthase (SPS), hexokinase (HK) and pyruvate kinase (PK) activities in ABA treatment. We also quantified the relative expression of sucrose or glucose synthesis genes during this process. Increasing ABA concentrations significantly improved adventitious root formation, with the most considerable effect at 0.05 μM. Compared to the control, ABA treatment showed higher glucose, sucrose, starch and total sugar contents. Moreover, ABA treatment increased glucose-6-phosphate (G6P), fructose-6-phosphate (F6P) and glucose-1-phosphate (G1P) contents in cucumber explants during adventitious root development, which was followed by an increase of activities of sucrose-related enzymes SS and SPS, glucose-related enzymes HK and PK. ABA, meanwhile, upregulated the expression levels of sucrose or glucose synthesis-related genes, including CsSuSy1, CsSuSy6, CsHK1 and CsHK3. These results suggest that ABA may promote adventitious root development by increasing the contents of glucose, sucrose, starch, total sugar, G6P, F6P and G1P, the activities of SS, SPS, HK, SPS and the expression levels of CsSuSy1, CsSuSy6, CsHK1 and CsHK3 genes. These findings provide evidence for the physiological role of ABA during adventitious root formation and provide a new understanding of the possible relationship between ABA and sugar synthesis during adventitious rooting in plants.

1. Introduction

Abscisic acid (ABA), as one of the plant hormones, is considered an important signaling molecule. ABA occupies an enviable place in mediating plant development and growth, such as seed germination, seed dormancy, embryo development, cell division and elongation, floral induction and stomatal movement [1,2,3,4]. Rapid advances in the area of ABA signaling have helped shed light on plant developmental processes. ABA is also involved in plant response to a series of environmental stresses, such as drought, salt and temperature stresses [5]. Importantly, Chin et al. [6] indicated that ABA stimulated the rooting of the stem cuttings of mung beans and English ivy. It has also been found that ABA may stimulate adventitious root initiation in mung bean Vigna radiata cuttings [7]. However, exogenous ABA inhibited peanut seedlings’ lateral root development by increasing endogenous ABA content [8]. ABA also acts as an inhibitor of lateral root development in Arachis hypogaea by blocking cell cycle progression [9]. Inhibition of the adventitious root formation step by ABA was also reported in deep-water rice [10]. Similarly, shoot-derived ABA inhibits lateral root development and adventitious root formation in tomato, likely via effects on ethylene (ET) and indoleacetic acid (IAA) pathways [11]. ABA regulates root growth and development through crosstalk with IAA and cytokinins (CTK) in Brassica napus L. [12]. Dong et al. [13] indicated that ABA-induced expression 1 (AIN1) was involved in the ABA-mediated inhibition of root elongation by modulating ROS homeostasis.
Sugars can be converted into polymers, giving rise to storage components such as starch and fructans or structural components such as cellulose. Sugar sensing and signaling are crucial to balance the requirement of nutrient, hormone and environmental signals in plants. Cytosolic triose phosphates are substrates for sucrose synthesis in which fructose-1,6-bisphosphatase (F6P) and sucrose phosphate synthase (SPS) have been identified as rate-limiting [14,15]. In plants, sucrose, as the majority abundant sugar, may be transported to sink organs or cleaved by invertases to glucose and fructose [16]. Glucose, recognized as a central signaling molecule, plays an important regulatory role, as well as a universal carbon and energy source. Hexokinase (HK) is an evolutionarily conserved glucose sensor in a wide range of organisms, including plants [17]. HK, as the first enzyme in glycolysis, phosphorylates glucose to glucose-6-phosphate (G6P). Both hexokinase-dependent and hexokinase-independent glucose signal transduction pathways appear to coexist [18]. Sugar may influence diverse plant growth and development processes, such as seed germination, development, photosynthesis, flowering and senescence [19]. Meanwhile, sugar is also involved in various abiotic stresses, including water stress, salt stress and temperature stress [20,21,22]. Several reports have shown that sugar influences plant root growth. For example, in Arabidopsis, sucrose promotes lateral root formation [23] and adventitious root initiation under dark conditions [24]. Mishra et al. [25] found that increasing glucose concentrations significantly increased root length and the number of lateral roots and root hairs. Glucose has also been shown to regulate lateral root formation via G-protein signaling [26]. Exogenous application of glucose to 7-day-old Arabidopsis seedlings for 3 days repressed primary root growth by shortening the root meristematic zone [27]. Sucrose as a source of energy was involved in adventitious root regeneration in apple [28].
Although ABA and sugar regulate adventitious rooting, the potential mechanism of ABA in sugar synthesis during adventitious rooting in cucumber remains unknown. To the best of our knowledge, this study is the first report on ABA in sugar synthesis during adventitious rooting and further investigates the signal regulatory network of adventitious rooting in plants.

2. Materials and Methods

2.1. Plant Material

Cucumber (Cucumis sativus ‘Xinchun NO. 4′) seeds were surface sterilized for 10 min in 5% (w/v) sodium hypochlorite and then soaked with distilled water for 6 h. Then, the seeds were germinated on filter paper containing distilled water in Petri dishes (15-cm diameter, 2.5 cm deep) and transferred to an illuminating incubator at 25 ± 1 °C for 6 days with a 14-h photoperiod (photosynthetically active radiation 200 μmol s−1m−2). Seedlings with primary roots removed were used as explants. Then, the cucumber explants were maintained under the same temperature and photoperiod conditions described above for another 5 days in the presence of different media, as indicated below. The number, length and fresh weight of adventitious roots per explant were then measured and recorded. In addition, the explants were cultivated under the same temperature and photoperiod conditions described above for another 2 days in the presence of different media indicated below. Finally, 1 cm long segments of the hypocotyl base (Figure S1) were taken as the experimental material and used for the following analysis.

2.2. Explant Treatments

The explants were cultivated at various concentrations of ABA (0, 0.01, 0.02, 0.05, 0.10 and 1.00 μM; Sigma, St. Louis, MO, USA). The ABA concentration used was closely related to the experimental materials and experimental conditions. Some studies have suggested that the ABA concentration used in different issues is different [29,30]. Additionally, under stress conditions, cucumber explants were treated with 0.5 μM ABA that was reported by Li et al. [31]. Our experiment was carried out under normal conditions. In our pre-experiment, when ABA was greater than 1 μM such as 2, 5 and 10 μM, it caused the explants to lose water, wilt and die. Thus, a low dose of ABA (less than 1 μM) was used in this study. The following chemicals were carried out: control (distilled water) and 0.05 μM ABA. For each treatment, three replicates of cucumber plants were performed. The concentration of these chemicals was selected based on the results of a preliminary experiment.

2.3. Determination of Glucose Content

Glucose was analyzed as described by Leach et al. [32], with some modifications. Briefly, 0.5 g of the sample was homogenized with 10 mL distilled water, diluted with distilled water to 50 mL, and mixed. The volumetric flask was then placed in a warm-water bath at 50 °C for 10 min. The homogenate was centrifuged at 4000× g rpm at 4 °C for 15 min. A 3,5-dinitrosalicylic acid (DNS) regent was prepared in advance. First, 6.3 g of 3,5-dinitrosalicylic acid was dissolved in 262 mL of a 2 M sodium hydroxide solution. Then, 185 g of potassium sodium tartrate was added to 500 mL of hot water solution and mixed until it dissolved fully. Lastly, the two solutions were mixed, followed by adding 5 g of redistilled phenol and 5 g of sodium sulfite, mixed and cooled to room temperature, and the volume was brought up to 1000 mL with distilled water. The supernatant (2 mL) and 1.5 mL of DNS were mixed together. Then, it was placed in a boiling water bath for 5 min, rapidly cooled and then filtered into a 25 mL volumetric flask. Absorbance at 540 nm was recorded using a spectrophotometer (UV-1601, Shimadzu, Kyoto, Japan).

2.4. Determination of Sucrose Content

The sucrose content was measured according to Wu et al. [33], with minor modifications. The sample (1.0 g) was homogenized with 10 mL of 80% ethanol and diluted to 100 mL. The volumetric flask was placed in a water bath at 80 °C for 45 min, rapidly cooled and then filtered. The filtrate was collected as the reaction mixture. The reaction mixture (0.4 mL) and 0.2 mL of 2 M NaOH were mixed together, placed in a water bath at 80 °C for 10 min, and rapidly cooled. The absorbance at 480 nm was recorded using a spectrophotometer (UV-1601).

2.5. Determination of Starch Content

The method described by Hou et al. [34] was adopted to determine the starch content. The frozen sample (0.5 g) was ground in 2 mL of distilled water, and then 3.2 mL of 60% HClO4 was added. After blending, the solution was transferred to a tube and diluted to 10 mL. The mixture was centrifuged at 5000× g r/min for 5 min. The supernatant (0.5 mL) was diluted to 3 mL with distilled water, and 2 mL of iodine reagent was added. After the reaction for 5 min, the mixture was diluted to 10 mL with distilled water. The absorbance was measured at 660 nm using a spectrophotometer (UV-1601).

2.6. Determination of Total Sugar Content

The total sugar content was determined by the procedures described by Zhao et al. [35]. One gram of sample tissue was homogenized in 10 mL of 6 M HCl and diluted to 25 mL with distilled water. The test tube was placed in a boiling water bath for 30 min to hydrolyze the sugar. Using phenolphthalein as an indicator, the total sugar content was determined with 6 M NaOH’s standard titration solution. Then, the mixture was diluted to 100 mL with distilled water, mixed well and filtered. The filtrate (10 mL) was transferred to the new test tube, diluted to 100 mL with distilled water, and analyzed. Absorbance at 540 nm was performed using a spectrophotometer (UV-1601).

2.7. G6P, F6P and G1P Content Measurements

The enzyme was extracted using the modified method of Wei et al. [36]. Briefly, 0.5 g of the samples were grounded in liquid nitrogen. Then, it was added to 2 mL of 5% trichloroacetic acid (TCA) consisting of 100 mg polyvinyl polypyrrolidone (PVPP). The mixtures were centrifuged at 12,000× g rpm for 15 min at 4 °C. The supernatant was collected, and 150 μL of neutralizing buffer containing 1 M triethanolamine and 5 M potassium hydroxide (KOH) was added to the supernatant. After a reaction for 30 min on ice, the mixture was centrifuged for 15 min at 12,000× g r/min. The supernatants were collected as enzyme extracts for further analysis.
For G6P, F6P and glucose-1-phosphate (G1P), the reaction mixture consisted of 497 μL of distilled water, 100 μL of 1 M Hepes-KOH (pH 7.6), 100 μL of 50 mM MgCl2, 100 μL 4 mM NAD, 100 μL of 10 mM EDTA and 100 μL of crude enzyme extract. The formation of blue formazan was monitored by recording the absorbance at 560 nm. G6PDH, PGI and PGM were added successively for G6P, F6P and G1P mixtures, and then were determined by measuring the absorbance at 340 nm using a spectrophotometer (UV-1601).

2.8. SS, SPS, HK and PK Enzyme Activity Measurement

Enzyme extracts were performed as described previously [37]. Samples were harvested, ground in liquid nitrogen, and homogenized in 9 mL of ice-cold PBS (pH = 7.4). Then, extracts were centrifuged at 3000× g rpm for 15 min at 4 °C. The activities of sucrose synthase (SS), sucrose phosphate synthase (SPS), hexokinase (HK) and pyruvate kinase (PK) enzyme were measured by enzyme-linked immunosorbent assay (ELISA; AndyGene Biotechnology Co. Ltd., Beijing, China) according to the manufacturer’s instructions.

2.9. Quantitative Real-Time PCR (qRT-PCR)

Total RNA was extracted using TRIzol (Invitrogen Life Technologies) according to the method described by Huang et al. [38]. RNA was reverse transcribed with the 5 × Evo M-MLVRT Master Mix (AG, Changsha, China) according to the manufacturer’s instructions. The cDNA was amplified with 2 × SYBR Green Pro Taq HS Premix (AG, China) using the following primers shown in Table 1. The reactions were controlled by the following conditions: 30 s at 95 °C, then 5 s at 95 °C and 30 s at 60 °C for 40 cycles. Quantitative real-time PCR reactions were performed with a Mastercycler eprealplex real-time PCR system (Eppendorf, Hamburg, Germany). The expression levels of CsSuSy1, CsSuSy6, CsHK1 and CsHK3 genes were presented as values relative to the corresponding control samples under the indicated conditions, with normalization of data to the geometric average of internal cucumber TUA [39]. The expression level of the gene was calculated by 2−ΔΔCT. ΔCT = CT (target gene) − CT (internal reference gene). ΔΔCT = ΔCT (test group) − ΔCT (control group). The relative expression level of the gene = 2−ΔΔCT. Each sample was set to three biological replicates.

2.10. Data Statistics and Analysis

Where indicated, the results were expressed as the mean values ± standard error (SE) of at least three independent experiments. Statistical analysis was performed using SPSS 22.0. For statistical analysis, a t-test (p < 0.05) was chosen.

3. Results

3.1. Effect of Exogenous ABA on Adventitious Root Development

To understand the effects of exogenous ABA on adventitious rooting in cucumber, explants were treated with increasing concentrations of ABA (Table 2). In comparison with the control, ABA had a significant effect on cucumber adventitious rooting. Among the different concentrations of ABA, the maximum root number, root length and fresh weight were observed for 0.05 μM ABA (Table 2). Thus, treatment with 0.05 μM ABA was used for further studies.

3.2. Effect of Exogenous ABA on Glucose, Sucrose, Starch and Total Sugar Contents during Adventitious Rooting

The effects of ABA on glucose, sucrose, starch and total sugar contents during adventitious root formation were investigated. Compared to the control, the glucose, sucrose, starch and total sugar contents in ABA-treated hypocotyls were significantly increased, by approximately 6.54%, 113.61%, 27.29% and 29.29%, respectively (Figure 1). Therefore, our results suggested that ABA treatment significantly increased the contents of glucose, sucrose, starch and total sugar.

3.3. Effect of Exogenous ABA on G6P, F6P and G1P Contents during Adventitious Root Development

We next measured the contents of 3 hexose phosphates in hypocotyls treated with ABA to detect the effect of sugar synthesis during adventitious rooting. The G6P content in the hypocotyls treated with ABA was significantly higher than that in the control (Figure 2A). Meanwhile, ABA significantly increased the F6P and G1P content by approximately 10.20% and 14.86%, respectively (Figure 2B,C).

3.4. Effect of Exogenous ABA on SS, SPS, HK and PK Activities during Adventitious Rooting

To examine the promotion roles of ABA in SS, SPS, HK and PK activities in detail, we determined the activities of SS, SPS, HK and PK in ABA-treated/untreated hypocotyls. ABA treatment significantly enhanced the SS, SPS, HK and PK activities with respect to the control by increasing 19.61%, 34.97%, 16.38% and 39.96%, respectively (Figure 3). These data revealed that ABA regulated the SS, SPS, HK and PK activities in the sugar synthesis pathway.

3.5. Effect of Exogenous ABA on CsSuSy1, CsSuSy6, CsHK1 and CsHK3 Expression Levels

To gain insight into the sugar synthesis-related mechanism of ABA-induced adventitious root development, the relative expression of related genes, CsSuSy1, CsSuSy6, CsHK1 and CsHK3, was analyzed by qRT-PCR. Compared with the control, ABA treatment was able to induce higher expression of the CsSuSy1, CsSuSy6, CsHK1 and CsHK3 genes during adventitious root formation, increased by 1.46, 1.99, 1.73, and 1.93-fold, respectively (Figure 4).

4. Discussion

The importance of ABA in plant root systems has been extensively recognized. ABA took part in the regulation of rice root system growth under simulated acid rain stress [40]. Li et al. [41] reported that pretreatment with ABA promoted the formation and growth of adventitious roots in mung bean under cadmium stress. Geng et al. [42] found that a suitable ABA concentration promoted root development, but high concentrations of ABA inhibited root growth. Li et al. [31] found that ABA significantly enhanced adventitious root formation in cucumbers under drought stress. Research has also shown that ABA repressed ethylene-induced and gibberellin-promoted emergence of adventitious roots in deepwater rice [10]. ABA is also involved in the inhibition of primary root elongation in rice and wheat under normal/non-stress conditions [43,44,45]. In the study, different ABA concentrations promoted adventitious rooting, and 0.05 μM ABA had the most effective (Table 2). Given the above, ABA might regulate adventitious root development in cucumber. However, our knowledge of the cross-talk between ABA and sugar signaling during adventitious rooting is unclear.
Sucrose is the major sugar translocated in plants and can be cleaved by invertase to glucose and fructose. Starch is an insoluble polymer of glucose produced by most higher plant species. The interaction between ABA and sugar signaling during early seedling development in Arabidopsis has been revealed [46]. ABA is a positive regulator of sucrose accumulation in citrus and grape [47]. Exogenous ABA can accelerate glucose and fructose accumulation [48]. Pan et al. [49] reported that ABA promoted sugar synthesis and accumulation in grape berry. Sucrose combined with ABA synergistically regulated the expression levels of 15 starch biosynthetic genes in maize endosperm [50]. The expression levels of AtAPL3 and OsAPL3 genes were upregulated in the sucrose-treated Arabidopsis leaves and cultured rice cells, respectively, resulting in an increase in starch content [51,52]. Additionally, the expression levels of the two genes were further enhanced in the sucrose plus ABA treatment. Huang et al. [53] reported that ZmEREB156 positively modulated the starch biosynthetic gene ZmSSIIIa through the synergistic effect of sucrose and ABA. In this study, the glucose, sucrose, starch and total sugar contents under ABA treatment were significantly increased compared to the control (Figure 1). Starch is degraded to G1P by phosphorylation. ABA promoted glucose, sucrose, starch and total sugar accumulations, followed by increasing G6P, F6P and G1P contents (Figure 2). These results indicate that ABA may significantly promote glucose, sucrose, starch and total sugar accumulations by increasing G6P, F6P and G1P contents.
There is a massive transformation of starch to sugars during plant growth and development, in which several enzymes are included, such as SPS and SS. Shi et al. [37] reported that SPS and SS, as key glucose synthesis enzymes, were responsible for sucrose accumulation in longan fruit. SS activity was also induced by sucrose and ABA in rice [54]. Tan et al. [48] also indicated that ABA increased the activities of SS and SPS in longan fruit. We also found that ABA significantly increased SS and SPS activities during adventitious root development. These data show that ABA increased sucrose content during cucumber adventitious rooting by enhancing SS and SPS activities (Figure 3). This might be one reason for sucrose accumulation. Hexokinase (HK) and pyruvate kinase (PK) are the key enzymes responsible for the glucose and fructose synthesis pathways. In the present study, the exposure of cucumber hypocotyls to ABA resulted in an increase in the activities of HK and PK enzymes, suggesting that ABA may be involved in glucose synthesis by increasing HK and PK activities during adventitious root formation.
Sugars have a signaling function in which the HK and SuSy proteins are suggested to play a pivotal role. To test the conclusion further, the expression levels of CsSuSy1, CsSuSy6, CsHK1 and CsHK3 with or without ABA were analyzed. ABA treatment induced higher expression levels of CsSuSy1, CsSuSy6, CsHK1 and CsHK3 genes than the control (Figure 4). Dominguez et al. [55] reported that ABA imparted on glucose signaling mediated by HK1. HK1 participates in the hypocotyl elongation of Arabidopsis promoted by glucose under dark conditions [56]. The combination of ABA and sucrose had synergic effects on the sucrose induction of the anthocyanin synthesis pathway [57]. Jia et al. [58] reported that abscisic acid-stress-ripening (ASR) was involved in the transduction of ABA and sucrose signaling pathways to regulate tomato and strawberry fruit ripening. Thus, the results have important functional implications, expanding and enriching the possibilities for ABA during adventitious root development.

5. Conclusions

In summary, this study demonstrated that ABA treatment promoted adventitious root development in the cucumber. ABA-treated cucumber hypocotyls also showed higher glucose, sucrose, starch and total sugar content than samples from untreated ABA. Moreover, ABA treatment increased G6P, F6P and G1P contents, which was followed by the increase of sucrose-related enzymes SS and SPS and glucose-related enzymes HK and PK activities. Meanwhile, the relative expression of sucrose and glucose synthesis-related genes, including CsSuSy1, CsSuSy6, CsHK1 and CsHK3, were significantly upregulated. Taken together, these results indicate that ABA treatment regulates the adventitious rooting of cucumber and that sugar synthesis may be regulated by ABA during this process.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11182354/s1, Figure S1. Patterns of cucumber explants and experimental materials.

Author Contributions

Conceptualization: W.L.; Data curation, C.L., MZ. and N.Q.; Formal analysis, C.L. and M.Z.; Investigation, C.L. and H.L.; Methodology, C.L. and Z.Z.; Project administration, W.L.; Software, C.L. and P.H.; Writing—original draft, C.L.; Writing—review & editing, W.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (Nos. 32072559, 31860568, 31560563 and 31160398); the Key Research and Development Program of Gansu Province, China (No. 21YF5WA096); the Research Fund of Higher Education of Gansu, China (No. 2018C-14 and 2019B-082); and the Natural Science Foundation of Gansu Province, China (Nos. 1606RJZA073 and 1606RJZA077 and 1606RJYA252).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Reyes, J.L.; Chua, N.H. ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. Plant J. 2007, 49, 592–606. [Google Scholar] [CrossRef] [PubMed]
  2. Liu, Y.; Ye, N.; Liu, R.; Chen, M.; Zhang, J. H2O2 mediates the regulation of ABA catabolism and GA biosynthesis in Arabidopsis seed dormancy and germination. J. Exp. Bot. 2010, 61, 2979–2990. [Google Scholar] [CrossRef]
  3. Qu, Y.; Song, P.; Hu, Y.; Jin, X.; Jia, Q.; Zhang, X.; Chen, L.; Zhang, Q. Regulation of stomatal movement by cortical microtubule organization in response to darkness and ABA signaling in Arabidopsis. Plant Growth Regul. 2018, 84, 467–479. [Google Scholar] [CrossRef]
  4. Endo, T.; Shimada, T.; Nakata, Y.; Fujii, H.; Matsumoto, H.; Nakajima, N.; Ikoma, Y.; Omura, M. Abscisic acid affects expression of citrus FT homologs upon floral induction by low temperature in Satsuma mandarin (Citrus unshiu Marc.). Tree Physiol. 2017, 38, 755–771. [Google Scholar] [CrossRef]
  5. Hong, J.H.; Seah, S.W.; Xu, J. The root of ABA action in environmental stress response. Plant Cell Rep. 2013, 32, 971–983. [Google Scholar] [CrossRef] [PubMed]
  6. Chin, T.Y.; Meyer, M.M.; Beevers, A.L. Abscisic-acid-stimulated rooting of stem cuttings. Planta 1969, 88, 192–196. [Google Scholar] [CrossRef]
  7. Tartoura, K.A.H. Effect of abscisic acid on endogenous IAA, auxin protector levels and peroxidase activity during adventitious root initiation in Vigna radiata cuttings. Acta Physiol. Plant. 2001, 23, 149–156. [Google Scholar] [CrossRef]
  8. Guo, D.; Liang, J.; Li, L. Abscisic acid (ABA) inhibition of lateral root formation involves endogenous ABA biosynthesis in Arachis hypogaea L. Plant Growth Regul. 2009, 58, 173–179. [Google Scholar] [CrossRef]
  9. Guo, D.; Liang, J.; Qiao, Y.; Yan, Y.; Li, L.; Dai, Y. Involvement of G1-to-S transition and AhAUX-dependent auxin transport in abscisic acid-induced inhibition of lateral root primordia initiation in Arachis hypogaea L. J. Plant Physiol. 2012, 169, 1102–1111. [Google Scholar] [CrossRef]
  10. Steffens, B.; Wang, J.; Sauter, M. Interactions between ethylene, gibberellin and abscisic acid regulate emergence and growth rate of adventitious roots in deepwater rice. Planta 2006, 223, 604–612. [Google Scholar] [CrossRef] [PubMed]
  11. McAdam, S.A.M.; Brodribb, T.J.; Ross, J.J. Shoot-derived abscisic acid promotes root growth. Plant Cell Environ. 2016, 39, 652–659. [Google Scholar] [CrossRef] [PubMed]
  12. Xie, L.-L.; Chen, F.; Zou, X.-L.; Shen, S.-S.; Wang, X.-G.; Yao, G.-X.; Xu, B.-B. Graphene oxide and ABA cotreatment regulates root growth of Brassica napus L. by regulating IAA/ABA. J. Plant Physiol. 2019, 240, 153007. [Google Scholar] [CrossRef] [PubMed]
  13. Dong, T.; Yin, X.; Wang, H.; Lu, P.; Liu, X.; Gong, C.; Wu, Y. ABA-INDUCED expression 1 is involved in ABA-inhibited primary root elongation via modulating ROS homeostasis in Arabidopsis. Plant Sci. 2021, 304, 110821. [Google Scholar] [CrossRef] [PubMed]
  14. Stitt, M.; Wirtz, W.; Heldt, H.W. Regulation of sucrose synthesis by cytoplasmic fructosebisphosphatase and sucrose phosphate synthase during photosynthesis in varying light and carbon dioxide. Plant Physiol. 1983, 72, 767–774. [Google Scholar] [CrossRef] [PubMed]
  15. Strand, A.; Zrenner, R.; Trevanion, S.; Stitt, M.; Gustafsson, P.; Gardestrom, P. Decreased expression of two key enzymes in the sucrose biosynthesis pathway, cytosolic fructose-1,6-bisphosphatase and sucrose phosphate synthase, has remarkably different consequences for photosynthetic carbon metabolism in transgenic Arabidopsis thaliana. Plant J. 2000, 23, 759–770. [Google Scholar] [CrossRef]
  16. Sturm, A. Invertases. Primary structures, functions, and roles in plant development and sucrose partitioning. Plant Physiol. 1999, 121, 1–8. [Google Scholar] [CrossRef]
  17. Rolland, F.; Baena-Gonzalez, E.; Sheen, J. Sugar sensing and signaling in plants: Conserved and novel mechanisms. Annu. Rev. Plant Biol. 2006, 57, 675–709. [Google Scholar] [CrossRef]
  18. Xiao, W.; Sheen, J.; Jang, J.C. The role of hexokinase in plant sugar signal transduction and growth and development. Plant Mol. Biol. 2000, 44, 451–461. [Google Scholar] [CrossRef]
  19. Sami, F.; Yusuf, M.; Faizan, M.; Faraz, A.; Hayat, S. Role of sugars under abiotic stress. Plant Physiol. Biochem. 2016, 109, 54–61. [Google Scholar] [CrossRef]
  20. Hu, M.Y.; Li, H.; Zhang, Y.J.; Liu, Q. Photosynthesis and related physiological characteristics affected by exogenous glucose in wheat seedlings under water stress. Acta Agron. Sin. 2009, 35, 724–732. [Google Scholar] [CrossRef]
  21. Hu, M.Y.; Shi, Z.G.; Zhang, Z.B.; Zhang, Y.J.; Li, H. Effects of exogenous glucose on seed germination and antioxidant capacity in wheat seedlings under salt stress. Plant Growth Regul. 2012, 68, 177–188. [Google Scholar] [CrossRef]
  22. Jiang, W.; Ding, M.; Duan, Q.; Zhou, Q.; Huang, D. Exogenous glucose preserves the quality of watermelon (Citrullus lanatus) plug seedlings for low temperature storage. Sci. Hortic. 2012, 148, 23–29. [Google Scholar] [CrossRef]
  23. MacGregor, D.R.; Deak, K.I.; Ingram, P.A.; Malamy, J.E. Root system architecture in Arabidopsis grown in culture is regulated by sucrose uptake in the aerial tissues. Plant Cell 2008, 20, 2643–2660. [Google Scholar] [CrossRef]
  24. Takahashi, F.; Sato-Nara, K.; Kobayashi, K.; Suzuki, M.; Suzuki, H. Sugar-induced adventitious roots in Arabidopsis seedling. J. Plant Res. 2003, 116, 83–91. [Google Scholar] [CrossRef] [PubMed]
  25. Mishra, B.S.; Singh, M.; Aggrawal, P.; Laxmi, A. Glucose and auxin signaling interaction in controlling Arabidopsis thaliana seedlings root growth and development. PLoS ONE 2009, 4, e4502. [Google Scholar] [CrossRef] [PubMed]
  26. Booker, K.S.; Schwarz, J.; Garrett, M.B.; Jones, A.M. Glucose attenuation of auxin-mediated bimodality in lateral root formation is partly coupled by the heterotrimeric G protein complex. PLoS ONE 2010, 5, e12833. [Google Scholar] [CrossRef]
  27. Yuan, T.T.; Xu, H.H.; Zhang, K.X.; Guo, T.T.; Lu, Y.T. Glucose inhibits root meristem growth via ABA INSENSITIVE 5, which represses PIN1 accumulation and auxin activity in Arabidopsis. Plant Cell Environ. 2014, 37, 1338–1350. [Google Scholar] [CrossRef]
  28. Calamar, A.; de Klerk, G.J. Effect of sucrose on adventitious root regeneration in apple. Plant Cell Tissue Organ Cult. 2002, 70, 207–212. [Google Scholar] [CrossRef]
  29. Tossi, V.; Lamattina, L.; Cassia, R. An increase in the concentration of abscisic acid is critical for nitric oxide-mediated plant adaptive responses to UV-B irradiation. New Phytol. 2009, 181, 871–879. [Google Scholar] [CrossRef]
  30. Tari, I.; Nagy, M. Abscisic acid and Ethrel abolish the inhibition of adventitious root formation of paclobutrazol-treated bean primary leaf cuttings. Biol. Plant. 1996, 38, 369. [Google Scholar] [CrossRef]
  31. Li, X.P.; Xu, Q.Q.; Liao, W.B.; Ma, Z.J.; Xu, X.T.; Wang, M.; Ren, P.J.; Niu, L.J.; Jin, X.; Zhu, Y.C. Hydrogen peroxide is involved in abscisic acid-induced adventitious rooting in cucumber (Cucumis sativus L.) under drought stress. J. Plant Biol. 2016, 59, 536–548. [Google Scholar]
  32. Leach, K.A.; Braun, D.M. Soluble sugar and starch extraction and quantification from maize (Zea mays) leaves. Curr. Protoc. Plant Biol. 2016, 1, 139–161. [Google Scholar] [CrossRef] [PubMed]
  33. Wu, X.T.; Li, W.T.; Liu, Z.Y.; Liu, H.W.; Gao, R.; Luo, Y.Y.; Liao, W.B. Trehalose promotes the formation of Lanzhou lily bulblets by increasing carbohydrate content. J. Hortic. Sci. Biotechnol. 2022, 97, 503–513. [Google Scholar] [CrossRef]
  34. Hou, X.; Qi, N.; Wang, C.; Li, C.; Huang, D.; Li, Y.; Wang, N.; Liao, W. Hydrogen-rich water promotes the formation of bulblets in Lilium davidii var. unicolor through regulating sucrose and starch metabolism. Planta 2021, 254, 106. [Google Scholar] [CrossRef] [PubMed]
  35. Zhao, Z.X.; Li, C.X.; Liu, H.W.; Yang, J.J.; Huang, P.P.; Liao, W.B. The involvement of glucose in hydrogen gas-medicated adventitious rooting in cucumber. Plants 2021, 10, 1937. [Google Scholar] [CrossRef] [PubMed]
  36. Wei, L.J.; Wang, C.L.; Liao, W.B. Hydrogen sulfide improves the vase life and quality of cut roses and chrysanthemums. J. Plant Growth Regul. 2021, 40, 2532–2547. [Google Scholar] [CrossRef]
  37. Shi, S.Y.; Wang, W.; Liu, L.Q.; Shu, B.; Wei, Y.Z.; Jue, D.W.; Fu, J.X.; Xie, J.H.; Liu, C.M. Physico-chemical properties of longan fruit during development and ripening. Sci. Hortic. 2016, 207, 160–167. [Google Scholar] [CrossRef]
  38. Huang, D.J.; Li, W.T.; Dawuda, M.M.; Huo, J.Q.; Li, C.X.; Wang, C.L.; Liao, W.B. Hydrogen sulfide reduced colour change in Lanzhou lily-bulb scales. Postharvest Biol. Technol. 2021, 176, 111520. [Google Scholar] [CrossRef]
  39. Wan, H.J.; Zhao, Z.G.; Qian, C.T.; Sui, Y.H.; Malik, A.A.; Chen, J.F. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber. Anal. Biochem. 2010, 399, 257–261. [Google Scholar] [CrossRef]
  40. Liu, H.Y.; Ren, X.Q.; Zhu, J.Z.; Wu, X.; Liang, C.J. Effect of exogenous abscisic acid on morphology, growth and nutrient uptake of rice (Oryza sativa) roots under simulated acid rain stress. Planta 2018, 248, 647–659. [Google Scholar] [CrossRef]
  41. Li, S.W.; Leng, Y.; Feng, L.; Zeng, X.Y. Involvement of abscisic acid in regulating antioxidative defense systems and IAA-oxidase activity and improving adventitious rooting in mung bean [Vigna radiata (L.) Wilczek] seedlings under cadmium stress. Environ. Sci. Pollut. Res. 2014, 21, 525–537. [Google Scholar] [CrossRef] [PubMed]
  42. Geng, Y.; Wu, R.; Wee, C.W.; Xie, F.; Wei, X.; Chan, P.M.Y.; Tham, C.; Duan, L.; Dinneny, J.R. A spatio-temporal understanding of growth regulation during the salt stress response in Arabidopsis. Plant Cell 2013, 25, 2132–2154. [Google Scholar] [CrossRef] [PubMed]
  43. Konishi, H.; Kitano, H.; Komatsu, S. Identification of rice root proteins regulated by gibberellin using proteome analysis. Plant Cell Environ. 2005, 28, 328–339. [Google Scholar] [CrossRef]
  44. McSteen, P. Auxin and monocot development. CSH Perspect. Biol. 2010, 2, a001479. [Google Scholar] [CrossRef]
  45. Yu, Y.; Jin, C.W.; Sun, C.L.; Wang, J.H.; Ye, Y.Q.; Zhou, W.W.; Lu, L.L.; Lin, X.Y. Inhibition of ethylene production by putrescine alleviates aluminum-induced root inhibition in wheat plants. Sci. Rep. 2016, 6, 18888. [Google Scholar] [CrossRef]
  46. Dekkers, B.J.; Schuurmans, J.A.; Smeekens, S.C. Interaction between sugar and abscisic acid signalling during early seedling development in Arabidopsis. Plant Mol. Biol. 2008, 67, 151–167. [Google Scholar] [CrossRef]
  47. Wang, X.H.; Yin, W.; Wu, J.X.; Chai, L.J.; Yi, H.L. Effects of exogenous abscisic acid on the expression of citrus fruit ripening-related genes and fruit ripening. Sci. Hortic. 2016, 201, 175–183. [Google Scholar] [CrossRef]
  48. Tan, S.; Xie, J.; Wang, W.; Shi, S.W. Effects of exogenous plant hormones on sugar accumulation and related enzyme activities during the development of longan (Dimocarpus Longan Lour.) fruits. J. Hortic. Sci. Biotechnol. 2019, 94, 790–797. [Google Scholar] [CrossRef]
  49. Pan, Q.H.; Li, M.J.; Peng, C.C.; Zhang, N.; Zou, X.; Zou, K.Q.; Wang, X.L.; Yu, X.C.; Wang, X.F.; Zhang, D.P. Abscisic acid activates acid invertases in developing grape berry. Physiol. Plant. 2005, 125, 157–170. [Google Scholar] [CrossRef]
  50. Chen, J.; Huang, B.Q.; Li, Y.P.; Du, H.; Gu, Y.; Liu, H.M.; Zhang, J.J.; Huang, Y.B. Synergistic influence of sucrose and abscisic acid on the genes involved in starch synthesis in maize endosperm. Carbohydr. Res. 2011, 346, 1684–1691. [Google Scholar] [CrossRef]
  51. Akihiro, T.; Mizuno, K.; Fujimura, T. Gene expression of ADP-glucose pyrophosphorylase and starch contents in rice cultured cells are cooperatively regulated by sucrose and ABA. Plant Cell Physiol. 2005, 46, 937–946. [Google Scholar] [CrossRef] [PubMed]
  52. Rook, F.; Corke, F.; Card, R.; Munz, G.; Smith, C.; Bevan, M.W. Impaired sucrose-induction mutants reveal the modulation of sugar-induced starch biosynthetic gene expression by abscisic acid signalling. Plant J. 2001, 26, 421–433. [Google Scholar] [CrossRef] [PubMed]
  53. Huang, H.H.; Xie, S.D.; Xiao, Q.L.; Wei, B.; Zheng, L.J.; Wang, Y.B.; Cao, Y.; Zhang, X.G.; Long, T.D.; Li, Y.P.; et al. Sucrose and ABA regulate starch biosynthesis in maize through a novel transcription factor, ZmEREB156. Sci. Rep. 2016, 6, 27590. [Google Scholar] [CrossRef]
  54. Tang, T.; Xie, H.; Wang, Y.X.; Lü, B.; Liang, J.S. The effect of sucrose and abscisic acid interaction on sucrose synthase and its relationship to grainfilling of rice (Oryza sativa L.). J. Exp. Bot. 2009, 60, 2641–2652. [Google Scholar] [CrossRef]
  55. Dominguez, P.G.; Frankel, N.; Mazuch, J.; Balbo, I.; Iusem, N.; Fernie, A.R.; Carrari, F. ASR1 mediates glucose-hormone cross talk by affecting sugar trafficking in tobacco plants. Plant Physiol. 2013, 161, 1486–1500. [Google Scholar] [CrossRef] [PubMed]
  56. Zhang, Y.Q.; He, J.X. Sugar-induced plant growth is dependent on brassinosteroids. Plant Signal. Behav. 2015, 10, e1082700. [Google Scholar] [CrossRef]
  57. Loreti, E.; Povero, G.; Novi, G.; Solfanelli, C.; Alpi, A.; Perata, P. Gibberellins, jasmonate and abscisic acid modulate the sucrose-induced expression of anthocyanin biosynthetic genes in Arabidopsis. New Phytol. 2008, 179, 1004–1016. [Google Scholar] [CrossRef]
  58. Jia, H.F.; Jiu, S.T.; Zhang, C.; Wang, C.; Tariq, P.; Liu, Z.J.; Wang, B.J.; Cui, L.W.; Fang, J.G. Abscisic acid and sucrose regulate tomato and strawberry fruit ripening through the abscisic acid-stress-ripening transcription factor. Plant Biotechnol. J. 2016, 14, 2045–2065. [Google Scholar] [CrossRef] [Green Version]
Plants 11 02354 g001 550
Figure 1. Effects of exogenous 0.05 μM ABA on glucose (A), sucrose (B), starch (C) and total sugar (D) contents in hypocotyls of cucumber. The values (means ± SE) are the averages of the three independent experiments. The different letters above the bars indicate significant differences (p < 0.05) according to one-way ANOVA and t test.
Figure 1. Effects of exogenous 0.05 μM ABA on glucose (A), sucrose (B), starch (C) and total sugar (D) contents in hypocotyls of cucumber. The values (means ± SE) are the averages of the three independent experiments. The different letters above the bars indicate significant differences (p < 0.05) according to one-way ANOVA and t test.
Plants 11 02354 g001
Plants 11 02354 g002 550
Figure 2. Effects of exogenous 0.05 μM ABA on G6P (A), F6P (B) and G1P (C) contents in hypocotyls of cucumber. The values (means ± SE) are the average concentrations of the three independent experiments. The different letters above the bars indicate significant differences (p < 0.05) according to one-way ANOVA and t test. G6P, glucose-6-phosphate; F6P, fructose-6-phosphate; G1P, glucose-1-phosphate.
Figure 2. Effects of exogenous 0.05 μM ABA on G6P (A), F6P (B) and G1P (C) contents in hypocotyls of cucumber. The values (means ± SE) are the average concentrations of the three independent experiments. The different letters above the bars indicate significant differences (p < 0.05) according to one-way ANOVA and t test. G6P, glucose-6-phosphate; F6P, fructose-6-phosphate; G1P, glucose-1-phosphate.
Plants 11 02354 g002
Plants 11 02354 g003 550
Figure 3. Effects of exogenous 0.05 μM ABA on SS (A), SPS (B), HK (C) and PK (D) enzyme activities in hypocotyls of cucumber. The values (means ± SE) are the averages of the three independent experiments. The different letters above the bars indicate significant differences (p < 0.05) according to one-way ANOVA and t test. IU/L: Activity of the enzyme solution per liter. SS, sucrose synthase; SPS, sucrose phosphate synthase; HK, hexokinase; PK, pyruvate kinase.
Figure 3. Effects of exogenous 0.05 μM ABA on SS (A), SPS (B), HK (C) and PK (D) enzyme activities in hypocotyls of cucumber. The values (means ± SE) are the averages of the three independent experiments. The different letters above the bars indicate significant differences (p < 0.05) according to one-way ANOVA and t test. IU/L: Activity of the enzyme solution per liter. SS, sucrose synthase; SPS, sucrose phosphate synthase; HK, hexokinase; PK, pyruvate kinase.
Plants 11 02354 g003
Plants 11 02354 g004 550
Figure 4. Effects of exogenous 0.05 μM ABA on the expression levels of CsSuSy1, CsSuSy6, CsHK1 and CsHK3 genes in hypocotyls of cucumber. The values (means ± SE) are the averages of three independent experiments. The different letters above the bars indicate significant differences (p < 0.05) according to one-way ANOVA and t test.
Figure 4. Effects of exogenous 0.05 μM ABA on the expression levels of CsSuSy1, CsSuSy6, CsHK1 and CsHK3 genes in hypocotyls of cucumber. The values (means ± SE) are the averages of three independent experiments. The different letters above the bars indicate significant differences (p < 0.05) according to one-way ANOVA and t test.
Plants 11 02354 g004
Table
Table 1. Sequences of primers used for qRT-PCR analysis.
Table 1. Sequences of primers used for qRT-PCR analysis.
Gene SymbolAccession NumberPrimer Sequence (5′-3′)
CsSuSy1-F
CsSuSy1-R
CsSuSy6-F
CsSuSy6-R
CsHK3-F
CsHK3-R
CsHK1-F
CsHK1-R		LOC101213767
LOC101216865
LOC101218300
LOC101215511		CGTGTGCTAAGGAAGGCGGAAG
CAGTGTCACCCCACCCTCTCTC
TCCAACCGCCACAACTTCATCAC
CCATTCCCACTCTGCCCAAGC
CACGGTCCTAGTCAGTCGGAGAG
GCCATAGCATCAACCACCTGTCTC
CGCCATGACCGTCGAGATGC
TTTGTACCGCCGAGATCCAATGC
CsTUA-F
CsTUA-R		AJ715498ACGCTGTTGGTGGTGGTAC
GAGAGGGGTAAACAGTGAATC
Table
Table 2. Effect of ABA on adventitious root development in cucumber.
Table 2. Effect of ABA on adventitious root development in cucumber.
ABA/μMRoot NumberRoot Length (mm)Fresh Weight (g)
0.00 3.21 ± 032 d6.16 ± 0.23 d0.1708 ± 0.0036 c
0.01 4.75 ± 0.52 c8.04 ± 0.25 c0.2025 ± 0.0054 b
0.02 5.29 ± 0.40 b8.39 ± 0.42 b0.2104 ± 0.0064 b
0.05 7.62 ± 0.37 a10.55 ± 0.04 a0.2460 ± 0.0017 a
0.10 4.71 ± 0.25 b7.69 ± 0.35 c0.2225 ± 0.0034 b
1.00 1.41 ± 0.22 e4.79 ± 0.31 e0.1610 ± 0.0013 d
The different letters indicate significant differences (p < 0.05). n = 18 explants from each of three independent experiments were carried out.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Li, C.; Zhang, M.; Qi, N.; Liu, H.; Zhao, Z.; Huang, P.; Liao, W. Abscisic Acid Induces Adventitious Rooting in Cucumber (Cucumis sativus L.) by Enhancing Sugar Synthesis. Plants 2022, 11, 2354. https://doi.org/10.3390/plants11182354

AMA Style

Li C, Zhang M, Qi N, Liu H, Zhao Z, Huang P, Liao W. Abscisic Acid Induces Adventitious Rooting in Cucumber (Cucumis sativus L.) by Enhancing Sugar Synthesis. Plants. 2022; 11(18):2354. https://doi.org/10.3390/plants11182354

Chicago/Turabian Style

Li, Changxia, Meiling Zhang, Nana Qi, Huwei Liu, Zongxi Zhao, Panpan Huang, and Weibiao Liao. 2022. "Abscisic Acid Induces Adventitious Rooting in Cucumber (Cucumis sativus L.) by Enhancing Sugar Synthesis" Plants 11, no. 18: 2354. https://doi.org/10.3390/plants11182354

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop