Next Article in Journal
The Main Protease of SARS-CoV-2 as a Target for Phytochemicals against Coronavirus
Previous Article in Journal
The Effect of Frankia and Hebeloma crustiliniforme on Alnus alnobetula subsp. Crispa Growing in Saline Soil
Previous Article in Special Issue
Machine Learning for Plant Stress Modeling: A Perspective towards Hormesis Management
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 11
Issue 14
10.3390/plants11141861
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation and Comprehensive in Silico Characterisation of a New 3-Hydroxy-3-Methylglutaryl-Coenzyme A Reductase 4 (HMGR4) Gene Promoter from Salvia miltiorrhiza: Comparative Analyses of Plant HMGR Promoters

by
Małgorzata Majewska
*,
Łukasz Kuźma
and
Piotr Szymczyk
Department of Biology and Pharmaceutical Botany, Medical University of Lodz, Muszyńskiego 1, 90-151 Lodz, Poland
*
Author to whom correspondence should be addressed.
Plants 2022, 11(14), 1861; https://doi.org/10.3390/plants11141861
Submission received: 20 April 2022 / Revised: 29 June 2022 / Accepted: 12 July 2022 / Published: 16 July 2022
(This article belongs to the Special Issue Plant Computational Biology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Salvia miltiorrhiza synthesises tanshinones with multidirectional therapeutic effects. These compounds have a complex biosynthetic pathway, whose first rate limiting enzyme is 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR). In the present study, a new 1646 bp fragment of the S. miltiorrhiza HMGR4 gene consisting of a promoter, 5′ untranslated region and part of a coding sequence was isolated and characterised in silico using bioinformatics tools. The results indicate the presence of a TATA box, tandem repeat and pyrimidine-rich sequence, and the absence of CpG islands. The sequence was rich in motifs recognised by specific transcription factors sensitive mainly to light, salicylic acid, bacterial infection and auxins; it also demonstrated many binding sites for microRNAs. Moreover, our results suggest that HMGR4 expression is possibly regulated during flowering, embryogenesis, organogenesis and the circadian rhythm. The obtained data were verified by comparison with microarray co-expression results obtained for Arabidopsis thaliana. Alignment of the isolated HMGR4 sequence with other plant HMGRs indicated the presence of many common binding sites for transcription factors, including conserved ones. Our findings provide valuable information for understanding the mechanisms that direct transcription of the S. miltiorrhiza HMGR4 gene.

1. Introduction

Salvia miltiorrhiza Bunge, also known as Red sage, or Chinese sage, is an important species used in traditional Chinese medicine. The dried root is used alone or in combination with other herbs to treat various ailments including cardiovascular diseases, menstrual disorders and insomnia [1,2]. In addition, it has been found to have potential in treating cancer [3], Parkinson’s [4] and Alzheimer’s disease [5], as well as renal deficiency [6], hepatocirrhosis [7], acute lung injury [8], fibrosis [9], neuropathic pain [10], diabetes mellitus [11], or alcohol dependence [12]. The main bioactive compounds responsible for such medical properties are quinone diterpenoids (e.g., tanshinones) and phenolic acids. The tanshinones are biosynthesised from intermediates generated in mevalonate (MVA) and methylerythritol phosphate (MEP) pathways [13]. The key rate-limiting enzyme in the MVA pathway converting 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) to MVA is HMG-CoA reductase (HMGR) [14]. The pivotal role of HMGR in plant metabolism is emphasised by the precise regulation of its function at the level of transcription, post-transcription, translation and post-translation [15,16]. To date, five S. miltiorrhiza HMGR gene sequences (HMGR—HMGR4) have been identified and deposited in the GenBank database [17,18,19]. A combination of cDNA sequence similarity searches with exon/intron structure indicates that HMGR (EU680958.1) and HMGR4 (JN831103.1), and HMGR2 (FJ747636.1) and HMGR3 (JN831102.1) are probably two pairs of duplicated genes, respectively [19]. Although the coding sequences of the S. miltiorrhiza HMGR genes have been identified and described, some of their promoter sequences remain unknown. These include the HMGR4 promoter.
Promoter sequence analysis provides much valuable information for understanding the regulation of gene expression. Motifs such as the TATA box, CpG islands, tandem repeats or transcription factor binding sites (TFBSs) deserve special attention. Genome-wide analyses indicate that most in vivo functional TFBSs are located in the proximal promoter region [20,21]. These sites form clusters, thus improving interactions of corresponding transcription factors (TFs) to ensure a better execution of their regulatory functions [22]. An essential functional linkage exists between TFs and RNA polymerase II, acting as a large, conformationally flexible multiprotein complex known as a Mediator [23]. This complex regulates polymerase activity by transmitting signals from TFs. Groups of TFs form complex networks of dependencies and act in a coordinated manner in response to intracellular and environmental signals, thus directing many biological processes [24]. Gene expression is also regulated by the activity of microRNAs (miRNAs). They are mainly known as post-transcriptional and translational inhibitors of gene expression. The miRNAs cut the mRNA strands, destabilise the mRNA by shortening its poly(A) tail, and reduce the efficiency of the translation process [25,26]. However, studies on human and Arabidopsis thaliana indicate that miRNAs can also regulate gene expression during transcription by binding to promoter sequences [27,28,29,30]. In conclusion, to understand the mechanisms driving gene expression, it is necessary to also understand the nature of the promoter regions. The first step to achieving this goal requires use of bioinformatics tools.
A. thaliana is the most widely-studied plant in modern biology. Its wide appeal for scientists results from its fast growth rate, easy maintenance and small space requirements [31]. Moreover, the plant indicates a good tolerance to homozygosity and self-fertility [32]. Genetic studies are attracted by the small size (132 Mbp) of its completely sequenced genome [32]. Due to its similarity to other plants, A. thaliana has become the starting point for studying numerous aspects of plant cell-, molecular- and system-biology [33]. The abundance of research conducted on A. thaliana has led to the creation of numerous clones, cloning vectors, mutant lines, seeds, databases and online tools containing genomic, epigenomic, transcriptomic and proteomic data [34].
This work describes the isolation of a new S. miltiorrhiza HMGR4 promoter and 5′ untranslated region (5′UTR) sequences, and their in silico characterisation via specialised databases such as PlantPan 2.0, TSSP and miRBase. Furthermore, the comprehensive in silico analysis presented herein presents valuable new information about the regulatory functions of HMGR promoters. The data can be used to create modified or synthetic promoters which could be active under certain controlled conditions [35]. In this way, numerous medically-important metabolites may be obtained.

2. Results

2.1. In Silico Analysis of the S. miltiorrhiza HMGR4 Promoter

The 1646 bp sequence obtained by the DNA walking method was deposited in GenBank under accession number KT921337.1 (Figure 1). The sequence contained a 51 bp coding region which perfectly coincided with HMGR4 gene sequence JN831103.1 identified by Ma et al. [19]. The TATA box was located at bases −28 to −33 from TSS. One tandem repeat (at −1296 to −1353) and no CpG islands were found. A pyrimidine-rich sequence (PRS) was recognised in the 5′UTR.
Moreover, 5369 TFBSs and 365 potentially interacting TFs described previously in A. thaliana were revealed using the PlantPan 2.0 tool (File S1). Each of the obtained TFs could interact with a number of binding sites. The TFBSs were identified at both strands of the examined sequence. The similarity score between the binding sites found in the S. miltiorrhiza HMGR4 promoter and those detected in A. thaliana ranged from 0.7 to 1.0.
Additional analysis of the entire HMGR4 promoter sequence revealed the following commonly-known consensus sequences: two auxin-responsive elements (AuxREs); seven salicylic acid (SA)-responsive elements, including W box and TCA-elements; two brassinosteroid-responsive elements (BRREs); two ethylene-responsive elements (EREs); two abscisic acid-responsive elements (ABREs); four methyl jasmonate-responsive elements (MJREs); one pathogen-responsive element Eli box 3; three wounding- and pathogen-responsive elements WRE3; three anaerobic-responsive elements (AREs); and twenty-four light-responsive elements (LREs), including ATCT sequences, Box 4, GT1 motif, TCT motifs, GA motifs, AE box, Box I (Figure 1). The vast majority of these results were in agreement with data provided by PlantPan 2.0, which demonstrated the presence of numerous binding sites for TFs responding to these types of stimulation (Table S1). Only anaerobic-sensitive TFs were not found. The most commonly-observed TFs were those representing the following families: GATA (light); MYB-related and Dof (auxin); WRKY (SA, wounding and pathogen); NAC; NAM (brassinosteroid and abscisic acid (ABA)); MYB-related (ethylene); and CAMTA (MeJa) (Table S1). The consensus sequences listed above were distributed along the entire HMGR4 promoter, with some being located only a few nucleotides from each other; this allows more precise regulation of gene expression by dimerization of binding TFs. Such sequences included two SA-responsive TCA elements and two LREs (Table 1).
The search of the PlantPan 2.0 database revealed about 234 TFs that could interact with 915 TFBSs in the HMGR4 proximal promoter (File S2). To complement the findings described above, the binding sites located in the proximal promoter were analysed in terms of their response to external factors. Such data were available for 666 TFBSs (File S2). The results indicated that HMGR4 transcription may be most dependent on light, SA, bacterial infection and auxins, and less dependent on ABA, gibberellin, chitin, cold or salt stress (Figure 2). The response to these agents was mainly associated with the following TF families: GATA (light); WRKY (SA, bacterial infection, chitin); bZIP (auxins); MYB-related, WRKY and C2H2 (ABA); MYB-related and MADS box (gibberellins); C2H2 and WRKY (cold); and WRKY and MYB-related (salt stress) (Table S2). To determine the stage of S. miltiorrhiza development at which the HMGR4 gene expression regulation is likely to occur, 450 TFBSs and interacting TFs located in its proximal promoter were examined (File S2). The findings indicated flowering, embryogenesis, organogenesis (root, shoot, leaf and flower development) and circadian rhythm (Figure 3).
As HMGR genes are crucial for the production of intermediates in the biosynthesis pathway for tanshinones, a literature search was performed for TFs that positively regulate tanshinone production. Following this, based on the results obtained with the PlantPan 2.0 database, the S. miltiorrhiza HMGR4 promoter sequence was searched for the presence of binding sites for the 20 identified TFs; of these, the results indicated the presence of the following five TFs: BHLH6 (MYC2) (14 binding sites), BHLH74 (2 sites), BZIP20 (32 sites), WRKY2 (8 sites) and WRKY61 (9 sites) (File S1) [36,37,38,39,40]. A number of TFBSs were also found to be located in the proximal promoter region. The obtained results suggest that HMGR4 may play a role in the biosynthesis of tanshinones.
Furthermore, in silico analysis of the HMGR4 promoter and 5′UTR revealed potentially interacting miRNAs (Table 2). In total, 12 mature miRNAs were found, 8 binding within the promoter and 4 within the 5′UTR.

2.2. Microarray and Next-Generation Sequencing (NGS) Co-Expression Data Analysis

The Protein BLAST analysis revealed that the coding sequence of S. miltiorrhiza HMGR4 (AEZ55673.1) was more similar to A. thaliana HMGR1 (NP_177775.2), with an identity of 73.76%, than to A. thaliana HMGR2 (NP_179329.1), with one of 69.48%. Additionally, a phylogenetic study of coding sequences indicated that HMGR4 from S. miltiorrhiza (JN831103.1) and HMGR1 from A. thaliana (NM_106299.4) were more closely related to each other (Figure S1). Therefore, the A. thaliana HMGR1 gene (At1g76490) was used for further co-expression research. As a result of the conducted microarray analysis, 166 TF genes co-expressed with A. thaliana HMGR1 in the r range of 0.5–1.0 were found: 41 in AtGenExpress Hormone and Chemical Compendium, 37 in AtGenExpress Abiotic Stress Compendium, 34 in AtGenExpress Pathogen Compendium, 25 in AtGenExpress Tissue Compendium, and 29 in AtGenExpress Plus—Extended Tissue Compendium (Table S3). The RNA-seq analysis did not identify any TF genes co-expressed with A. thaliana HMGR1 in the WGCNA correlation range of 0.5–1.0.

2.3. Comparison of the in Silico HMGR4 Analysis Results with Microarray Co-Expression Data

The comparison identified 32 common TFs in the S. miltiorrhiza HMGR4 promoter (Table 3), with the most well-represented being TFs from the homeodomain-leucine zipper (HD-ZIP) and WRKY families. The common TFs participated mainly in response to hormones (ABA, ethylene, jasmonic acid and cytokinins), other abiotic factors (light, salt stress, water deprivation, heat and iron ion) and biotic agents (bacteria), embryogenesis, organogenesis (root development), flowering or, finally, tissue development (epidermis) (Table 3).
These 32 common TFs were scanned with the Genomatix Pathway System for the presence of interactions between them. The identified relationships are presented in Figure 4. It was found that SVP, AGL18 and SPL3 proteins were involved together in the regulation of flowering, and PDF2 and ATML1 in epidermal specification in embryos, respectively. Furthermore, NAC3 and RD26 responded to high salinity, drought and ABA, while NAC3 and ZF2 supported resistance to the herbivore Spodoptera littoralis. EIL3 and EIL1 played roles in regulating the response to sulphur deficiency and in ethylene signalling, and EBP transcription was light modulated through the EIN2-EIN3/EIL1 pathway.
Of the 32 common TFs that were recognised, 18 were found to interact with the TFBSs situated in the proximal promoter region (Table 3). The ability of these 18 TFs to bind to DNA as dimers or multimers was also tested. The TFBSs identified for HD-ZIP (ATML1, PDF2, HDG1), WRKY (WRKY2, WRKY14, WRKY45, WRKY57, WRKY69) and Dof (DOF5.4) are given in Table 1; all are closely located to each other, and only separated by a few nucleotides. The existence of experimentally-determined interactions between ATML1 and PDF2 proteins was confirmed by the BioGRID database.

2.4. Comparison of S. miltiorrhiza HMGR Promoters

The S. miltiorrhiza HMGR1, HMGR2 and HMGR4 promoter sequences were analysed using the Common TFs tool. Based on the findings, common binding sites for TFs were recognised, and these were classified into 22 matrix families (Figure 5, Table 4), with each single matrix family comprising identical or functionally-similar TFs identified by weight matrices. The following matrix families were found: Arabidopsis homeobox proteins (P$AHBP), L1 box (P$L1BX), MYB IIG-type binding sites (P$MIIG), DNA binding with one finger (P$DOFF), GT box elements (P$GTBX), MADS box proteins (P$MADS), MYB-like proteins (P$MYBL), MYB proteins with single DNA binding repeat (P$MYBS), NAC factors with transmembrane motif (P$NTMF), plant specific NAC proteins (P$NACF), transcription repressor KANADI (P$KAN1), W box family (P$WBXF), time-of-day-specific regulatory elements (P$TODS), nodulin consensus sequence 1 (P$NCS1), sweet potato DNA-binding factor with two WRKY domains (P$SPF1), zinc finger proteins (P$ZFAT), light-responsive elements (P$LREM), protein secretory pathway elements (P$PSPE), CGCG box binding proteins (P$CGCG), proteins involved in programmed cell death response (P$PCDR), plant nitrate-responsive elements (P$PNRE) and finally, stomatal carpenter (P$SCAP). As can be seen in Figure 5, the distribution of the matrices within the HMGR1 and HMGR2 promoter sequences was strikingly similar. The above TF family analysis found that the S. miltiorrhiza HMGR1, HMGR2 and HMGR4 genes can be co-regulated in response to abiotic factors (auxins, gibberellins, ABA, SA, jasmonic acid, brassinosteroids, light, water deprivation, salt stress, cold or phosphate starvation), biotic factors (bacteria, fungi and viruses) and during root, stem, leaf and flower organogenesis (Table 4).
The FrameWorker tool indicated the existence of 10,000 10-element-frameworks within the S. miltiorrhiza HMGR1, HMGR2 and HMGR4 promoters. Two selected models are provided in Figure 6. The frameworks were created based on 52 matrix families common to the tested sequences, some of which are mentioned above in the Common TF results section. The matrix families were located on the positive or negative strand of the promoters.
The DiAlign TF tool analysis found the HMGR1 (GU367911.1) and HMGR2 (KF297286.1) promoters to demonstrate the greatest similarity (97%). In contrast, only 17% similarity was found between HMGR4 (KT921337.1) and HMGR2, and 14% between HMGR4 and HMGR1. The greatest number of identical areas was revealed in the proximal fragments of the analysed promoters, as well as in the beginning and the middle of the distal parts. Common overlapping TFBSs were identified in locations where all three tested sequences showed high local similarity; these included two binding sites for Arabidopsis homeobox proteins (P$AHBP), one site for SBP domain proteins (P$SBPD), one site for W box family proteins (P$WBXF), one site for DNA binding with one finger factors (P$DOFF), one GT box element (P$GTBX) and, finally, one L1 box (P$L1BX). The PlantPan 2.0 and MatInspector (Genomatix) databases indicated that P$AHBP proteins are mainly involved in the response to hormones (auxins, ABA, cytokinins and gibberellins) and the initiation and development of shoot, root and flower meristems. P$SBPD TFs are associated with inflorescence development, flowering and leaf epidermis differentiation. In turn, P$WBXF matrix family responds to hormonal stimulation (SA, ABA, ethylene and jasmonic acid), other abiotic factors (salt stress, wounding, osmotic stress, heat, water deprivation and cold) and biotic agents (bacteria, fungi and viruses), and also participate in leaf senescence. P$DOFF proteins are primarily involved in the regulation of flowering, circadian rhythm and in response to hormones (auxins and SA). P$GTBX factors participate in the organogenesis of flowers and shoots. In addition, P$L1BX proteins are needed for epidermis development and seed germination. These data are available in File S1 and Table 4.

2.5. The Conservation of Plant HMGR Promoters

MEGA X software alignment of 36 sequences spanning the proximal promoters and 5′UTRs of the plant HMGR genes revealed the presence of conserved regions; these are marked in blue in Figure 7. These regions were detected in both the 5′UTRs and proximal promoters. In most of the tested sequences, PRS was identified within the preserved areas. Additional analysis with the DiAlign TF tool revealed the presence of conserved TFBSs. However, no TFBS was found to be conserved in any of the analysed sequences. The most conserved site was the TATA box, detected in 41.7% of the sequences. Two preserved binding sites for TFs belonging to the P$AHBP (Arabidopsis homeobox protein) and P$GCCF (GCC box family) families were detected in 27.8% of cases. Sites for P$TDTF (transposase-derived proteins), P$MYBL (MYB-like proteins) and P$L1BX (L1 box) proteins were identified in 25% of the sequences. Binding sites for P$DREB (dehydration responsive element binding factors) and P$ROOT (root hair-specific cis-elements in angiosperms) families were found in 22.2%. These TFBSs are highlighted in red in Figure 7.
Apart from the conserved TATA box and PRS motifs, the investigated S. miltiorrhiza HMGR4 promoter was found to contain several other common binding sites for TFs, belonging to P$AHBP (Arabidopsis homeobox protein), P$GTBX (GT box elements), P$DOFF (DNA binding with one finger) and P$L1BX (L1 box); these were shared by 8–13% of the tested sequences. Nucleotide pairwise alignment of S. miltiorrhiza HMGR4 with the remaining tested sequences found 13 to 31% identity (mean 24.7%).

3. Discussion

Our study presents new data regarding the isolated S. miltiorrhiza HMGR4 promoter and 5′UTR and compares these sequences with other plant HMGRs.
Initially, the sequences were examined for the presence of certain distinctive motifs (Figure 1). One such motif found in the investigated sequences is the TATA box, which is estimated to be present in 30–50% of all known promoters [41] and 29% of A. thaliana promoters [42]. It was also detected in the S. miltiorrhiza HMGR2 promoter [43]. Previous studies in human and yeast models indicate that the TATA box is more common in promoters of highly-regulated genes and in those stimulated by stress factors and extracellular signals [44,45,46,47,48]; in contrast, TATA-less genes are more constitutively expressed and associated with key processes such as cell growth [44,45,46,47,48]. In addition, promoters containing the TATA box appear to have a more conserved sequence than those that do not [49].
The HMGR4 promoter is also characterised by the presence of a single tandem repeat. This motif is estimated to be present in only 25% of promoters [50], and is absent from the S. miltiorrhiza HMGR2 promoter [43]. As tandem repeats are more prone to mutation, which affects the length of the repeat and thus local nucleosome positioning and gene expression rate, genes whose promoters have tandem repeats show higher rates of transcription divergence [50].
Both the HMGR2 promoter and the studied HMGR4 promoter lack CpG islands [43]. The cytosines in the CG dinucleotides of the islands can be methylated, thus inhibiting gene expression [51,52]. However, the CpG cluster is not required for methylation since, in plants, it can also occur within the CHG and CHH sequences (H = A, T or C) [53].
A PRS is also detected in the 5′UTR of the described sequence. This is a rather rare observation, but not an unprecedented one, as a PRS has also been found in the 5′UTR of the S. miltiorrhiza HMGR2 gene [43]. It is believed to take part in the organisation of the spliceosomal complex [54].
Furthermore, the examined S. miltiorrhiza HMGR4 promoter sequence turned out to be rich in TFBSs recognised by specific TFs (File S1). The conducted research indicates that the number of promoter regulatory elements and interacting proteins positively correlates with divergence of gene expression [55]. The HMGR4 proximal promoter was found to contain consensus sequences mainly related to the response to light, SA, bacterial infection, auxins, ABA, gibberellin, chitin, cold or, finally, salt stress (Figure 2), suggesting that these factors may participate in gene regulation. One previous paper investigating the influence of external agents on S. miltiorrhiza HMGR4 found that treatment with 200 µM MeJa had no significant effect on HMGR4 expression in either leaves or roots [19]. It is important to note that the effect of these factors has been examined on other S. miltiorrhiza HMGR genes. Chen et al. found that only 100% red light slightly increased the expression of HMGR in hairy root culture, while other light types (e.g., 100% far-red, 100% blue, red:far-red, blue:far-red, red:blue, red:blue:UV) had an inhibitory effect [56]. In contrast, Wang et al. noted that UV-B enhanced the expression of HMGR1 in roots almost 5-fold compared to an untreated control [57]. Incubation of hairy root culture with 100 µM SA raised HMGR transcript level, peaking at three-times higher than baseline after 36 h [58]. In turn, 200 µM SA has been found to have a differential effect on HMGR2 promoter in leaf material [43]. A decrease in its activity was observed after 12, 24 and 48 h of treatment, while a 2.5- to 3-fold rise compared to the calibrator values was observed after 72 and 96 h. Bacteria appeared to be good activators of HMGR expression. The addition of Pseudomonas brassicacearum subsp. neoaurantiaca and Pseudomonas thivervalensis to S. miltiorrhiza root culture resulted in 2.1- and 1.5-fold enhancements in HMGR enzyme activity, respectively [59]. In addition, Streptomyces pactum Act12 increased HMGR1 expression by more than a factor of 35 on day 14 relative to the calibrator [60]. Exposure to 2.85 µM IAA and 2.88 µM gibberellic acid improved the activity of the HMGR2 promoter, resulting in manifold higher expression compared to the calibrator in 96 h [43]. In turn, 200 µM and 10 µM ABA upregulated HMGR1 and HMGR2, respectively [43,61]. Salt stress (50 mM, 100 mM, 200 mM, 300 mM NaCl) enhanced the expression and enzymatic activity of HMGR in leaves and roots over 48 h of exposure [62]. It was also found that 200 mM NaCl inhibited the level of HMGR1 transcript in leaves and roots as compared to the calibrator [63].
As non-coding regions are generally not highly conserved, from an evolutionary perspective, finding such motifs in the promoter or 5′UTR sequences suggest they have functional importance [64].
Within the studied 36 HMGR sequences, the most frequently-identified conserved motif was the TATA box (Figure 7). This is a known sequence that has been conserved from Archaebacteria to humans [65]. The other TFBSs discussed in the Results section were shared by a much smaller number of tested sequences (27.8% or fewer).
The study also examined the possibility that more complex structures could be created by TFs interacting with the HMGR4 promoter. TFs participate in the regulation of gene expression as monomers, dimers (homo- and heterodimers) or multimers. Dimers and multimers are often preferred by nature because they allow specific interactions with the promoter sequence and bind with high affinity [66]. One TF monomer can create dimers or multimers with different functions, thus mediating the regulation of various genes, by forming bonds with multiple, but not random, protein partners [67]. Our analyses revealed the presence of closely-related TFBSs for the following TFs in the S. miltiorrhiza HMGR4 proximal promoter: HD-ZIP (ATML1, PDF2 and HDG1), WRKY (WRKY2, WRKY14, WRKY45, WRKY57 and WRKY69) and Dof (DOF5.4) (Table 1). The HD-ZIP proteins are unique to the plant kingdom. TFs from the family are unable to bind to DNA as monomers [68]. They form homo- and heterodimers via the leucine zipper motif [67]. Meanwhile, ATML1 was able to create a heterodimer with its paralogue PDF2 in studies on Nicotiana benthamiana and A. thaliana [69,70], and to form homodimers in vitro [69,71]. It has been shown that WRKY TFs can interact with DNA as monomers or create homo- and heterodimers, especially those with a leucine zipper motif [72,73,74], WRKY2 protein was found to form homodimers in Hordeum vulgare [75], while WRKY45 created homodimers in vitro by exchanging β4-β5 strands in Oryza sativa [72]. The Dof TFs have a multifunctional domain that allows them to bind to DNA and interact with other proteins [76] and to establish homo- and heterodimers.
As miRNA is believed to regulate plant promoter activity at the transcription level, the investigated HMGR4 sequence was searched for miRNA binding sites and interacting miRNAs [27]. Of the 12 miRNAs potentially binding to the HMGR4 promoter and 5′UTR sequences (Table 2), non-conserved miR1128 and miR1436 were detected during deep sequencing in S. miltiorrhiza [77]. However, their significance in the regulation of gene expression has not yet been investigated at the experimental level.
The results of our present in silico analysis of the HMGR4 promoter and 5′UTR sequences constitute a strong basis for planning future necessary experiments on S. miltiorrhiza.

4. Materials and Methods

4.1. Plant Material

S. miltiorrhiza plants were cultivated from seeds provided by the Garden of Medicinal Plants of the Medical University of Lodz. The plants were grown in pots containing composite soil at 26 ± 2 °C under natural light. Six-month-old plants were used for the experiment.

4.2. Isolation of the S. miltiorrhiza HMGR4 Promoter Sequence

Genomic DNA used for isolation of the HMGR4 promoter was obtained from young, fresh S. miltiorrhiza leaves and stems according to the method proposed by Khan et al. [78]. The DNA was analysed using a NanoPhotometer P300 (Implen, Munich, Germany) to determine its quantity and quality based on A260/A280 and A260/A230 ratios. The HMGR4 promoter region was isolated using GenomeWalker Universal Kit (Takara Bio, Kusatsu, Japan) according to the manufacturer’s instructions. A 5′-terminal fragment of the HMGR4 gene, deposited in GenBank under accession number JN831103.1, was used as a target for designing GSP1 and GSP2 specific primers (Table S4). The PCR reactions were performed using the Advantage 2 PCR Kit (Takara Bio, Kusatsu, Japan). The amplified DNA fragments were TOPO-TA cloned into a pCRII-TOPO vector (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The inserts were Sanger sequenced (CoreLab, Medical University of Lodz, Lodz, Poland) with specific primers listed in Table S4. The HMGR4 promoter sequence was assembled using CodonCode Aligner software version 8.0.2 (CodonCode Corporation, Centerville, MA, USA).
The isolation and sequencing of the S. miltiorrhiza HMGR4 promoter took approximately one month.

4.3. In Silico Analysis of the S. miltiorrhiza HMGR4 Promoter Sequence

The obtained HMGR4 promoter sequence was characterised in silico using available tools and databases [79]. The promoter, TATA box, TSS and 5′UTR positions were identified with TSSP software (Softberry Inc., Mount Kisco, NY, USA) [80]. Tandem repeats, CpG islands, TFBSs and TFs were detected using PlantPan 2.0 [81]. The promoter sequence was screened for the presence of commonly-known consensus motifs reported in the published literature. Assuming that the functional TFBSs are concentrated mainly in the proximal promoters, special attention was paid to the promoter region lying within 300 bp from the TSS. The miRBase tool was used to search for miRNA binding sites and interacting miRNAs in the obtained promoter and 5′UTR sequences [82].

4.4. Microarray and NGS Co-Expression Data Analysis

Protein BLAST (NCBI, Bethesda, MD, USA) and MEGA X version 10.2.6 (Pennsylvania State University, State College, PA, USA) [83] were employed to determine which of the A. thaliana HMGR genes is a homologue of the S. miltiorrhiza HMGR4 gene. Analyses were performed on coding sequences. Expression Angler (BAR, Toronto, ON, Canada) [84] and Arabidopsis RNA-seq Database [85] were utilised to find TF genes co-expressed with the selected A. thaliana HMGR gene. The Expression Angler tool has access to the expression results for approximately 22,000 Arabidopsis genes, while the Arabidopsis RNA-seq Database integrates 28,164 publicly available Arabidopsis RNA-seq libraries. The following microarray dataset compendiums were used during the study: AtGenExpress Hormone and Chemical, AtGenExpress Abiotic Stress, AtGenExpress Pathogen, AtGenExpress Tissue, and AtGenExpress Plus—Extended Tissue. The Pearson’s correlation coefficient (r) ranging from 0.50 to 1.00 (moderate to strong positive correlation) was applied to identify co-regulated genes. Information on the detected TFs was obtained from the UniProt database [86]. The collected results were compared with the in silico data found by PlantPan 2.0. The occurrence of interactions between the received common TFs was determined using Pathway System (Genomatix, Munich, Germany) and the BioGRID database version 4.4.201 [87].

4.5. Comparison of S. miltiorrhiza HMGR Promoters

The entire available S. miltiorrhiza HMGR promoter sequences, i.e., HMGR1 (GU367911.1), HMGR2 (KF297286.1), and HMGR4 (KT921337.1) were analysed with Common TFs, FrameWorker and DiAlign TF tools from Genomatix, Munich, Germany. Common TFs was used for preliminary analysis of the common TFBSs and interacting TFs located anywhere in the investigated promoters. The search only included sites that were common to all three sequences. The similarity of the matrix to the tested sequences was set to the highest possible value, i.e., 0.05. The FrameWorker tool permitted the common, most complex framework of TFBSs to be extracted from the input promoters. Frameworks are defined as TFBSs that occur in the same order and in a specificed space range in all of the sequences. The DiAlign TF allowed for multiple alignment of the studied HMGR promoters, and revealed conserved regions and TFBSs located therein. The analyses using the Genomatix tools were based on matrix library version 11.3 and default search criteria.

4.6. Assessment of Conservation of Plant HMGR Promoters

The conservation of the 36 available HMGR promoters derived from plants such as A. thaliana, Arabidopsis lyrata, Glycine max, Gossypium hirsutum, Oryza sativa, Solanum lycopersicum, Zea mays and S. miltiorrhiza was assessed by aligning their sequences. Proximal promoters and 5′UTR sequences (each sequence 500 bases long) were obtained from PlantPan 3.0 [88] and NCBI Nucleotide databases with the participation of the UniProt [86]. Alignments were performed using the MUSCLE algorithm from the MEGA X software, version 10.2.6 [83]. TFBSs located in the conserved regions of the compared sequences were recognised with the DiAlign TF tool (Genomatix, Munich, Germany).

5. Conclusions

Regulation of S. miltiorrhiza HMGR4 gene expression can occur during flowering, embryogenesis, organogenesis and circadian rhythm, and are influenced mainly by factors such as light, SA, bacterial infection and auxins.
The presence of binding sites for TFs that promote the biosynthesis of tanshinones may indicate that the S. miltiorrhiza HMGR4 gene plays an important role in the production of these metabolites.
A comparison of TFBSs and TFs in the S. miltiorrhiza HMGR1, HMGR2, and HMGR4 promoter sequences indicates that these genes can be co-regulated in response to abiotic and biotic factors, and during organogenesis.
The S. miltiorrhiza HMGR4 promoter is not highly conserved.
Future research on the S. miltiorrhiza HMGR4 promoter could be developed towards preparing promoter deletion mutants, and studying their transcriptional activity [89]. Moreover, mutagenesis of particular TFBSs could be suitable for experimental verification of their importance in response to biotic or abiotic factors [89]. The TFs or other regulatory proteins could be isolated using a yeast-one hybrid (Y1H) system and the promoter segments as bait [90]. Isolated TFs could be functionally characterised by studying their DNA binding properties, and their potential to increase expression of specific genes [91,92]. These studies could be verified by chromatin immunoprecipitation-sequencing (ChIP-seq) of DNA fragments that are associated with particular proteins [93]. Finally, regulatory networks of TFs and other proteins playing a pivotal role in the response to certain external factors could be built using transcriptomic RNA sequencing, and weighted gene co-expression network analysis (WGCNA) [94,95].

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11141861/s1, Figure S1: Unrooted dendrogram of HMGR sequences from S. miltiorrhiza and A. thaliana; Table S1: TFs responsive to light, hormone, wounding and pathogen stimulation found in the entire S. miltiorrhiza HMGR4 promoter sequence using PlantPan 2.0 database; Table S2: TFs responsive to major abiotic and biotic factors found in the proximal S. miltiorrhiza HMGR4 promoter using the PlantPan 2.0 database; Table S3: TF genes co-expressed with A. thaliana HMGR1 found with the Expression Angler tool; Table S4: Primers used in the study.

Author Contributions

Conceptualization, M.M. and P.S.; methodology, M.M. and P.S.; formal analysis, M.M. and P.S.; investigation, M.M. and P.S.; writing—original draft preparation, M.M.; writing—review and editing, P.S. and Ł.K.; visualization, M.M.; supervision, P.S. and Ł.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Medical University of Lodz (grant nos. 502-03/3-012-02/502-34-103, 503/3-012-01/503-31-001-19-00 and 503/3-012-02/503-31-001-19-00).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article and supplementary material.

Acknowledgments

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Xu, Y.; Wan, R.; Lin, Y.; Yang, L.; Chen, Y.; Liu, C. Recent advance on research and application of Salvia miltiorrhiza. Asian J. Pharmacodyn. Pharmacokinet. 2007, 7, 99–130. [Google Scholar]
  2. Cheng, T.O. Cardiovascular effects of Danshen. Int. J. Cardiol. 2007, 121, 9–22. [Google Scholar] [CrossRef] [PubMed]
  3. Zhang, H.S.; Wang, S.Q. Salvianolic acid B from Salvia miltiorrhiza inhibits tumor necrosis factor-alpha (TNF-alpha)-induced MMP-2 upregulation in human aortic smooth muscle cells via suppression of NAD(P)H oxidase-derived reactive oxygen species. J. Mol. Cell. Cardiol. 2006, 41, 138–148. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, H.N.; An, C.N.; Zhang, H.N.; Pu, X.P. Protocatechuic acid inhibits neurotoxicity induced by MPTP in vivo. Neurosci. Lett. 2010, 474, 99–103. [Google Scholar] [CrossRef] [PubMed]
  5. Wong, K.K.; Ho, M.T.; Lin, H.Q.; Lau, K.F.; Rudd, J.A.; Chung, R.C.; Fung, K.P.; Shaw, P.C.; Wan, D.C. Cryptotanshinone, an acetylcholinesterase inhibitor from Salvia miltiorrhiza, ameliorates scopolamine-induced amnesia in Morris water maze task. Planta Med. 2010, 76, 228–234. [Google Scholar] [CrossRef]
  6. Kang, D.G.; Oh, H.; Sohn, E.J.; Hur, T.Y.; Lee, K.C.; Kim, K.J.; Kim, T.Y.; Lee, H.S. Lithospermic acid B isolated from Salvia miltiorrhiza ameliorates ischemia/reperfusion-induced renal injury in rats. Life Sci. 2004, 75, 1801–1816. [Google Scholar] [CrossRef]
  7. Wu, Z.M.; Wen, T.; Tan, Y.F.; Liu, Y.; Ren, F.; Wu, H. Effects of salvianolic acid a on oxidative stress and liver injury induced by carbon tetrachloride in rats. Basic Clin. Pharmacol. Toxicol. 2007, 100, 115–120. [Google Scholar] [CrossRef]
  8. Li, J.; Xu, M.; Fan, Q.; Xie, X.; Zhang, Y.; Mu, D.; Zhao, P.; Zhang, B.; Cao, F.; Wang, Y.; et al. Tanshinone IIA ameliorates seawater exposure-induced lung injury by inhibiting aquaporins (AQP) 1 and AQP5 expression in lung. Respir. Physiol. Neurobiol. 2011, 176, 39–49. [Google Scholar] [CrossRef]
  9. Che, X.H.; Park, E.J.; Zhao, Y.Z.; Kim, W.H.; Sohn, D.H. Tanshinone II A induces apoptosis and S phase cell cycle arrest in activated rat hepatic stellate cells. Basic Clin. Pharmacol. Toxicol. 2010, 106, 30–37. [Google Scholar] [CrossRef]
  10. Isacchi, B.; Fabbri, V.; Galeotti, N.; Bergonzi, M.C.; Karioti, A.; Ghelardini, C.; Vannucchi, M.G.; Bilia, A.R. Salvianolic acid B and its liposomal formulations: Anti-hyperalgesic activity in the treatment of neuropathic pain. Eur. J. Biochem. 2011, 44, 552–558. [Google Scholar] [CrossRef]
  11. Yang, X.Y.; Qiang, G.F.; Zhang, L.; Zhu, X.M.; Wang, S.B.; Sun, L.; Yang, H.G.; Du, G.H. Salvianolic acid A protects against vascular endothelial dysfunction in high-fat diet fed and streptozotocin-induced diabetic rats. J. Asian Nat. Prod. Res. 2011, 13, 884–894. [Google Scholar] [CrossRef] [PubMed]
  12. Serra, S.; Vacca, G.; Tumatis, S.; Carrucciu, A.; Morazzoni, P.; Bombardelli, E.; Colombo, G.; Gessa, G.L.; Carai, M.A. Anti-relapse properties of IDN 5082, a standardized extract of Salvia miltiorrhiza, in alcohol-preferring rats. J. Ethnopharmacol. 2003, 88, 249–252. [Google Scholar] [CrossRef]
  13. Lu, S. The Salvia Miltiorrhiza Genome; Springer: Cham, Switzerland, 2019; pp. 129–139. [Google Scholar]
  14. Liao, P.; Hemmerlin, A.; Bach, T.J.; Chye, M.L. The potential of the mevalonate pathway for enhanced isoprenoid production. Biotechnol. Adv. 2016, 34, 697–713. [Google Scholar] [CrossRef] [PubMed]
  15. Hemmerlin, A. Post-translational events and modifications regulating plant enzymes involved in isoprenoid precursor biosynthesis. Plant Sci. 2013, 203–204, 41–54. [Google Scholar] [CrossRef] [PubMed]
  16. Leivar, P.; Antolín-Llovera, M.; Ferrero, S.; Closa, M.; Arró, M.; Ferrer, A.; Boronat, A.; Campos, N. Multilevel control of Arabidopsis 3-hydroxy-3-methylglutaryl coenzyme A reductase by protein phosphatase 2A. Plant Cell 2011, 23, 1494–1511. [Google Scholar] [CrossRef] [Green Version]
  17. Liao, P.; Zhou, W.; Zhang, L.; Wang, J.; Yan, X.; Zhang, Y.; Zhang, R.; Li, L.; Zhou, G.; Kai, G. Molecular cloning, characterization and expression analysis of a new gene encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase from Salvia miltiorrhiza. Acta Physiol. Plant. 2009, 31, 565–572. [Google Scholar] [CrossRef]
  18. Dai, Z.; Cui, G.; Zhou, S.F.; Zhang, X.; Huang, L. Cloning and characterization of a novel 3-hydroxy-3-methylglutaryl coenzyme A reductase gene from Salvia miltiorrhiza involved in diterpenoid tanshinone accumulation. J. Plant Physiol. 2011, 168, 148–157. [Google Scholar] [CrossRef]
  19. Ma, Y.; Yuan, L.; Wu, B.; Li, X.; Chen, S.; Lu, S. Genome-wide identification and characterization of novel genes involved in terpenoid biosynthesis in Salvia miltiorrhiza. J. Exp. Bot. 2012, 63, 2809–2823. [Google Scholar] [CrossRef] [Green Version]
  20. Hernandez-Garcia, C.M.; Finer, J.J. Identification and validation of promoters and cis-acting regulatory elements. Plant Sci. 2014, 217–218, 109–119. [Google Scholar] [CrossRef] [Green Version]
  21. Yu, C.P.; Lin, J.J.; Li, W.H. Positional distribution of transcription factor binding sites in Arabidopsis thaliana. Sci. Rep. 2016, 6, 25164. [Google Scholar] [CrossRef]
  22. Hussain, T.; Rehman, N.; Inam, S.; Ajmal, W.; Afroz, A.; Muhammad, A.; Zafar, Y.; Ali, G.M.; Khan, M.R. Homotypic clusters of transcription factor binding sites in the first large intron of AGL24 MADS-box transcription factor are recruited in the enhancement of floral expression. Plant Mol. Biol. Rep. 2019, 37, 24–40. [Google Scholar] [CrossRef]
  23. Allen, B.L.; Taatjes, D.J. The Mediator complex: A central integrator of transcription. Nat. Rev. Mol. Cell Biol. 2015, 16, 155–166. [Google Scholar] [CrossRef] [PubMed]
  24. Khan, D.; Ziegler, D.J.; Kalichuk, J.L.; Hoi, V.; Huynh, N.; Hajihassani, A.; Parkin, I.A.P.; Robinson, S.J.; Belmonte, M.F. Gene expression profiling reveals transcription factor networks and subgenome bias during Brassica napus seed development. Plant J. 2022, 109, 477–489. [Google Scholar] [CrossRef]
  25. Engels, B.M.; Hutvagner, G. Principles and effects of microRNA-mediated post-transcriptional gene regulation. Oncogene 2006, 25, 6163–6169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Pillai, R.S.; Bhattacharyya, S.N.; Filipowicz, W. Repression of protein synthesis by miRNAs: How many mechanisms? Trends Cell Biol. 2007, 17, 118–126. [Google Scholar] [CrossRef]
  27. Yang, G.; Li, Y.; Wu, B.; Zhang, K.; Gao, L.; Zheng, C. MicroRNAs transcriptionally regulate promoter activity in Arabidopsis thaliana. J. Integr. Plant Biol. 2019, 61, 1128–1133. [Google Scholar] [CrossRef]
  28. Ye, R.; Wang, W.; Iki, T.; Liu, C.; Wu, Y.; Ishikawa, M.; Zhou, X.; Qi, Y. Cytoplasmic assembly and selective nuclear import of Arabidopsis Argonaute4/siRNA complexes. Mol. Cell 2012, 46, 859–870. [Google Scholar] [CrossRef] [Green Version]
  29. Place, R.F.; Li, L.C.; Pookot, D.; Noonan, E.J.; Dahiya, R. MicroRNA-373 induces expression of genes with complementary promoter sequences. Proc. Natl. Acad. Sci. USA 2008, 105, 1608–1613. [Google Scholar] [CrossRef] [Green Version]
  30. Kim, D.H.; Saetrom, P.; Snøve, O., Jr.; Rossi, J.J. MicroRNA-directed transcriptional gene silencing in mammalian cells. Proc. Natl. Acad. Sci. USA 2008, 105, 16230–16235. [Google Scholar] [CrossRef] [Green Version]
  31. Holland, C.K.; Jez, J.M. Arabidopsis: The original plant chassis organism. Plant Cell Rep. 2018, 37, 1359–1366. [Google Scholar] [CrossRef]
  32. Woodward, A.W.; Bartel, B. Biology in Bloom: A Primer on the Arabidopsis thaliana Model System. Genetics 2018, 208, 1337–1349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Provart, N.J.; Alonso, J.; Assmann, S.M.; Bergmann, D.; Brady, S.M.; Brkljacic, J.; Browse, J.; Chapple, C.; Colot, V.; Cutler, S.; et al. 50 years of Arabidopsis research: Highlights and future directions. New Phytol. 2016, 209, 921–944. [Google Scholar] [CrossRef]
  34. Cantó-Pastor, A.; Mason, G.A.; Brady, S.M.; Provart, N.J. Arabidopsis bioinformatics: Tools and strategies. Plant J. 2021, 108, 1585–1596. [Google Scholar] [CrossRef] [PubMed]
  35. Dey, N.; Sarkar, S.; Acharya, S.; Maiti, I.B. Synthetic promoters in planta. Planta 2015, 242, 1077–1094. [Google Scholar] [CrossRef]
  36. Shi, M.; Wang, Y.; Wang, X.; Deng, C.; Cao, W.; Hua, Q.; Kai, G. Simultaneous promotion of tanshinone and phenolic acid biosynthesis in Salvia miltiorrhiza hairy roots by overexpressing Arabidopsis MYC2. Ind. Crops Prod. 2020, 155, 112826. [Google Scholar] [CrossRef]
  37. Deng, C.; Hao, X.; Shi, M.; Fu, R.; Wang, Y.; Zhang, Y.; Zhou, W.; Feng, Y.; Makunga, N.P.; Kai, G. Tanshinone production could be increased by the expression of SmWRKY2 in Salvia miltiorrhiza hairy roots. Plant Sci. 2019, 284, 1–8. [Google Scholar] [CrossRef]
  38. Zhang, Y.; Xu, Z.; Ji, A.; Luo, H.; Song, J. Genomic survey of bZIP transcription factor genes related to tanshinone biosynthesis in Salvia miltiorrhiza. Acta Pharm. Sin. B 2018, 8, 295–305. [Google Scholar] [CrossRef] [PubMed]
  39. Zhang, X.; Luo, H.; Xu, Z.; Zhu, Y.; Ji, A.; Song, J.; Chen, S. Genome-wide characterisation and analysis of bHLH transcription factors related to tanshinone biosynthesis in Salvia miltiorrhiza. Sci. Rep. 2015, 5, 11244. [Google Scholar] [CrossRef] [Green Version]
  40. Chen, Y.; Wang, Y.; Guo, J.; Yang, J.; Zhang, X.; Wang, Z.; Cheng, Y.; Du, Z.; Qi, Z.; Huang, Y.; et al. Integrated Transcriptomics and Proteomics to Reveal Regulation Mechanism and Evolution of SmWRKY61 on Tanshinone Biosynthesis in Salvia miltiorrhiza and Salvia castanea. Front. Plant Sci. 2021, 12, 820582. [Google Scholar] [CrossRef]
  41. Shahmuradov, I.A.; Umarov, R.K.; Solovyev, V.V. TSSPlant: A new tool for prediction of plant Pol II promoters. Nucleic Acids Res. 2017, 45, e65. [Google Scholar] [CrossRef]
  42. Molina, C.; Grotewold, E. Genome wide analysis of Arabidopsis core promoters. BMC Genom. 2005, 6, 25. [Google Scholar] [CrossRef] [Green Version]
  43. Szymczyk, P.; Grąbkowska, R.; Skała, E.; Żebrowska, M.; Balcerczak, E.; Jeleń, A. Isolation and characterization of a 3-hydroxy-3-methylglutaryl coenzyme A reductase 2 promoter from Salvia miltiorrhiza. J. Plant Biochem. Biotechnol. 2018, 27, 223–236. [Google Scholar] [CrossRef]
  44. Tirosh, I.; Weinberger, A.; Carmi, M.; Barkai, N. A genetic signature of interspecies variations in gene expression. Nat. Genet. 2006, 38, 830–834. [Google Scholar] [CrossRef]
  45. Yang, C.; Bolotin, E.; Jiang, T.; Sladek, F.M.; Martinez, E. Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters. Gene 2007, 389, 52–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Basehoar, A.D.; Zanton, S.J.; Pugh, B.F. Identification and distinct regulation of yeast TATA box-containing genes. Cell 2004, 116, 699–709. [Google Scholar] [CrossRef] [Green Version]
  47. Bae, S.H.; Han, H.W.; Moon, J. Functional analysis of the molecular interactions of TATA box-containing genes and essential genes. PLoS ONE 2015, 10, e0120848. [Google Scholar] [CrossRef] [PubMed]
  48. de Jonge, W.J.; O’Duibhir, E.; Lijnzaad, P.; van Leenen, D.; Groot Koerkamp, M.J.; Kemmeren, P.; Holstege, F.C. Molecular mechanisms that distinguish TFIID housekeeping from regulatable SAGA promoters. EMBO J. 2017, 36, 274–290. [Google Scholar] [CrossRef] [PubMed]
  49. Cliften, P.; Sudarsanam, P.; Desikan, A.; Fulton, L.; Fulton, B.; Majors, J.; Waterston, R.; Cohen, B.A.; Johnston, M. Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 2003, 301, 71–76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Vinces, M.D.; Legendre, M.; Caldara, M.; Hagihara, M.; Verstrepen, K.J. Unstable tandem repeats in promoters confer transcriptional evolvability. Science 2009, 324, 1213–1216. [Google Scholar] [CrossRef] [Green Version]
  51. Davey, C.; Pennings, S.; Allan, J. CpG methylation remodels chromatin structure in vitro. J. Mol. Biol. 1997, 267, 276–288. [Google Scholar] [CrossRef] [PubMed]
  52. Bell, A.C.; Felsenfeld, G. Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 2000, 405, 482–485. [Google Scholar] [CrossRef] [PubMed]
  53. Henderson, I.R.; Jacobsen, S.E. Epigenetic inheritance in plants. Nature 2007, 447, 418–424. [Google Scholar] [CrossRef] [PubMed]
  54. Saulière, J.; Sureau, A.; Expert-Bezançon, A.; Marie, J. The polypyrimidine tract binding protein (PTB) represses splicing of exon 6B from the beta-tropomyosin pre-mRNA by directly interfering with the binding of the U2AF65 subunit. Mol. Cell. Biol. 2006, 26, 8755–8769. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Tirosh, I.; Barkai, N. Evolution of gene sequence and gene expression are not correlated in yeast. Trends Genet. 2008, 24, 109–113. [Google Scholar] [CrossRef]
  56. Chen, I.J.; Lee, M.S.; Lin, M.K.; Ko, C.Y.; Chang, W.T. Blue light decreases tanshinone IIA content in Salvia miltiorrhiza hairy roots via genes regulation. J. Photochem. Photobiol. B 2018, 183, 164–171. [Google Scholar] [CrossRef]
  57. Wang, C.H.; Zheng, L.P.; Tian, H.; Wang, J.W. Synergistic effects of ultraviolet-B and methyl jasmonate on tanshinone biosynthesis in Salvia miltiorrhiza hairy roots. J. Photochem. Photobiol. B 2016, 159, 93–100. [Google Scholar] [CrossRef]
  58. Hao, X.; Shi, M.; Cui, L.; Xu, C.; Zhang, Y.; Kai, G. Effects of methyl jasmonate and salicylic acid on tanshinone production and biosynthetic gene expression in transgenic Salvia miltiorrhiza hairy roots. Biotechnol. Appl. Biochem. 2015, 62, 24–31. [Google Scholar] [CrossRef]
  59. Yan, Y.; Zhang, S.; Zhang, J.; Ma, P.; Duan, J.; Liang, Z. Effect and mechanism of endophytic bacteria on growth and secondary metabolite synthesis in Salvia miltiorrhiza hairy roots. Acta Physiol. Plant. 2014, 36, 1095–1105. [Google Scholar] [CrossRef]
  60. Yan, Y.; Zhang, S.; Yang, D.; Zhang, J.; Liang, Z. Effects of Streptomyces pactum Act12 on Salvia miltiorrhiza hairy root growth and tanshinone synthesis and its mechanisms. Appl. Biochem. Biotechnol. 2014, 173, 883–893. [Google Scholar] [CrossRef]
  61. Yang, D.; Ma, P.; Liang, X.; Wei, Z.; Liang, Z.; Liu, Y.; Liu, F. PEG and ABA trigger methyl jasmonate accumulation to induce the MEP pathway and increase tanshinone production in Salvia miltiorrhiza hairy roots. Physiol. Plant. 2012, 146, 173–183. [Google Scholar] [CrossRef]
  62. Yu, W.; Yu, Y.; Wang, C.; Zhang, Z.; Xue, Z. Mechanism by which salt stress induces physiological responses and regulates tanshinone synthesis. Plant Physiol. Biochem. 2021, 164, 10–20. [Google Scholar] [CrossRef] [PubMed]
  63. Li, X.; Li, J.; Islam, F.; Najeeb, U.; Pan, J.; Hou, Z.; Shou, J.; Qin, J.; Xu, L. 5-Aminolevulinic acid could enhance the salinity tolerance by alleviating oxidative damages in Salvia miltiorrhiza. Food Sci. Technol. 2021, 42, 1–9. [Google Scholar] [CrossRef]
  64. Setlow, J.K. Genetic Engineering. Principles and Methods, 1st ed.; Springer Science Business Media LLC: New York, NY, USA, 1997; pp. 15–47. [Google Scholar]
  65. Reeve, J.N. Archaeal chromatin and transcription. Mol. Microbiol. 2003, 48, 587–598. [Google Scholar] [CrossRef] [Green Version]
  66. Matthews, J.M. Protein Dimerization and Oligomerization in Biology; Springer Science+Business Media: New York, NY, USA, 2012; pp. 1–170. [Google Scholar]
  67. Amoutzias, G.D.; Robertson, D.L.; Van de Peer, Y.; Oliver, S.G. Choose your partners: Dimerization in eukaryotic transcription factors. Trends Biochem. Sci. 2008, 33, 220–229. [Google Scholar] [CrossRef] [PubMed]
  68. Ariel, F.D.; Manavella, P.A.; Dezar, C.A.; Chan, R.L. The true story of the HD-Zip family. Trends Plant Sci. 2007, 12, 419–426. [Google Scholar] [CrossRef]
  69. San-Bento, R.; Farcot, E.; Galletti, R.; Creff, A.; Ingram, G. Epidermal identity is maintained by cell-cell communication via a universally active feedback loop in Arabidopsis thaliana. Plant J. 2014, 77, 46–58. [Google Scholar] [CrossRef]
  70. Rombolá-Caldentey, B.; Rueda-Romero, P.; Iglesias-Fernández, R.; Carbonero, P.; Oñate-Sánchez, L. Arabidopsis DELLA and two HD-ZIP transcription factors regulate GA signaling in the epidermis through the L1 box cis-element. Plant Cell 2014, 26, 2905–2919. [Google Scholar] [CrossRef] [Green Version]
  71. Abe, M.; Takahashi, T.; Komeda, Y. Identification of a cis-regulatory element for L1 layer-specific gene expression, which is targeted by an L1-specific homeodomain protein. Plant J. 2001, 26, 487–494. [Google Scholar] [CrossRef]
  72. Cheng, X.; Zhao, Y.; Jiang, Q.; Yang, J.; Zhao, W.; Taylor, I.A.; Peng, Y.L.; Wang, D.; Liu, J. Structural basis of dimerization and dual W-box DNA recognition by rice WRKY domain. Nucleic Acids Res. 2019, 47, 4308–4318. [Google Scholar] [CrossRef] [Green Version]
  73. Eulgem, T.; Rushton, P.J.; Robatzek, S.; Somssich, I.E. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 2000, 5, 199–206. [Google Scholar] [CrossRef]
  74. Ciolkowski, I.; Wanke, D.; Birkenbihl, R.P.; Somssich, I.E. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function. Plant Mol. Biol. 2008, 68, 81–92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  75. Shen, Q.H.; Saijo, Y.; Mauch, S.; Biskup, C.; Bieri, S.; Keller, B.; Seki, H.; Ulker, B.; Somssich, I.E.; Schulze-Lefert, P. Nuclear activity of MLA immune receptors links isolate-specific and basal disease-resistance responses. Science 2007, 315, 1098–1103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Yanagisawa, S. Dof DNA-binding domains of plant transcription factors contribute to multiple protein-protein interactions. Eur. J. Biochem. 1997, 250, 403–410. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  77. Xu, X.; Jiang, Q.; Ma, X.; Ying, Q.; Shen, B.; Qian, Y.; Song, H.; Wang, H. Deep sequencing identifies tissue-specific microRNAs and their target genes involving in the biosynthesis of tanshinones in Salvia miltiorrhiza. PLoS ONE 2014, 9, e111679. [Google Scholar] [CrossRef] [Green Version]
  78. Khan, S.; Qureshi, M.I.; Kamaluddin; Alam, T.; Abdin, M.Z. Protocol for isolation of genomic DNA from dry and fresh roots of medicinal plants suitable for RAPD and restriction digestion. Afr. J. Biotechnol. 2007, 6, 175–178. [Google Scholar] [CrossRef]
  79. Majewska, M.; Wysokińska, H.; Kuźma, Ł.; Szymczyk, P. Eukaryotic and prokaryotic promoter databases as valuable tools in exploring the regulation of gene transcription: A comprehensive overview. Gene 2018, 644, 38–48. [Google Scholar] [CrossRef]
  80. Shahmuradov, I.A.; Gammerman, A.J.; Hancock, J.M.; Bramley, P.M.; Solovyev, V.V. PlantProm: A database of plant promoter sequences. Nucleic Acids Res. 2003, 31, 114–117. [Google Scholar] [CrossRef] [Green Version]
  81. Chow, C.N.; Zheng, H.Q.; Wu, N.Y.; Chien, C.H.; Huang, H.D.; Lee, T.Y.; Chiang-Hsieh, Y.F.; Hou, P.F.; Yang, T.Y.; Chang, W.C. PlantPAN 2.0: An update of plant promoter analysis navigator for reconstructing transcriptional regulatory networks in plants. Nucleic Acids Res. 2016, 44, D1154–D1160. [Google Scholar] [CrossRef] [Green Version]
  82. Griffiths-Jones, S.; Grocock, R.J.; van Dongen, S.; Bateman, A.; Enright, A.J. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 2006, 34, D140–D144. [Google Scholar] [CrossRef]
  83. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  84. Toufighi, K.; Brady, S.M.; Austin, R.; Ly, E.; Provart, N.J. The Botany Array Resource: E-Northerns, Expression Angling, and promoter analyses. Plant J. 2005, 43, 153–163. [Google Scholar] [CrossRef] [PubMed]
  85. Zhang, H.; Zhang, F.; Yu, Y.; Feng, L.; Jia, J.; Liu, B.; Li, B.; Guo, H.; Zhai, J. A Comprehensive Online Database for Exploring ~20,000 Public Arabidopsis RNA-Seq Libraries. Mol. Plant 2020, 13, 1231–1233. [Google Scholar] [CrossRef] [PubMed]
  86. UniProt, C. UniProt: The universal protein knowledgebase in 2021. Nucleic Acids Res. 2021, 49, D480–D489. [Google Scholar] [CrossRef]
  87. Oughtred, R.; Rust, J.; Chang, C.; Breitkreutz, B.J.; Stark, C.; Willems, A.; Boucher, L.; Leung, G.; Kolas, N.; Zhang, F.; et al. The BioGRID database: A comprehensive biomedical resource of curated protein, genetic, and chemical interactions. Protein Sci. 2021, 30, 187–200. [Google Scholar] [CrossRef]
  88. Chow, C.N.; Lee, T.Y.; Hung, Y.C.; Li, G.Z.; Tseng, K.C.; Liu, Y.H.; Kuo, P.L.; Zheng, H.Q.; Chang, W.C. PlantPAN3.0: A new and updated resource for reconstructing transcriptional regulatory networks from ChIP-seq experiments in plants. Nucleic Acids Res. 2019, 47, D1155–D1163. [Google Scholar] [CrossRef] [Green Version]
  89. Luján, M.A.; Soria-García, Á.; Claver, A.; Lorente, P.; Rubio, M.C.; Picorel, R.; Alfonso, M. Different Cis-Regulatory Elements Control the Tissue-Specific Contribution of Plastid ω-3 Desaturases to Wounding and Hormone Responses. Front. Plant Sci. 2021, 12, 727292. [Google Scholar] [CrossRef]
  90. Yuan, L.; Perry, S.E. Plant Transcription Factors, 1st ed.; Humana Press: Totowa, NJ, USA, 2011; pp. 45–66. [Google Scholar]
  91. Zhang, X.; Ge, F.; Deng, B.; Shah, T.; Huang, Z.; Liu, D.; Chen, C. Molecular Cloning and Characterization of PnbHLH1 Transcription Factor in Panax notoginseng. Molecules 2017, 22, 1268. [Google Scholar] [CrossRef] [Green Version]
  92. Chen, R.; Cao, Y.; Wang, W.; Li, Y.; Wang, D.; Wang, S.; Cao, X. Transcription factor SmSPL7 promotes anthocyanin accumulation and negatively regulates phenolic acid biosynthesis in Salvia miltiorrhiza. Plant Sci. 2021, 310, 110993. [Google Scholar] [CrossRef]
  93. Chen, X.; Bhadauria, V.; Ma, B. ChIP-Seq: A Powerful Tool for Studying Protein-DNA Interactions in Plants. Curr. Issues Mol. Biol. 2018, 27, 171–180. [Google Scholar] [CrossRef]
  94. Chen, H.; Yang, Q.; Fu, H.; Chen, K.; Zhao, S.; Zhang, C.; Cai, T.; Wang, L.; Lu, W.; Dang, H.; et al. Identification of Key Gene Networks and Deciphering Transcriptional Regulators Associated With Peanut Embryo Abortion Mediated by Calcium Deficiency. Front. Plant Sci. 2022, 13, 814015. [Google Scholar] [CrossRef]
  95. Lei, X.; Liu, Z.; Xie, Q.; Fang, J.; Wang, C.; Li, J.; Wang, C.; Gao, C. Construction of two regulatory networks related to salt stress and lignocellulosic synthesis under salt stress based on a Populus davidiana × P. bolleana transcriptome analysis. Plant Mol. Biol. 2022. [Google Scholar] [CrossRef] [PubMed]
Plants 11 01861 g001 550
Figure 1. Isolated S. miltiorrhiza HMGR4 promoter sequence (1499 bp), 5′ untranslated region (5′UTR) (96 bp) and coding sequence fragment (51 bp). The potential TATA box, transcription start site (TSS), pyrimidine-rich sequence (PRS), tandem repeat and consensus sequences for hormone-, pathogen-, wounding-, light-, and anaerobic-responsive elements are signed and marked in pink on the strands. ABRE, abscisic acid-responsive element; ARE, anaerobic-responsive element; AuxRE, auxin-responsive element; BRRE, brassinosteroid-responsive element; ERE, ethylene-responsive element; LRE, light-responsive element; MJRE, methyl jasmonate-responsive element.
Figure 1. Isolated S. miltiorrhiza HMGR4 promoter sequence (1499 bp), 5′ untranslated region (5′UTR) (96 bp) and coding sequence fragment (51 bp). The potential TATA box, transcription start site (TSS), pyrimidine-rich sequence (PRS), tandem repeat and consensus sequences for hormone-, pathogen-, wounding-, light-, and anaerobic-responsive elements are signed and marked in pink on the strands. ABRE, abscisic acid-responsive element; ARE, anaerobic-responsive element; AuxRE, auxin-responsive element; BRRE, brassinosteroid-responsive element; ERE, ethylene-responsive element; LRE, light-responsive element; MJRE, methyl jasmonate-responsive element.
Plants 11 01861 g001
Plants 11 01861 g002 550
Figure 2. Classification of TFBSs found in the proximal S. miltiorrhiza HMGR4 promoter with regard to their response to biotic and abiotic factors.
Figure 2. Classification of TFBSs found in the proximal S. miltiorrhiza HMGR4 promoter with regard to their response to biotic and abiotic factors.
Plants 11 01861 g002
Plants 11 01861 g003 550
Figure 3. Classification of TFBSs found in the proximal S. miltiorrhiza HMGR4 promoter with regard to their biological functions.
Figure 3. Classification of TFBSs found in the proximal S. miltiorrhiza HMGR4 promoter with regard to their biological functions.
Plants 11 01861 g003
Plants 11 01861 g004 550
Figure 4. Interactions between TFs potentially binding to the S. miltiorrhiza HMGR4 promoter found with the Pathway System tool. The presented dependencies are based on co-citation (dashed line) or expert-curation (solid line). Diamond-ended lines indicate that a given TF has a predicted binding site in dependent promoter sequence. The number in the lower right corner of TF indicates the number of interactions within the network (including those not displayed). EBP = RAP 2-3, NAC3 = NAC055, RD26 = NAC072, ZF2 = AZF2, HB-1 = HAT5.
Figure 4. Interactions between TFs potentially binding to the S. miltiorrhiza HMGR4 promoter found with the Pathway System tool. The presented dependencies are based on co-citation (dashed line) or expert-curation (solid line). Diamond-ended lines indicate that a given TF has a predicted binding site in dependent promoter sequence. The number in the lower right corner of TF indicates the number of interactions within the network (including those not displayed). EBP = RAP 2-3, NAC3 = NAC055, RD26 = NAC072, ZF2 = AZF2, HB-1 = HAT5.
Plants 11 01861 g004
Plants 11 01861 g005 550
Figure 5. Distribution of matrix families common to the S. miltiorrhiza promoter sequences, i.e., HMGR1 (GU367911.1), HMGR2 (KF297286.1) and HMGR4 (KT921337.1) identified by the Common TFs tool. Black lines correspond to the promoter sequences. Each matrix family is marked with a semicircular coloured symbol. The figure shows families found on the positive and negative strands. P$AHBP, Arabidopsis homeobox proteins; P$L1BX, L1 box; P$MIIG, MYB IIG-type binding sites; P$DOFF, DNA binding with one finger; P$GTBX, GT box elements; P$MADS, MADS box proteins; P$MYBL, MYB-like proteins; P$MYBS, MYB proteins with single DNA binding repeat; P$NTMF, NAC factors with transmembrane motif; P$NACF, plant specific NAC proteins; P$KAN1, transcription repressor KANADI; P$WBXF, W box family; P$TODS, time-of-day-specific regulatory elements; P$NCS1, nodulin consensus sequence 1; P$SPF1, sweet potato DNA-binding factor with two WRKY domains; P$ZFAT, zinc finger proteins; P$LREM, light-responsive elements; P$PSPE, protein secretory pathway elements; P$CGCG, CGCG box binding proteins; P$PCDR, proteins involved in programmed cell death response; P$PNRE, plant nitrate-responsive elements; P$SCAP, stomatal carpenter.
Figure 5. Distribution of matrix families common to the S. miltiorrhiza promoter sequences, i.e., HMGR1 (GU367911.1), HMGR2 (KF297286.1) and HMGR4 (KT921337.1) identified by the Common TFs tool. Black lines correspond to the promoter sequences. Each matrix family is marked with a semicircular coloured symbol. The figure shows families found on the positive and negative strands. P$AHBP, Arabidopsis homeobox proteins; P$L1BX, L1 box; P$MIIG, MYB IIG-type binding sites; P$DOFF, DNA binding with one finger; P$GTBX, GT box elements; P$MADS, MADS box proteins; P$MYBL, MYB-like proteins; P$MYBS, MYB proteins with single DNA binding repeat; P$NTMF, NAC factors with transmembrane motif; P$NACF, plant specific NAC proteins; P$KAN1, transcription repressor KANADI; P$WBXF, W box family; P$TODS, time-of-day-specific regulatory elements; P$NCS1, nodulin consensus sequence 1; P$SPF1, sweet potato DNA-binding factor with two WRKY domains; P$ZFAT, zinc finger proteins; P$LREM, light-responsive elements; P$PSPE, protein secretory pathway elements; P$CGCG, CGCG box binding proteins; P$PCDR, proteins involved in programmed cell death response; P$PNRE, plant nitrate-responsive elements; P$SCAP, stomatal carpenter.
Plants 11 01861 g005
Plants 11 01861 g006 550
Figure 6. Selected 10-element-frameworks of TFBSs obtained for S. miltiorrhiza promoter sequences, i.e., HMGR1 (GU367911.1), HMGR2 (KF297286.1) and HMGR4 (KT921337.1) using the FrameWorker tool. Black lines correspond to the promoter sequences. Each matrix family is marked with a semicircular coloured symbol. The figure shows families found on the positive and negative strands. (A) P$SBPD, SBP-domain proteins; P$AHBP, Arabidopsis homeobox proteins; P$SUCB, sucrose box; P$WTBX, WT box; P$HEAT, heat shock factors; P$NACF, plant specific NAC proteins; (B) P$SCAP, stomatal carpenter; P$L1BX, L1 box; P$MIIG, MYB IIG-type binding sites; P$AHBP, Arabidopsis homeobox proteins; P$TCXF, CRC domain containing tesmin/TSO1-like CXC (TCX) factors; P$TGAF, basic/leucine zipper-type TFs of the TGA-family.
Figure 6. Selected 10-element-frameworks of TFBSs obtained for S. miltiorrhiza promoter sequences, i.e., HMGR1 (GU367911.1), HMGR2 (KF297286.1) and HMGR4 (KT921337.1) using the FrameWorker tool. Black lines correspond to the promoter sequences. Each matrix family is marked with a semicircular coloured symbol. The figure shows families found on the positive and negative strands. (A) P$SBPD, SBP-domain proteins; P$AHBP, Arabidopsis homeobox proteins; P$SUCB, sucrose box; P$WTBX, WT box; P$HEAT, heat shock factors; P$NACF, plant specific NAC proteins; (B) P$SCAP, stomatal carpenter; P$L1BX, L1 box; P$MIIG, MYB IIG-type binding sites; P$AHBP, Arabidopsis homeobox proteins; P$TCXF, CRC domain containing tesmin/TSO1-like CXC (TCX) factors; P$TGAF, basic/leucine zipper-type TFs of the TGA-family.
Plants 11 01861 g006
Plants 11 01861 g007 550
Figure 7. Alignment of proximal promoter regions and 5′UTRs of Arabidopsis thaliana (At), Arabidopsis lyrata (Al), Gossypium hirsutum (Gh), Glycine max (Gm), Oryza sativa (Os), Solanum lycopersicum (Sl), Zea mays (Zm) and Salvia miltiorrhiza (Sm) HMGR genes. Conserved nucleotides are marked in blue. The darker the colour, the greater the degree of conservation within the analysed sequences. The proximal promoters are present at the beginning and the 5′UTRs at the end of the displayed sequences, respectively. Conserved TFBSs identified by DiAlign TF tool are highlighted in red. P$AHBP, Arabidopsis homeobox protein; P$GCCF, GCC box family; P$TDTF, transposase-derived proteins; P$MYBL, MYB-like proteins; P$L1BX, L1 box; P$DREB, dehydration responsive element binding factors; P$ROOT, root hair-specific cis-elements in angiosperms.
Figure 7. Alignment of proximal promoter regions and 5′UTRs of Arabidopsis thaliana (At), Arabidopsis lyrata (Al), Gossypium hirsutum (Gh), Glycine max (Gm), Oryza sativa (Os), Solanum lycopersicum (Sl), Zea mays (Zm) and Salvia miltiorrhiza (Sm) HMGR genes. Conserved nucleotides are marked in blue. The darker the colour, the greater the degree of conservation within the analysed sequences. The proximal promoters are present at the beginning and the 5′UTRs at the end of the displayed sequences, respectively. Conserved TFBSs identified by DiAlign TF tool are highlighted in red. P$AHBP, Arabidopsis homeobox protein; P$GCCF, GCC box family; P$TDTF, transposase-derived proteins; P$MYBL, MYB-like proteins; P$L1BX, L1 box; P$DREB, dehydration responsive element binding factors; P$ROOT, root hair-specific cis-elements in angiosperms.
Plants 11 01861 g007
Table
Table 1. Transcription factor binding sites (TFBSs) with the potential to form dimers detected in the S. miltiorrhiza HMGR4 promoter sequence.
Table 1. Transcription factor binding sites (TFBSs) with the potential to form dimers detected in the S. miltiorrhiza HMGR4 promoter sequence.
Transcription Factor (TF) Family NameFragment of Promoter Sequence with Underlined TFBSs a and Potentially Interacting TF Pairs
˗AGAAAAATGGAATAAGAAGA
two salicylic acid (SA)-responsive TCA elements (AGAAAA and AGAAGA) spaced by eight nucleotides
˗ATCTCCAATCT
two LREs (ATCT) spaced by three nucleotides
HD-ZIPatTTAATgtaTTCATAAATata
ATML1/HDG1 and PDF2/ATML1 spaced by four nucleotides
WRKYAGTCATAACAATGTCAA
WRKY2/WRKY14/WRKY45/WRKY57/WRKY69 and WRKY2/WRKY14/WRKY45/WRKY57/WRKY69 spaced by six nucleotides
DofAAAGAAAAAAGA
DOF5.4 and DOF5.4 spaced by two nucleotides
a Most conserved positions within a matrix were written in capital letters.
Table
Table 2. Identification of microRNAs (miRNAs) potentially interacting with the S. miltiorrhiza HMGR4 promoter sequence and 5′UTR identified by the miRBase tool.
Table 2. Identification of microRNAs (miRNAs) potentially interacting with the S. miltiorrhiza HMGR4 promoter sequence and 5′UTR identified by the miRBase tool.
miRNA Name and SourcemiRNA SequenceSequence Alignment Position Start/EndStrande-Value
HMGR4Promoter
miR1128
Saccharum sp.		UACUACUCCCUCCGUCCCAAA350/368
405/423		+
−		0.75
4.2
miR6462c-5p
Populus trichocarpa		AAGGGACAAAAAUGGCAUAAGA259/279−3.5
miR1128
Triticum aestivum		UACUACUCCCUCCGUCCGAAA350/368+4.2
miR1436
Oryza sativa and Hordeum vulgare		ACAUUAUGGGACGGAGGGAGU354/368−6.2
miR5205a
Medicago truncatula		CAUACAAUUUGGGACGGAGGGAG355/374−9.1
miR8740
Gossypium raimondii		UAAUGAUGUGGCACAAUAUUA634/653−9.1
miR11573a and miR11573b
Picea abies		UUGGGGAGCGUAUUGUAGAUU197/216−9.1
5′UTR of HMGR4
miR477
Gossypium raimondii		CGAAGUCUUGGAAGAGAGUAA59/75−3.2
miR6180
Hordeum vulgare		AGGGUGGAAGAAAGAGGGCG55/69−3.9
miR4993
Glycine max		GAGCGGCGGCGGUGGAGGAUG13/30−6.9
miR12107-5p
Citrus sinensis		CUGAUGAGAGAGCGAAUGAUA51/66−8.4
Table
Table 3. TFs common between in silico analysis of the S. miltiorrhiza HMGR4 promoter and microarray co-expression studies with A. thaliana HMGR1.
Table 3. TFs common between in silico analysis of the S. miltiorrhiza HMGR4 promoter and microarray co-expression studies with A. thaliana HMGR1.
TF Family NameTF Gene Name and LocusProcesses in Which TF is Involved ar-Value bTFBS Motif and Localisation c,d
Homeodomain; HD-ZIPATHB-13; At1g69780cotyledon and leaf morphogenesis; primary root development; sucrose-signalling pathway0.594ATAAT 310; 309AATAA 308; 307
ATHB-16; At4g40060regulation of timing of transition from vegetative to reproductive phase; repression of cell expansion during plant development; response to blue light0.562ATAAT 309
HDG1; At3g61150maintenance of floral organ identity0.507ATTAA 161TTAAT 1218; 1331; 1332
ANL2; At4g00730regulation of tissue-specific accumulation of anthocyanins; cellular organisation of primary root; cuticle hydrocarbon biosynthetic process; plant-type cell wall modification; root hair cell differentiation0.524TTAAT 1218ATTAA 1161
ATML1; At4g21750cotyledon development; epidermal cell differentiation; seed dormancy and germination0.583TTAAT 1332
ATTTA 1057; 1282		TAAAT 987; 1272; 1346
PDF2; At4g04890cotyledon development; epidermal cell differentiation; seed dormancy and germination; maintenance of floral organ identity0.587ATTTA 1057; 1282TAAAT 987; 1272; 1346
Homeodomain; bZIP; HD-ZIPHAT5; At3g01470leaf morphogenesis; response to blue light and salt stress0.521ATAAT 307; 310AATAA 308; 307
bZIPBZIP25; At3g54620positive regulation of seed maturation0.666CCACG 822
TACGT 46; 720
ACGTA 47; 721		AACGT 290;1188
ACGTT 291; 1189
WRKYWRKY2; At5g56270regulation of basal cell division patterns during early embryogenesis; establishment of cell polarity; longitudinal axis specification; pollen development0.575/ 0.557TGACT 5; 832
AGTCA 111; 1240		TTGAC 831
GTCAA 913; 1147; 1251
WRKY14; At1g30650˗0.576
WRKY57; At1g69310response to osmotic stress, salt stress and water deprivation0.504
WRKY45; At3g01970phosphate ion transport0.515TTGAC 830; 831
TGACT 5; 832		AGTCA 111; 1240
GTCAA 913; 1147; 1251
WRKY69; At3g58710˗0.564
Myb/SANT; ARR-BARR2; At4g16110His-to-Asp phosphorelay signal transduction system; expression of nuclear genes for components of mitochondrial complex I; ethylene- and cytokinin-activated signalling pathways; promotion of cytokinin-mediated leaf longevity; root meristem growth; seed growth; stomatal movement0.552/0.611AATCT 15; 197; 919
AGATT 1405		AATCC 179; 204; 548
ARR14; At2g01760His-to-Asp phosphorelay signal transduction system; activation of some type-A response regulators in response to cytokinins0.509/
0.530
Myb/SANT; MYBMYB6; At4g09460response to ethylene, abscisic acid (ABA), indole-3-acetic acid, and Pseudomonas syringae pv. phaseolica0.599ACCTA 886
MYB-relatedRVE1; At5g17300morning-phased TF integrating circadian clock and auxin pathways; regulation of free indole-3-acetic acid level in time-of-day specific manner; negative regulation of freezing tolerance0.501ATATC 1166
RVE4; At5g02840regulation of circadian rhythm0.545/
0.573		ATATC 1166GATAT 1215
EIN3; EILEIL1; At2g27050positive regulation of ethylene response pathway; cellular response to iron ion; defence response to bacterium0.554TGTAT 374; 759ATACA 391
EIL3; At1g73730ethylene response pathway; sulphur metabolic process; cellular response to iron ion0.525ATGTA 757
MADS box; MIKCAGL18; At3g57390negative regulation of flowering and short-day photoperiodism; pollen development0.567TTTCC 804; 801
TTTTG 805
CAAAA 1396		AGAAA 293; 1402
GGAAA 1364; 1362
TTTTT 77; 78; 79, 80; 81; 82; 83; 84
SVP; At2g22540inhibition of floral transition in autonomous flowering pathway; identity of floral meristem; response to temperature stimulus0.537TTTCC 801GGAAA 1362
NAC; NAMNAC055; At3g15500jasmonic acid-mediated signalling pathway; response to water deprivation0.594TACGT 44; 718
CGTA 720
ACAT 644		TTGAC 829
ACGTA 44; 718; 720
NAC072; At4g27410activator in ABA-mediated dehydration response0.543CGTA 720
TTGAC 829		ACAT 644
NF-YBNFYB5; At2g47810protein heterodimerization activity0.558CTAAT 42
ATCGG 102; 131
CCCAT 139
CCAAG 149; 213
CCAAT 195; 202
GTTGG 389
ATGGG 959
ATTGC 1039
CGAAT 1115
ATTAG 1389
CCTAT 890
TTTGG 811		TCAAT 13; 1149; 1253
AATGG 462; 847
CCACT 144; 380; 1364
CCATT 169; 266; 701
CCAAC 530
AGTGG 592
ATTGA 766; 1099
ACAAT 460; 800; 1247
ATTGT 599; 637; 1145; 1152
CCAAA 176; 534; 1261; 1396
CAAAT 177; 469; 897; 1107; 1161; 1262; 1313
NF-YCNFYC10; At5g381400.523
TBPTBP2; At1g55520required for basal transcription (facilitating the recruitment of TFIID to the promoter, forming a preinitiation complex with RNA polymerase)0.645ATATA 746; 739
TTTTA 1022; 1078
TAAAA 541; 1465; 1024		TATAT 677; 1305; 743; 736
ATAAA 1025; 1466; 1344; 298; 439; 1024; 1465
TTTAT 669; 1016; 1072; 1297; 1223; 1303; 674; 1077; 1302
TCPTCP21; At5g08330positive regulation of circadian clock0.546CCCAC 818
AP2; ERFRAP2-3; At3g16770cell death; heat acclimation; ethylene-activated signalling pathway; response to cytokinin, jasmonic acid and other organism0.502TAAGA 494
C2H2AZF2; At3g19580inhibition of plant growth under abiotic stress conditions; negative regulation of ABA signalling during seed germination; positive regulation of leaf senescence; jasmonate early signalling response; response to chitin and water deprivation; plants overexpressing AZF2 have increased sensitivity to salt stress and barely survive under high salt conditions0.503ACACT 29; 1462
DofDOF5.4; At5g60850metal ion binding; binding of OBF TFs to OCS elements0.727CGTTA 685
AACGT 286; 1184
ACGTT 289; 1187
GCCTT 79
CCTTT 80; 807
AAAGT 109; 982
AAGGG 1031
AAGGA 1372		ACCTT 158; 184; 605; 612
GCTTT 369
AAAGC 400; 571
AAAGA 939; 1413; 1420
AAAGG 1030; 1289; 1371
TCTTT 252; 328; 586; 874
TCCTT 275; 338; 806; 1156
ACTTT 382; 509; 881; 1021; 1291
SBPSPL3; At2g33810promotion of vegetative phase change and flowering; vegetative- to reproductive-phase transition of meristem0.596AGTAC 51; 972
GTACA 578; 973
TGTAC 577
GTACT 52
ATACG 43
CGTAG 46		CTTAC 275; 427; 625
CGTCC 360
GGACG 405
CGAAC 524
CTACG 717
CGTAA 720
a The roles of the TFs were assumed based on the UniProt database. b r-value between the TFBSs found in the S. miltiorrhiza HMGR4 promoter and those detected in A. thaliana ranged from 0.5 to 1.0. c For TFBSs, only the most conserved positions within a matrix were listed. d TFBSs localised in proximal promoter region were put in bold.
Table
Table 4. Common TF matrix families found during in silico analysis of the S. miltiorrhiza HMGR1, HMGR2, HMGR4 promoter sequences using the Common TFs tool.
Table 4. Common TF matrix families found during in silico analysis of the S. miltiorrhiza HMGR1, HMGR2, HMGR4 promoter sequences using the Common TFs tool.
TF Matrix FamilyProcesses in Which TF Is Involved a
Arabidopsis homeobox proteins
(P$AHBP)		root, leaf and anther development; seed maturation; meristem initiation and growth; xylem and phloem pattern formation; cell differentiation; determination of bilateral symmetry; transition from vegetative to reproductive phase; glucosinolate metabolic process; response to: auxin, gibberellin, ABA, water deprivation, blue light and salt stress
L1 box
(P$L1BX)		cotyledon development; seed germination and dormancy; epidermal cell differentiation; maintenance of floral organ identity
MYB IIG-type binding sites
(P$MIIG)		root, seed, stamen and xylem development; cellular cadmium ion homeostasis; gibberellin and flavonol biosynthesis; defence response to fungi; response to: ABA, chitin, salt stress, cold, water deprivation, phosphate starvation, potassium ion and light
DNA binding with one finger
(P$DOFF)		secondary shoot, cotyledon and seed development; cell wall modification; cell cycle; gibberellin biosynthesis; response to: SA, auxin, chitin, red light and cold
GT box elements
(P$GTBX)		shoot system and stomatal complex development; trichome morphogenesis; seed maturation and germination; cell size and growth; response to: auxin and water deprivation
MADS box proteins
(P$MADS)		flower, ovule and seed coat development; seed maturation; meristem structural organisation; transition from vegetative to reproductive phase; short-day photoperiodism; circadian rhythm; response to auxin
MYB-like proteins
(P$MYBL)		integument, anther and pollen development; leaf morphogenesis; seed growth and dormancy; endothelial cell proliferation; vacuole organisation; wax biosynthesis; long-day photoperiodism; defence response to bacteria and fungi; response to: SA, brassinosteroid, gibberellin, ABA, jasmonic acid, chitin, salt, water deprivation and cold
MYB proteins with single DNA binding repeat
(P$MYBS)		leaf and lateral root development; leaf senescence; circadian rhythm; peroxidase activity; auxin and sulphate ion homeostasis; response to: ABA, phosphate starvation, absence of light and high light intensity
NAC factors with transmembrane motif
(P$NTMF)		leaf and trichome morphogenesis; xylem development; seed germination; photoperiodism; membrane protein proteolysis; response to: gibberellin, salt stress
plant specific NAC proteins
(P$NACF)		leaf and secondary shoot development; primary shoot apical meristem specification; formation of organ boundary; regulation of timing of organ formation; response to water deprivation
transcription repressor KANADI
(P$KAN1)		phenylpropanoid metabolic process
W box family
(P$WBXF)		induced systemic resistance; JA-mediated signalling pathway; phosphate ion transport; defence response to: bacteria, fungi and viruses; response to: SA, chitin and wounding
time-of-day-specific regulatory elements
(P$TODS)		circadian rhythm; red or far-red light signalling pathway; response to temperature
nodulin consensus sequence 1
(P$NCS1)		nodule-specific expression
zinc finger proteins
(P$ZFAT)		regulation of root development; phosphate ion homeostasis
light-responsive elements
(P$LREM)		response to hypoxia
protein secretory pathway elements
(P$PSPE)		SA induction of secretion-related genes via NPR1
CGCG box binding proteins
(P$CGCG)		leaf senescence; defence response to: bacteria, fungi and insects; response to: cold, auxins and water deprivation
proteins involved in programmed cell death response
(P$PCDR)		regulation of expression of vacuolar processing enzyme
plant nitrate-responsive elements
(P$PNRE)		nitrate assimilation; stomatal movement; response to: nitrate and water deprivation
stomatal carpenter
(P$SCAP)		stomatal movement
sweet potato DNA-binding factor with two WRKY domains
(P$SPF1)		˗
a The roles of the TFs were assumed based on the MatInspector (Genomatix) database.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Majewska, M.; Kuźma, Ł.; Szymczyk, P. Isolation and Comprehensive in Silico Characterisation of a New 3-Hydroxy-3-Methylglutaryl-Coenzyme A Reductase 4 (HMGR4) Gene Promoter from Salvia miltiorrhiza: Comparative Analyses of Plant HMGR Promoters. Plants 2022, 11, 1861. https://doi.org/10.3390/plants11141861

AMA Style

Majewska M, Kuźma Ł, Szymczyk P. Isolation and Comprehensive in Silico Characterisation of a New 3-Hydroxy-3-Methylglutaryl-Coenzyme A Reductase 4 (HMGR4) Gene Promoter from Salvia miltiorrhiza: Comparative Analyses of Plant HMGR Promoters. Plants. 2022; 11(14):1861. https://doi.org/10.3390/plants11141861

Chicago/Turabian Style

Majewska, Małgorzata, Łukasz Kuźma, and Piotr Szymczyk. 2022. "Isolation and Comprehensive in Silico Characterisation of a New 3-Hydroxy-3-Methylglutaryl-Coenzyme A Reductase 4 (HMGR4) Gene Promoter from Salvia miltiorrhiza: Comparative Analyses of Plant HMGR Promoters" Plants 11, no. 14: 1861. https://doi.org/10.3390/plants11141861

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop