Next Article in Journal
Factors Influencing Smallholder Farmers’ Decisions to Participate in Loan-Based Farming in Mutare District, Zimbabwe—A Double-Hurdle Model Approach
Previous Article in Journal
Solvency and Debt of Rural Communes vs. Their Residents’ Standards of Living: A Polish Case Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 13
Issue 12
10.3390/agriculture13122224
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Different Manures in Combination with Fulvic Acid on the Abundance of N-Cycling Functional Genes in Greenhouse Soils

by
Shouqiang Zhao
1,2,
Zhongyang Li
1,3,
Chuncheng Liu
1,
Jiuming Sun
1,4,
Jibin Song
1,2,
Xiaotong Li
1,2 and
Yuan Liu
1,*
1
Institute of Farmland Irrigation, Chinese Academy of Agricultural Sciences, Xinxiang 453002, China
2
Graduate School of Chinese Academy of Agricultural Sciences, Beijing 100081, China
3
National Research and Observation Station of Shangqiu Agro-Ecology System, Shangqiu 476000, China
4
College of Agriculture, Henan University, Kaifeng 475004, China
*
Author to whom correspondence should be addressed.
Agriculture 2023, 13(12), 2224; https://doi.org/10.3390/agriculture13122224
Submission received: 29 October 2023 / Revised: 27 November 2023 / Accepted: 29 November 2023 / Published: 30 November 2023
(This article belongs to the Special Issue Impacts of Fertilization and Irrigation on Soil Nitrogen Cycling and Crop Nitrogen Utilization)
Browse Figures
Review Reports Versions Notes

Abstract

:
To investigate the effects of different manures in combination with fulvic acid on the abundance of N-cycling functional genes in greenhouse soils, Chinese cabbage was planted for three growing seasons. A total of six treatments—pig manure (P), pig manure + fulvic acid (PH), chicken manure (C), chicken manure + fulvic acid (CH), sheep manure (S), sheep manure + fulvic acid (SH) and no fertilization (CK)—were set up. The abundance of 13 soil N-cycling functional genes (gdhA, amoA-1, amoA-2, amoB, narG, nirK-1, nirK-2, nirK-3, nirS-1, nirS-2, nirS-3, nosZ and nifH) were investigated after the harvest of the third growing season using a gene chip approach. The results showed that fertilization treatments increased the abundance of most N-cycling functional genes in the soil, such as nitrification genes amoA-2 and amoB as well as denitrification genes narG, nirK-1, nirS-1 and nirS-2, with the stronger influence of sheep and pig manure than chicken manure. Fortunately, the additional fulvic acid reduced the increasing effect resulting from pig, chicken and sheep manure application. The abundance of functional genes for nitrogen cycling in soil was positively correlated with the content of soil organic matter, available phosphorus and NO3−-N, and negatively correlated with electrical conductivity. Overall, fertilization treatments increased soil nitrification and denitrification genes abundance, with a risk of increasing soil nitrogen loss, but the supplementary fulvic acid could limit the increase. In this study, it was concluded that the sheep manure (31.3 t/ha) + fulvic acid (7.5 kg/ha) treatment was more powerful in regulating the abundance of N-cycling functional genes in soil.

1. Introduction

Soil nitrogen (N) research has been a hot topic in agriculture [1,2]. Nitrogen is one of the most important nutrients affecting the growth of crops and micro-organisms [3], and different forms of nitrogen undergo a complex transformation process in the soil environment [4]. It has been shown that soil nitrogen transformation is influenced by numerous environmental factors such as moisture [5], temperature [6], reactive substrates [7,8], organic matter (OM) [9,10], pH [11], among others. Most scholars proved that soil micro-organisms related to the nitrogen cycle play a major role in regulating nitrogen transformation processes, including mineralization, nitrification, denitrification and fixation [12,13,14]. The abundance of soil N-cycle functional genes is an important character of soil N-cycle micro-organisms. Therefore, mining the change of the abundance of soil N-cycle functional genes and the associated microbiological mechanisms is of great significance in clarifying the transformation of soil nitrogen.
The input of different organic fertilizers may shift the content of different forms of soil nitrogen, affecting the abundance of soil N-cycle functional genes and the composition of the microbial community [15]. In previous studies, the response of soil N-cycling functional genes to organic fertilizers was generally compared to that of inorganic fertilizers and that of a combined application with organic and inorganic fertilizers. Ouyang et al. [16] documented through a meta-analysis that the application of nitrogen fertilizers altered the abundance of soil N-cycle functional genes, significantly increasing the abundance of nitrification gene amoA and denitrification genes nirK, nirS and nosZ, and that the organic fertilizers exerted a more potent effect than inorganic fertilizers. Ma et al. [15] found that a combined application with organic and inorganic fertilizers decreased the abundance of nitrification genes amoA, amoB and Hao, but increased the abundance of denitrification genes nirK, norB and nosZ. In addition, manures were found to increase mainly the abundance of ammonia-oxidizing bacteria but not ammonia-oxidizing archaea in a separate study [17]. It is also evidenced that organic fertilizers increased soil microbial community diversity and enzyme activity due to an increase in soil nutrients and organic carbon [18]. Liang et al. [19] confirmed that the increased content of carbon and nitrogen in soils was an important reason why organic fertilizers increased the abundance of main N-cycle functional genes. The application of organic fertilizers enhanced the abundance of soil genes for the N-cycle and enriched the composition of the associated microbial communities [20,21]. However, variations in the effects of various types of organic fertilizers (manures) on functional genes of the N-cycle are still unclear.
In addition, it is found that humic acid with strong biological activity can improve soil properties, enhance soil fertility, promote crop growth and regulate soil enzyme activity and the microbial community structure, etc. [22,23,24,25,26]. The genes, as the genetic material, control microbial activities and enzyme synthesis in organisms [27]. The unknowns are how humic acid affects N-cycle functional genes in the soil and whether humic acid has different impacts on different genes. Furthermore, the effects of manure applications coupled with humic acid on the N-cycle functional genes in the soil have not been reported. Considering fulvic acid has a low molecular weight, good solubility and high functional group content [28], it was selected to investigate the effects of a combined application of different manures with humic acid on the abundance of N-cycle functional genes in soils and to depict the main environmental factors determining the abundance of N-cycling functional genes. This study has some implications for regulating each step of the nitrogen cycle at the gene level.

2. Materials and Methods

2.1. Experimental Site

The experiment was conducted in an ordinary arched plastic greenhouse (length 81 m, width 8 m and height 3 m) in Xinxiang City, Henan province, China (35°19′47″ N, 114°0′51″ E), with a typical warm temperate continental monsoon. The average annual temperature and the average annual precipitation in Xinxiang is 14 °C and 582 mm, respectively. The greenhouse was covered by a transparent plastic film and installed with film coilers on both long sides to adjust the temperature and humidity. In the previous 3 years, there were no agricultural activities conducted in the greenhouse, which was suitable for the study of organic agriculture. The soil is a fluvo-aquic soil according to Chinese classification, and a Fluvic Cambisol according to the World Reference Base, and the soil properties of 0–10 cm are shown in Table 1.

2.2. Experimental Design

Chinese cabbage (Brassica chinensis L.) was planted for three growing seasons using the varieties Hanxiu, Shandaoqingcui and Xiadi, respectively. Three types of manures including pig manure, chicken manure and sheep manure with two levels were set up in the first growing season, and no fertilizer control (CK) was set. The treatments with the detailed information of fertilization and the properties of the manures are shown in Table 2 and Table 3. Each treatment had three replicate plots scheduled in a completely randomized design. A total of 21 plots (3.2 m × 2.5 m) were conducted with a 0.5 m gap between adjacent plots. All plots were irrigated with shallow groundwater pumped from the experimental site at 1163 m3/ha on 8 November 2022, the basic properties of which are shown in Table 4. All the manures used in the experiment were applied evenly as basal fertilizers on 3 December 2022 before soil ploughing. The seeds were sown into the 10 furrows of each plot by hand on 4 December with a sowing density of 7.5 kg/ha. In order to meet the water requirements of emergence, 600 mL of water was sprinkled for each furrow before sowing. The experimental indicators detection and other practices such as irrigation and seedlings thinning were stopped due to the outbreak of the novel coronavirus; consequently, the first growing season lasted 94 days. The vegetable yield was measured after the harvest on 7 March 2023.
After the first season, the treatments for the experiments were appropriately adjusted to arrange a long-term experiment to investigate the effects of different manures in combination with fulvic acid on N-cycling functional genes in soil. In the following growing seasons, six treatments were set up—pig manure (P), pig manure + fulvic acid (PH), chicken manure (C), chicken manure + fulvic acid (CH), sheep manure (S), sheep manure + fulvic acid (SH). CK was still there. The corresponding relationships of treatments in the different growing seasons are shown in Table 2. The manures used were the same as the first season. Potassium fulvic acid of a mineral source (Wujin999, fulvic acid contents ≥ 50%, K2O ≥ 8%, pH 10.08) was purchased from Xinjiang Shuanglong Humic Acid Co. The fulvic acid (7.5 kg/ha) was dissolved in 2 L of water and the manures (150 kg N /ha) were applied evenly to the plots. After the fertilization and ploughing of plots on 31 March 2023, the seeds were sown on 1 April using the same procedure with the first season. Irrigation was arranged based on local farmers’ established practice on 9 April 2023 (2126 m3/ha), 22 April (1376 m3/ha) and 6 May (1376 m3/ha), respectively. Other agronomy practices were carried out according to the field managements of organic vegetables. The vegetables were harvested on 11 May 2023; eventually, the second season lasted a total of 41 d.
The design and management of the vegetables for the third growing season were in the same way as the second season. The plots were fertilized and ploughed on 10 June 2023, and the seeds were sown on 11 June. Irrigation was carried out on 17 June 2023 (1001 m3/ha), 27 June (1126 m3/ha) and 8 July (875 m3/ha), respectively. The vegetables were harvested on 18 July 2023.

2.3. Collection and Analysis of Soil Samples

2.3.1. Soil Samples Collection

After the harvest of the third growing season, the soil samples (0–10 cm) collected using an auger with a diameter of 5 cm from three randomly selected sites in each plot were composited together as a single sample. Each sample was divided into four parts: the first part was oven-dried to determine the soil’s water content (WC); the second part was stored at −80 °C for gene determination; the third was stored at 4 °C for analyzing the NH4+-N and NO3−-N content; the remaining was air-dried for the determination of pH, electrical conductivity (EC), organic matter (OM), available phosphorus (AP), available potassium (AK), total nitrogen (TN), etc.

2.3.2. Determination of Soil and Manure Properties

The properties of soil and manures were determined according to the procedure of “Analysis Method of Agricultural Chemistry in Soil” [29]. The soil’s water content was determined by drying method. pH and EC were determined using the soil/water ratio of 1:5 with a pH meter (ORION STAR A211) and an EC meter (DDB-303A), respectively. NH4+-N and NO3−-N were determined by indophenol blue colorimetry and ultraviolet spectrophotometry, respectively. OM was determined by a low-temperature exothermic potassium dichromate oxidation-colorimetric method. AP was determined by the sodium bicarbonate method. AK was determined by ammonium acetate extraction method; TN was determined by the Kjeldahl method.

2.3.3. Soil DNA Extraction

A FastDNA SPIN Kit for soil (MP Biomedicals, Santa Ana, CA, USA) was employed to extract total DNA in light of the manufacturer’s instructions. The concentration and the quality of DNA were tested by a spectrophotometer (NanoDrop ND-8000, Thermo Fisher Scientific, Waltham, MA, USA) and 1.5% agar gel electrophoresis.

2.3.4. Quantification of N-Cycle Functional Genes

The WaferGen SmartChip Real-Time PCR System was utilized to perform a high-throughput quantitative PCR (HT-qPCR) of N-cycle functional genes using the 16S rRNA gene as the reference gene in Hefei Yuanzai Biotechnology Co., Ltd, Hefei, China. Samples were loaded onto the SmartChip Multisample Nanodispenser using a 96 (assays) × 54 (samples) array. The HT-qPCR array consisted of 14 primer sets, including 1 primer set targeting nitrogen mineralization gene (gdhA), 3 primer sets targeting nitrification genes (amoA-1, amoA-2, and amoB), 8 primer sets targeting denitrification genes (narG, nirK-1, nirK-2, nirK-3, nirS-1, nirS-2, nirS-3 and nosZ), 1 primer set targeting the nitrogen fixation gene (nifH) and 1 targeting the 16S rRNA gene. Each 100 nL reaction mixture contained 50 nL of 2 × LightCycler 480 SYBR Green I Master Mix (Roche Inc., East Dublin, Ga, USA), 20 nL of a 2 ng/μL DNA template, 1 nL of 0.1 mg/mL bovine serum albumin, 500 nM each of the forward and reverse primers and 19 nL of nuclease-free PCR-grade water. For each primer set, amplification was conducted in triplicate and a non-template control was included. The thermal regimen included an initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 30 s and annealing at 60 °C for 30 s. Finally, the melting curve analysis was autogenerated by the program [30].
Results of the HT-qPCR were analyzed using the SmartChip qPCR software (version 2.7.0.1). Wells with multiple melting peaks or amplification efficiencies outside the range of 1.8–2.2 were not included in the analysis. A limit was set on the number of cycles necessary to observe a significant fluorescence signal (threshold cycle, Ct). Only samples exhibiting Ct less than 31 and having more than two replicates showing amplification were regarded as positive. The primer sequences of the targeted genes were shown in Table 5. Absolute gene abundance is the absolute gene copy number per gram of dry soil. The absolute gene copy number was calculated based on the absolute 16S rRNA gene copy number quantified by conventional qPCR. The absolute gene copy number was calculated as follows:
G R = 10 ( 31 − C t ) / ( 10 / 3 )
G A N − c y c l e   g e n e = G A 16 S   r R N A . G R N − c y c l e   g e n e G R 16 S   r R N A
where GR is relative gene copy number, Ct is the threshold cycle and GA is absolute gene copy number.

2.4. Data Processing and Statistical Analysis

Microsoft Excel 2019 was used for data processing; Origin 2022 was used for principal component analysis (PCA) [42], redundancy analysis (RDA) [43] and drawing. R software (version 4.1.0) was used for the one-factor analysis of variance (ANOVA), Duncan’s multiple range test, permutation multivariate analysis of variance (PERMANOVA) [20], Monte Carlo permutation test (999 permutations) [20] and stepwise regression analysis [43]. ANOVA was used to test the differences between treatments and Duncan’s multiple range test was used to conduct the comparisons of treatment-means; a probability of p < 0.05 was deemed to be significant. PCA and PERMANOVA based on weighted UniFrac phylogenetic distance was used to assess the differences in the abundance of N-cycling genes in soil of different treatments. RDA, the Monte Carlo permutation test (999 permutations) and stepwise regression analysis were performed to investigate the correlation between N-cycling genes and environmental factors. The gene abundance increase rate was calculated as follows:
G e n e   a b u n d a n c e   i n c r e a s e   r a t e = ( G e n e   a b s o l u t e   a b u n d a n c e F − G e n e   a b s o l u t e   a b u n d a n c e C K ) G e n e   a b s o l u t e   a b u n d a n c e C K × 100 %
where F and CK refer to fertilization treatment and no fertilization, respectively.

3. Results and Analysis

3.1. Effects of Different Treatments on Soil Basic Properties

After the harvest of the third growing season, the soil water content fluctuated around 15% (Table 6). The different fertilizations exerted a negligible effect on soil pH. The soil EC value was higher in CK than the original soil, indicating the irrigation led to the accumulation of salt in the soil. Fertilization also increased the soil EC, with the maximum value in the PH treatment. The content of soil OM, NH4+-N, NO3−-N, AP, AK and TN was augmented by fertilization relative to CK, with the highest increase in the SH, SH, S, P, CH and PH treatment, respectively.

3.2. Effects of Different Treatments on the Abundance of 16S rRNA Gene in Soil

Most treatments increased the abundance of the 16S rRNA gene in the soil as compared with CK (Figure 1a). Specially, the abundance of the 16S rRNA gene in pig manure and sheep manure treatments was lifted significantly by 67.05% and 106.97%, respectively, compared to CK, suggesting the more conducive effect of pig manure and sheep manure on the growth and reproduction of bacteria than chicken manure. Exceptionally, the CH treatment lowered the abundance of the 16S rRNA gene by 7.11% relative to CK. When fulvic acid was introduced, the 16S rRNA gene abundance in the manure-added soils fell, especially for the chicken-manure-added soil.

3.3. Effects of Different Treatments on the Abundance of gdhA Gene in Soil

Fertilization (except CH treatment) increased the abundance of the gdhA gene in soil (Figure 1b), with the significant improvement in C, SH and S treatments. Sheep manure treatments had a better performance than pig and chicken manure treatments. Similar with the 16S rRNA gene, the additional fulvic acid had a tendency to reduce the abundance of the gdhA gene in the manure-added soils, with the most obvious decline (45.15%) in chicken-manure-added soil.

3.4. Effects of Different Treatments on the Abundance of nifH Gene in Soil

The abundance of the nifH gene was boosted by a single manure application, especially chicken manure; simultaneously, it went down in the soil appended with manure ascribed to the introduction of fulvic acid (Figure 1c). The abundance of the nifH gene in the CH treatment was reduced by 65.00% at a significant level compared to the single chicken manure treatment. Though nifH abundance was not dramatically altered by the treatments mingling manure and fulvic acid, it descended slightly in the PH and CH treatments in comparison to CK.

3.5. Effects of Different Treatments on the Abundance of Nitrification Genes in Soil

The abundance of nitrification genes in the soil went up under the effect of fertilization (Figure 2). Compared with CK, the chicken manure treatment significantly increased amoA-1 gene abundance (Figure 2a), sheep manure increased the abundance of both the amoA-1 and amoA-2 genes (Figure 2a,b) and the pig manure treatment increased amoB gene abundance (Figure 2c). Again, the fulvic acid addition decreased the abundance of nitrification genes in the manure-added soils generally. Take amoA-2 gene as an example, its abundance responded to fulvic acid rather sensitively in the sheep-manure-added soils.

3.6. Effects of Different Treatments on the Abundance of Denitrification Genes in Soil

The distribution of denitrification genes showed a very similar response to fertilization as the nitrification genes studied here. With a few exceptions in the CH treatment, manure application, particularly sheep manure, increased the abundance of the denitrification genes in soil (Figure 3a,c,d). Gene nosZ (Figure 3b), encoding nitrous oxide reductase, was more abundant compared with other denitrification genes. For the three nirK genes, the abundance of nirK-3 was the highest in most cases in addition to the high abundance of nirK-1 in the single pig manure treatment, while the abundance of nirK-2 was considerably lower. The abundance of nirS, another gene involved in nitrite reductase, was higher than nirK, indicating nirS played a more essential role in nitrite reduction in our soil. Gene nirS-2 was the dominate nirS gene among the three nirS genes considering their abundance. Due to the fulvic acid input, the abundance of narG and nirS-1 in the soil amended with chicken manure dropped sharply, and the abundance of nirK-1 and nirK-3 was cut down remarkably in the soil supplemented with pig manure and sheep manure, respectively; manifesting the extra fulvic acid caused a decrease in the abundance of denitrification genes in the soil applied with manure basically.

3.7. Differences of N-Cycling Genes in Different Fertilization Treatments

The results of the principal component analysis (PCA) of soil N-cycle functional genes impacted by different fertilization treatments are presented in Figure 4. Fertilization significantly changed the overall distribution of N-cycle functional genes (PERMANOVA: F = 69.993, p < 0.001). The treatments could be broadly classified into four groups: CK and CH treatments formed the first group, which was considerably disparate with other treatments along the first PCA axis, accounting for the 64.2% of variance; PH, C and SH treatments formed the second group; S treatments formed the third group; and P treatments stood alone, distinguished with other treatments along the second PCA axis explaining 16.2% of variance. The increase rates of the abundance of N-cycle functional genes in different treatments compared to CK were calculated (Table 7). Fertilization mainly increased the abundance of amoA-2, amoB, narG, nirK-1, nirS-1 and nirS-2, and the increase of different genes varied greatly. The P and S treatments increased the gene abundance more potently than the PH, C and SH treatments, while the influence of the CH treatment was insignificant.

3.8. Effects of Environmental Factors on N-Cycle Functional Genes

A redundancy analysis (RDA) showed that the overall effect of all environmental factors on N-cycle functional genes was significant (p = 0.002) (Figure 5), and OM (p < 0.01), AP (p < 0.01), NO3−-N (p < 0.05) and EC (p < 0.05) influenced significantly the abundance changes of N-cycle functional genes by the Monte Carlo permutation test. This was also confirmed in the stepwise regression analyses (Table 8). The environmental factors (except AK and EC) were mainly positively correlated with the N-cycle functional genes. We also found the gdhA gene was more related with OM content than other genes. The denitrification genes nirS-2, nirS-3 and nosZ were closely associated with AP, NO3−-N content. Genes nirK-1, amoB, nirS-3 and nirS-2 formed a cluster, and the increase in their abundance were obviously linked with the decrease in the value of EC.

4. Discussion

4.1. Effects of Fertilization on N-Cycle Functional Genes

It is known that chemical fertilizers exert a substantial effect on the abundance of N-cycle functional genes in soil, but the effect may be beneficial or detrimental [16,20]. The effects of organic fertilizers on them are usually favorable [19], due to the fact that organic fertilizers are rich in nutrients released slowly which could improve soil fertility for a longer period of time [44], and consequently provide a more stable environment for the growth and reproduction of soil micro-organisms. In this study, different manures increased the abundance of main N-cycle functional genes in soil, consistent with the results of a previous study [45]. Among them, the addition of pig and sheep manure, especially sheep manure, was associated with a more powerful response of N-cycle functional genes than the addition of chicken manure. Additionally, the abundance of these genes showed the weakest response to the chicken manure application with fulvic acid. This is acceptable since the addition of sheep and pig manure improved the content of OM, AP, NO3−-N and other properties in the soil compared with the addition of chicken manure (Table 6). In other words, different fertilizer treatments created different soil environments [46], leading to the differences in their impacts on the genes. The increase in the abundance of the nitrification and denitrification genes indicated the increased potential of nitrification and denitrification processes in the soil. The complete denitrification reaction releases nitrogen into the atmosphere in the form of gas, resulting in the loss of nitrogen and the nitrification in the soil provided the reaction substrate for denitrification [47]. As a result, the increase in the abundance of nitrification and denitrification genes resulting from manure addition might risk soil nitrogen loss, and similar results were also found in an early study [42].
We also found that fulvic acid reduced the abundance of N-cycle functional genes in soil caused by manure usage. One possible reason is that fulvic acid addition lowered the soil pH (Table 6), affecting the abundance of N-cycle genes [48]. In addition, the supply of fulvic acid could accelerate the nutrient uptake of crops and thereby the crop biomass [49], and increase the competition for nutrients between crops and micro-organisms and between micro-organisms [50,51]. The reduction originating from fulvic acid input might reduce the soil nitrogen loss, which is conducible to the efficient use of nutrients.

4.2. Effects of Fertilization on N-Cycle

Manure addition provided a large amount of organic nitrogen to the soil environment, which can be used by crops and micro-organisms when converted to inorganic nitrogen. This conversion is controlled by mineralizing micro-organisms in soil [52]. In this study, the increase in gdhA gene abundance was relatively higher in sheep-manure-applied soils, indicating that micro-organisms containing the gdhA gene were more abundant in the soil added with sheep manure than those with pig and chicken manure. Nitrate, the product of nitrification reaction [53], is an important nitrogen nutrient for nitrate-loving crops, but highly mobile and prone to nitrogen losses such as runoff and leaching. The abundance of the nitrification gene amoA-1 in this study was higher than that of the amoA-2 gene, in line with the study of Xu [54]. Fertilization particularly increased the abundance of the nitrification genes amoA-2 and amoB, meaning that amoA-2 and amoB genes possessed a greater effect on soil nitrification than the amoA-1 gene in this study. This is understandable, because the amoA-2 and amoB genes dominate nitrification under alkaline conditions [55,56].
Denitrification genes are important indicators of soil denitrification [57]. In this study, manures addition significantly increased the abundance of the narG gene involved in the first step of denitrification (nitrate reduction). The nirK and nirS genes associated with the second step of denitrification (nitrite reduction) were also enriched by the addition of manures. However, the response of the targeted nirK or nirS genes with different primers was distinct: the abundance of the nirK-1 and nirK-3 genes were higher than that of nirK-2 genes, and the abundance of the nirS-1 and nirS-2 genes were higher than the nirS-3 gene. Whether genes with high abundance contribute more to soil denitrification remains to be further studied. Soil nitrogen fixation converts atmospheric N2 by nitrogen-fixing micro-organisms into ammonia that can be utilized by crops [10]. Here, the increase in the abundance of the nifH gene was comparable between the SH and S treatments. Whereas, for the pig and chicken manure treatments, the addition of fulvic acid had a significant inhibitory effect on nifH gene abundance. Overall, the effects of a combined application with manure and fulvic acid on the soil nitrogen cycle under a long-term positioning test need to be confirmed by further research.

4.3. Effects of Environmental Factors on N-Cycle Functional Genes

In this study, both the redundancy analysis and stepwise regression analysis confirmed that OM, AP, NO3−-N and EC were the main factors affecting N-cycle functional genes, in accord with the results of previous studies [8,58]. OM, the basis of soil fertility, can improve the soil environments [59] and provide nutrients and energy for soil micro-organisms. It is believed that AP content and the abundance of N-cycle functional genes were closely linked [58], in consistency with this study. This suggests the strong coupling between soil phosphorus and N-cycle micro-organisms, since nitrogen fertilization promotes the demand for phosphorus by soil micro-organisms [60], and the abundant phosphorus in manure is the guarantee for the increase of soil nitrogen transformation genes [61]. Lan [62] proposed that NO3−-N as a reaction substrate for soil denitrification is closely linked to denitrification genes. The relationship between EC and gene abundance is expected [63], because the higher the salt content, the stronger the salt stress soil micro-organisms are subjected to.
In addition, this study also concluded that WC, pH, NH4+-N, AK and TN exerted less effect on the abundance of functional genes for the soil nitrogen cycle. However, it is proven that soil pH could affect the abundance of soil N-cycle micro-organisms and functional genes significantly [11,64]. The weaker correlation in this study might be due to the small fluctuating range of pH (8.15–8.33) and the fact that manures had a longer duration of interaction with micro-organisms and a greater regulation of soil acidity and alkalinity compared to chemical fertilizers. Many studies had found that NH4+-N and TN were also important factors influencing N-cycle functional micro-organisms [19,64]. The present study observed a minor effect of them on the abundance of N-cycle functional genes, probably because manures were able to provide balanced and stable nutrients [65], all of which could satisfy the requirements of soil micro-organisms. In alkaline soil, the content of NH4+-N is always low (Table 6), which also leads to its weak correlation with N-cycle functional genes. TN in soil could not be easily altered in a short time; therefore, the association between TN and N-cycle functional genes was not constructed apparently here. What is more, soil temperature [6], soil type [66,67], crop diversity [68] and other factors also affect the abundance of N-cycle functional genes expressively. Due to the limited environmental factors determined and the short experimental period in this study, the effects of multiple environmental factors on soil N-cycle functional genes under the long-term positioning experiment need to be further explored.

5. Conclusions

In this study, fertilization increased the abundance of N-cycle functional genes in the soil, particularly nitrification and denitrification genes, such as amoA-2, amoB, narG, nirK-1, nirS-1 and nirS-2, and increased the risk of soil nitrogen loss. The response of sheep and pig manure to the N-cycle functional genes were more potent than chicken manure. Additional fulvic acid tended to reduce the abundance of main N-cycle functional genes in the manure-added soils, especially for nitrification and denitrification genes. OM, AP, NO3--N and EC were the main environmental factors affecting the abundance of N-cycle functional genes. Considering the changes in the abundance of main N-cycle functional genes, it was concluded that the fertilization with sheep manure (31.3 t/ha) and fulvic acid (7.5 kg/ha) was more effective in regulating the N-cycle functional genes in soil.

Author Contributions

Conceptualization, S.Z.; data curation, S.Z., J.S. (Jiuming Sun) and X.L.; formal analysis, S.Z. and C.L.; funding acquisition, Z.L.; investigation, S.Z., C.L. and J.S. (Jiuming Sun); methodology, S.Z., J.S. (Jiuming Sun) and Y.L.; resources, S.Z., J.S. (Jiuming Sun) and X.L.; software, S.Z., J.S. (Jiuming Sun) and X.L.; supervision, Y.L. and Z.L.; validation, S.Z. and J.S. (Jibin Song); visualization, S.Z.; writing—original draft, S.Z.; writing—review and editing, C.L., J.S. (Jibin Song), Y.L. and Z.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the National Key Research and Development Program of China (2021YFD1700900); the Talent Cultivation Program of Chinese Academy of Agricultural Sciences (NKYCQN-2021-028); the Agricultural Science and Technology Innovation Program (ASTIP) of Chinese Academy of Agricultural Sciences; the Central Public interest Scientific Institution Basal Research Fund (FIRI2022-04, FIRI2022-14, Y2022LM29).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The authors are grateful to Xiaoxian Zhang for language improvement.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ibrahim, M.M.; Tong, C.X.; Hu, K.; Zhou, B.Q.; Xing, S.H.; Mao, Y.L. Biochar-fertilizer interaction modifies N-sorption, enzyme activities and microbial functional abundance regulating nitrogen retention in rhizosphere soil. Sci. Total Environ. 2020, 739, 140065. [Google Scholar] [CrossRef] [PubMed]
  2. Qasim, W.; Xia, L.; Lin, S.; Wan, L.; Zhao, Y.; Butterbach-Bahl, K. Global greenhouse vegetable production systems are hotspots of soil N2O emissions and nitrogen leaching: A meta-analysis. Environ. Pollut. 2021, 272, 116372. [Google Scholar] [CrossRef] [PubMed]
  3. Elrys, A.S.; Wang, J.; Metwally, M.A.S.; Cheng, Y.; Zhang, J.B.; Cai, Z.C.; Chang, S.X.; Müller, C. Global gross nitrification rates are dominantly driven by soil carbon-to-nitrogen stoichiometry and total nitrogen. Glob. Chang. Biol. 2021, 27, 6512–6524. [Google Scholar] [CrossRef] [PubMed]
  4. Kuypers, M.M.M.; Marchant, H.K.; Kartal, B. The microbial nitrogen-cycling network. Nat. Rev. Microbiol. 2018, 16, 263–276. [Google Scholar] [CrossRef] [PubMed]
  5. Wu, Q.; Tang, Y.; Chen, R.; Xu, F.; Wu, Q.; He, Y.; Xiao, W.; Li, J.; Liu, Z.; Chen, Y. Metabolism characteristics of nitrogen functional microorganisms in bioretention system under multiple dry-wet alternation. J. Water Process Eng. 2023, 53, 103685. [Google Scholar] [CrossRef]
  6. Liang, Y.; Wu, C.; Wei, X.; Liu, Y.; Chen, X.; Qin, H.; Wu, J.; Su, Y.; Ge, T.; Hu, Y. Characterization of nirS- and nirK-containing communities and potential denitrification activity in paddy soil from eastern China. Agric. Ecosyst. Environ. 2021, 319, 107561. [Google Scholar] [CrossRef]
  7. Ouyang, Y.; Norton, J.M.; Stark, J.M.; Reeve, J.R.; Habteselassie, M.Y. Ammonia-oxidizing bacteria are more responsive than archaea to nitrogen source in an agricultural soil. Soil Biol. Biochem. 2016, 96, 4–15. [Google Scholar] [CrossRef]
  8. Lin, J.; Xu, Z.; Xue, Y.; Sun, R.; Yang, R.; Cao, X.; Li, H.; Shao, Q.; Lou, Y.; Wang, H.; et al. N2O emissions from soils under short-term straw return in a wheat-corn rotation system are associated with changes in the abundance of functional microbes. Agric. Ecosyst. Environ. 2023, 341, 108217. [Google Scholar] [CrossRef]
  9. Wang, C.; Zheng, M.; Song, W.; Wen, S.; Wang, B.; Zhu, C.; Shen, R. Impact of 25 years of inorganic fertilization on diazotrophic abundance and community structure in an acidic soil in southern China. Soil Biol. Biochem. 2017, 113, 240–249. [Google Scholar] [CrossRef]
  10. Levy-Booth, D.J.; Prescott, C.E.; Grayston, S.J. Microbial functional genes involved in nitrogen fixation, nitrification and denitrification in forest ecosystems. Soil Biol. Biochem. 2014, 75, 11–25. [Google Scholar] [CrossRef]
  11. Lin, Y.; Ye, G.; Liu, D.; Ledgard, S.; Luo, J.; Fan, J.; Yuan, J.; Chen, Z.; Ding, W. Long-term application of lime or pig manure rather than plant residues suppressed diazotroph abundance and diversity and altered community structure in an acidic Ultisol. Soil Biol. Biochem. 2018, 123, 218–228. [Google Scholar] [CrossRef]
  12. Li, Z.; Tian, D.; Wang, B.; Wang, J.; Wang, S.; Chen, H.Y.H.; Xu, X.; Wang, C.; He, N.; Niu, S. Microbes drive global soil nitrogen mineralization and availability. Glob. Chang. Biol. 2019, 25, 1078–1088. [Google Scholar] [CrossRef]
  13. Song, L.; Niu, S. Increased soil microbial AOB amoA and narG abundances sustain long-term positive responses of nitrification and denitrification to N deposition. Soil Biol. Biochem. 2022, 166, 108539. [Google Scholar] [CrossRef]
  14. Fan, Z.; Li, R.; Guan, E.; Chen, H.; Zhao, X.; Wei, G.; Shu, D. Fertilization regimes affect crop yields through changes of diazotrophic community and gene abundance in soil aggregation. Sci. Total Environ. 2023, 866, 161359. [Google Scholar] [CrossRef] [PubMed]
  15. Ma, L.; Gao, W.; Luan, H.; Tang, J.; Li, M.; Huang, S. Effects of partial substitution of chemical fertilizer with manure and/or straw on the abundance of functional genes related to soil N-cycling. J. Plant Nutr. Fertitizer 2021, 27, 1767–1778. [Google Scholar]
  16. Ouyang, Y.; Evans, S.E.; Friesen, M.L.; Tiemann, L.K. Effect of nitrogen fertilization on the abundance of nitrogen cycling genes in agricultural soils: A meta-analysis of field studies. Soil Biol. Biochem. 2018, 127, 71–78. [Google Scholar] [CrossRef]
  17. Wang, Y.; Zhu, G.; Song, L.; Wang, S.; Yin, C. Manure fertilization alters the population of ammonia-oxidizing bacteria rather than ammonia-oxidizing archaea in a paddy soil. J. Basic Microbiol. 2014, 54, 190–197. [Google Scholar] [CrossRef] [PubMed]
  18. Ouyang, Y.; Norton, J.M. Short-Term Nitrogen Fertilization Affects Microbial Community Composition and Nitrogen Mineralization Functions in an Agricultural Soil. Appl. Environ. Microbiol. 2020, 86, e02278-19. [Google Scholar] [CrossRef] [PubMed]
  19. Liang, Y.; Yang, C.; Sainju, U.M.M.; Zhang, N.; Zhao, F.; Wang, W.; Wang, J. Differential Responses of Soil Microbial N-Cycling Functional Genes to 35 yr Applications of Chemical Fertilizer and Organic Manure in Wheat Field Soil on Loess Plateau. Agronomy 2023, 13, 1516. [Google Scholar] [CrossRef]
  20. Li, W.X.; Wang, C.; Zheng, M.M.; Cai, Z.J.; Wang, B.R.; Shen, R.F. Fertilization strategies affect soil properties and abundance of N-cycling functional genes in an acidic agricultural soil. Appl. Soil Ecol. 2020, 156, 103704. [Google Scholar] [CrossRef]
  21. Li, X.; Han, S.; Wan, W.; Zheng, L.; Chen, W.; Huang, Q. Manure fertilizes alter the nitrite oxidizer and comammox community composition and increase nitrification rates. Soil Tillage Res. 2020, 204, 104701. [Google Scholar] [CrossRef]
  22. Gao, Y.; He, J.; He, Z.; Li, Z.; Zhao, B.; Mu, Y.; Lee, J.-Y.; Chu, Z. Effects of fulvic acid on growth performance and intestinal health of juvenile loath Paramisgurnus dabryanus (Sauvage). Fish Shellfish Immunol. 2017, 62, 47–56. [Google Scholar] [CrossRef] [PubMed]
  23. Liu, Y.; Ding, F.; Zhang, J.; Qi, X.; Gu, D.; Wu, Q.; Li, C. Effect of activated humic acid-urea on nitrogen use efficiency and its driving factors under wheat-maize rotation system. Zhongguo Shengtai Nongye Xuebao/Chin. J. Eco-Agric. 2016, 24, 1310–1319. [Google Scholar]
  24. Liu, X.; Zhang, M.; Li, Z.; Zhang, C.; Wan, C.; Zhang, Y.; Lee, D.-J. Inhibition of urease activity by humic acid extracted from sludge fermentation liquid. Bioresour. Technol. 2019, 290, 121767. [Google Scholar] [CrossRef] [PubMed]
  25. Xi, Q.; Yang, T.; Zhou, F.; Wang, D.; Ye, H.; Xu, S.; Yang, B. Effect of the liquid fertilizer containing fulvic acid on metabolism of cembratrien-diols in flue-cured tobacco. J. Plant Nutr. Fertitizer 2018, 24, 981–991. [Google Scholar]
  26. Priya, B.N.V.; Mahavishnan, K.; Gurumurthy, D.S.; Bindumadhava, H.; Upadhyay, A.P.; Sharma, N.K. Fulvic Acid (FA) for Enhanced Nutrient Uptake and Growth: Insights from Biochemical and Genomic Studies. J. Crop Improv. 2014, 28, 740–757. [Google Scholar] [CrossRef]
  27. Balazs, M.; Ronavari, A.; Nemeth, A.; Bihari, Z.; Rutkai, E.; Bartos, P.; Kiss, I.; Szvetnik, A. Effect of DNA polymerases on PCR-DGGE patterns. Int. Biodeterior. Biodegrad. 2013, 84, 244–249. [Google Scholar] [CrossRef]
  28. Qin, Y.; Zhang, M.; Dai, W.; Xiang, C.; Li, B.; Jia, Q. Antidiarrhoeal mechanism study of fulvic acids based on molecular weight fractionation. Fitoterapia 2019, 137, 104270. [Google Scholar] [CrossRef]
  29. Rukun, L. Analysis Method of Agricultural Chemistry in Soil; Agriculture and Science Press: Beijing, China, 1999. [Google Scholar]
  30. Ouyang, W.-Y.; Huang, F.-Y.; Zhao, Y.; Li, H.; Su, J.-Q. Increased levels of antibiotic resistance in urban stream of Jiulongjiang River, China. Appl. Microbiol. Biotechnol. 2015, 99, 5697–5707. [Google Scholar] [CrossRef]
  31. Zheng, B.; Zhu, Y.; Sardans, J.; Penuelas, J.; Su, J. QMEC: A tool for high-throughput quantitative assessment of microbial functional potential in C, N, P, and S biogeochemical cycling. Sci. China-Life Sci. 2018, 61, 1451–1462. [Google Scholar] [CrossRef]
  32. Francis, C.A.; Roberts, K.J.; Beman, J.M.; Santoro, A.E.; Oakley, B.B. Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean. Proc. Natl. Acad. Sci. USA 2005, 102, 14683–14688. [Google Scholar] [CrossRef] [PubMed]
  33. Rotthauwe, J.H.; Witzel, K.P.; Liesack, W. The ammonia monooxygenase structural gene amoA as a functional marker: Molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl. Environ. Microbiol. 1997, 63, 4704–4712. [Google Scholar] [CrossRef] [PubMed]
  34. Calvó, L.; Garcia-Gil, L.J. Use of amoB as a new molecular marker for ammonia-oxidizing bacteria (vol 57, pg 69, 2004). J. Microbiol. Methods 2005, 61, 291. [Google Scholar] [CrossRef]
  35. Koper, T.E.; El-Sheikh, A.F.; Norton, J.M.; Klotz, M.G. Urease-encoding genes in ammonia-oxidizing bacteria. Appl. Environ. Microbiol. 2004, 70, 2342–2348. [Google Scholar] [CrossRef] [PubMed]
  36. Braker, G.; Fesefeldt, A.; Witzel, K.P. Development of PCR primer systems for amplification of nitrite reductase genes (nirK and nirS) to detect denitrifying bacteria in environmental samples. Appl. Environ. Microbiol. 1998, 64, 3769–3775. [Google Scholar] [CrossRef] [PubMed]
  37. Wei, W.; Isobe, K.; Nishizawa, T.; Zhu, L.; Shiratori, Y.; Ohte, N.; Koba, K.; Otsuka, S.; Senoo, K. Higher diversity and abundance of denitrifying microorganisms in environments than considered previously. Isme J. 2015, 9, 1954–1965. [Google Scholar] [CrossRef] [PubMed]
  38. Jung, J.; Yeom, J.; Kim, J.; Han, J.; Lim, H.S.; Park, H.; Hyun, S.; Park, W. Change in gene abundance in the nitrogen biogeochemical cycle with temperature and nitrogen addition in Antarctic soils. Res. Microbiol. 2011, 162, 1018–1026. [Google Scholar] [CrossRef] [PubMed]
  39. Throbäck, I.N.; Enwall, K.; Jarvis, Å.; Hallin, S. Reassessing PCR primers targeting nirS, nirK and nosZ genes for community surveys of denitrifying bacteria with DGGE. Fems Microbiol. Ecol. 2004, 49, 401–417. [Google Scholar] [CrossRef]
  40. Rösch, C.; Bothe, H. Improved assessment of denitrifying, N2-fixing, and total-community bacteria by terminal restriction fragment length polymorphism analysis using multiple restriction enzymes. Appl. Environ. Microbiol. 2005, 71, 2026–2035. [Google Scholar] [CrossRef]
  41. Zhang, X.; Chen, Z.; Ma, Y.; Zhang, N.; Pang, Q.; Xie, X.; Li, Y.; Jia, J. Response of Anammox biofilm to antibiotics in trace concentration: Microbial activity, diversity and antibiotic resistance genes. J. Hazard. Mater. 2019, 367, 182–187. [Google Scholar] [CrossRef]
  42. Sun, R.; Guo, X.; Wang, D.; Chu, H. Effects of long-term application of chemical and organic fertilizers on the abundance of microbial communities involved in the nitrogen cycle. Appl. Soil Ecol. 2015, 95, 171–178. [Google Scholar] [CrossRef]
  43. Guo, J.; Zhu, C.; Liu, W.; Wang, J.; Ling, N.; Guo, S. Effects of different fertilization managements on functional microorganisms involved in nitrogen cycle. J. Plant Nutr. Fertitizer 2021, 27, 751–759. [Google Scholar]
  44. Chew, K.W.; Chia, S.R.; Yen, H.-W.; Nomanbhay, S.; Ho, Y.-C.; Show, P.L. Transformation of Biomass Waste into Sustainable Organic Fertilizers. Sustainability 2019, 11, 2266. [Google Scholar] [CrossRef]
  45. Ai, C.; Liang, G.; Sun, J.; Wang, X.; He, P.; Zhou, W. Different roles of rhizosphere effect and long-term fertilization in the activity and community structure of ammonia oxidizers in a calcareous fluvo-aquic soil. Soil Biol. Biochem. 2013, 57, 30–42. [Google Scholar] [CrossRef]
  46. Wan, L.-J.; Tian, Y.; He, M.; Zheng, Y.-Q.; Lyu, Q.; Xie, R.-J.; Ma, Y.-Y.; Deng, L.; Yi, S.-L. Effects of Chemical Fertilizer Combined with Organic Fertilizer Application on Soil Properties, Citrus Growth Physiology, and Yield. Agriculture 2021, 11, 1207. [Google Scholar] [CrossRef]
  47. Pan, B.; Xia, L.; Wang, E.; Zhang, Y.; Mosier, A.; Chen, D.; Lam, S.K. A global synthesis of soil denitrification: Driving factors and mitigation strategies. Agric. Ecosyst. Environ. 2022, 327, 107850. [Google Scholar] [CrossRef]
  48. Xiao, Z.; Rasmann, S.; Yue, L.; Lian, F.; Zou, H.; Wang, Z. The effect of biochar amendment on N-cycling genes in soils: A meta-analysis. Sci. Total Environ. 2019, 696, 133984. [Google Scholar] [CrossRef]
  49. Zhang, P.; Zhang, H.; Wu, G.; Chen, X.; Gruda, N.; Li, X.; Dong, J.; Duan, Z. Dose-Dependent Application of Straw-Derived Fulvic Acid on Yield and Quality of Tomato Plants Grown in a Greenhouse. Front. Plant Sci. 2021, 12, 736613. [Google Scholar] [CrossRef]
  50. Kuzyakov, Y.; Xu, X. Competition between roots and microorganisms for nitrogen: Mechanisms and ecological relevance. New Phytol. 2013, 198, 656–669. [Google Scholar] [CrossRef]
  51. Coonan, E.C.; Kirkby, C.A.; Kirkegaard, J.A.; Amidy, M.R.; Strong, C.L.; Richardson, A.E. Microorganisms and nutrient stoichiometry as mediators of soil organic matter dynamics. Nutr. Cycl. Agroecosystems 2020, 117, 273–298. [Google Scholar] [CrossRef]
  52. Mahal, N.K.; Osterholz, W.R.; Miguez, F.E.; Poffenbarger, H.J.; Sawyer, J.E.; Olk, D.C.; Archontoulis, S.V.; Castellano, M.J. Nitrogen Fertilizer Suppresses Mineralization of Soil Organic Matter in Maize Agroecosystems. Front. Ecol. Evol. 2019, 7. [Google Scholar] [CrossRef]
  53. Hu, H.-W.; Xu, Z.-H.; He, J.-Z. Ammonia-Oxidizing Archaea Play a Predominant Role in Acid Soil Nitrification. Adv. Agron. 2014, 125, 261–302. [Google Scholar]
  54. Xu, P.; Jiang, M.; Khan, I.; Zhao, J.; Yang, T.; Tu, J.; Hu, R. Available nitrogen and ammonia-oxidizing archaea in soil regulated N2O emissions regardless of rice planting under a double rice cropping-fallow system. Agric. Ecosyst. Environ. 2022, 340, 108166. [Google Scholar] [CrossRef]
  55. Luo, Y.; Yu, Z.; Zhang, K.; Xu, J.; Brookes, P.C. The properties and functions of biochars in forest ecosystems. J. Soils Sediments 2016, 16, 2005–2020. [Google Scholar] [CrossRef]
  56. Li, D.; Ren, Z.; Zhou, Y.; Jiang, L.; Zheng, M.; Liu, G. Comammox Nitrospira and Ammonia-Oxidizing Archaea Are Dominant Ammonia Oxidizers in Sediments of an Acid Mine Lake Containing High Ammonium Concentrations. Appl. Environ. Microbiol. 2023, 89, e0004723. [Google Scholar] [CrossRef] [PubMed]
  57. Cui, Y.; Zhang, Y.; Duan, C.; Wang, X.; Zhang, X.; Ju, W.; Chen, H.; Yue, S.; Wang, Y.; Li, S.; et al. Ecoenzymatic stoichiometry reveals microbial phosphorus limitation decreases the nitrogen cycling potential of soils in semi-arid agricultural ecosystems. Soil Tillage Res. 2020, 197, 104463. [Google Scholar] [CrossRef]
  58. Nie, L.; Wan, W. Nutrient-cycling functional gene diversity mirrors phosphorus transformation during chicken manure composting. Bioresour. Technol. 2023, 386, 129504. [Google Scholar] [CrossRef]
  59. Williams, A.; Hedlund, K. Indicators and trade-offs of ecosystem services in agricultural soils along a landscape heterogeneity gradient. Appl. Soil Ecol. 2014, 77, 1–8. [Google Scholar] [CrossRef]
  60. Wang, Q.; Wang, J.; Li, Y.; Chen, D.; Ao, J.; Zhou, W.; Shen, D.; Li, Q.; Huang, Z.; Jiang, Y. Influence of nitrogen and phosphorus additions on N2-fixation activity, abundance, and composition of diazotrophic communities in a Chinese fir plantation. Sci. Total Environ. 2018, 619, 1530–1537. [Google Scholar] [CrossRef]
  61. Cheng, Y.; Wan, W. Strong linkage between nutrient-cycling functional gene diversity and ecosystem multifunctionality during winter composting with pig manure and fallen leaves. Sci. Total Environ. 2023, 867, 161529. [Google Scholar] [CrossRef]
  62. Lan, M. Research on remediation the NO3−-N polluted groundwater by the synergistic effect of autotrophic and heterotrophic denitrification. Abstr. Pap. Am. Chem. Soc. 2018, 255, 1155. [Google Scholar]
  63. Wang, J.; Yang, T.; Zhu, K.; Shao, C.; Zhu, W.; Hou, G.; Sun, Z. A novel retrieval model for soil salinity from CYGNSS: Algorithm and test in the Yellow River Delta. Geoderma 2023, 432, 116417. [Google Scholar] [CrossRef]
  64. Geisseler, D.; Scow, K.M. Long-term effects of mineral fertilizers on soil microorganisms—A review. Soil Biol. Biochem. 2014, 75, 54–63. [Google Scholar] [CrossRef]
  65. Li, X.; Qiao, L.; Huang, Y.; Li, D.; Xu, M.; Ge, T.; Meersmans, J.; Zhang, W. Manuring improves soil health by sustaining multifunction at relatively high levels in subtropical area. Agric. Ecosyst. Environ. 2023, 353, 108539. [Google Scholar] [CrossRef]
  66. Blaud, A.; van der Zaan, B.; Menon, M.; Lair, G.J.; Zhang, D.; Huber, P.; Schiefer, J.; Blum, W.E.H.; Kitzler, B.; Huang, W.E.; et al. The abundance of nitrogen cycle genes and potential greenhouse gas fluxes depends on land use type and little on soil aggregate size. Appl. Soil Ecol. 2018, 125, 1–11. [Google Scholar] [CrossRef]
  67. Liu, J.; Guo, Y.; Gu, H.; Liu, Z.; Hu, X.; Yu, Z.; Li, Y.; Li, L.; Sui, Y.; Jin, J.; et al. Conversion of steppe to cropland increases spatial heterogeneity of soil functional genes. Isme J. 2023, 17, 1–12. [Google Scholar] [CrossRef]
  68. Hao, J.; Feng, Y.; Wang, X.; Yu, Q.; Zhang, F.; Yang, G.; Ren, G.; Han, X.; Wang, X.; Ren, C. Soil microbial nitrogen-cycling gene abundances in response to crop diversification: A meta-analysis. Sci. Total Environ. 2022, 838, 156621. [Google Scholar] [CrossRef]
Agriculture 13 02224 g001
Figure 1. The abundance of the 16S rRNA (a), gdhA (b) and nifH (c) gene in soil after the third planting of Chinese cabbage. Note: CK, no fertilization; P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid. The data are expressed as the mean ± standard deviation. Lower-case letters above each column indicate significant differences between groups.
Figure 1. The abundance of the 16S rRNA (a), gdhA (b) and nifH (c) gene in soil after the third planting of Chinese cabbage. Note: CK, no fertilization; P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid. The data are expressed as the mean ± standard deviation. Lower-case letters above each column indicate significant differences between groups.
Agriculture 13 02224 g001
Agriculture 13 02224 g002
Figure 2. The abundance of nitrification genes amoA-1 (a), amoA-2 (b), and amoB (c) in soil after the third planting of Chinese cabbage. Note: CK, no fertilization; P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid. The data are expressed as the mean ± standard deviation. Lower-case letters above each column indicate significant differences between groups.
Figure 2. The abundance of nitrification genes amoA-1 (a), amoA-2 (b), and amoB (c) in soil after the third planting of Chinese cabbage. Note: CK, no fertilization; P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid. The data are expressed as the mean ± standard deviation. Lower-case letters above each column indicate significant differences between groups.
Agriculture 13 02224 g002
Agriculture 13 02224 g003
Figure 3. The abundance of denitrification genes narG (a), nosZ (b), nirS (c) and nirK (d) in soil after the third planting of Chinese cabbage. Note: CK, no fertilization; P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid. The data are expressed as the mean ± standard deviation. Lower-case letters above each column indicate significant differences between groups.
Figure 3. The abundance of denitrification genes narG (a), nosZ (b), nirS (c) and nirK (d) in soil after the third planting of Chinese cabbage. Note: CK, no fertilization; P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid. The data are expressed as the mean ± standard deviation. Lower-case letters above each column indicate significant differences between groups.
Agriculture 13 02224 g003
Agriculture 13 02224 g004
Figure 4. Principal component analysis of N-cycle functional genes. Note: CK, no fertilization; P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid.
Figure 4. Principal component analysis of N-cycle functional genes. Note: CK, no fertilization; P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid.
Agriculture 13 02224 g004
Agriculture 13 02224 g005
Figure 5. Redundancy analysis of the abundance of N-cycle functional genes and environmental factors. Note: WC, water content; EC, electrical conductivity; OM, organic matter; AP, available phosphorus; AK, available potassium; TN, total nitrogen.
Figure 5. Redundancy analysis of the abundance of N-cycle functional genes and environmental factors. Note: WC, water content; EC, electrical conductivity; OM, organic matter; AP, available phosphorus; AK, available potassium; TN, total nitrogen.
Agriculture 13 02224 g005
Table 1. The original soil properties (0–10 cm).
Table 1. The original soil properties (0–10 cm).
ParameterBD
(g/cm3)		FC
(%)		OM
(g/kg)		pH
/		EC
(dS/m)		NH4+-N
(mg/kg)		NO3−-N
(mg/kg)		AP
(mg/kg)		AK
(mg/kg)		TN
(g/kg)
0–10 cm1.3427.9825.248.350.290.98128.1234.33366.000.85
Note: BD, bulk density; FC, field capacity; OM, organic matter; EC, electrical conductivity; AP, available phosphorus; AK, available potassium; TN, total nitrogen.
Table 2. Treatments with the detailed fertilization information.
Table 2. Treatments with the detailed fertilization information.
The First Growing SeasonThe Second Growing SeasonThe Third Growing Season
Total TreatmentsManure Types—Fertilization (t/ha)TN Inputs (kg/ha)Manure Types—Fertilization (t/ha)Fulvic Acid (kg/ha)TN Inputs (kg/ha)Manure Types—Fertilization (t/ha)Fulvic Acid (kg/ha)TN Inputs (kg/ha)
CK--------
PHPig manure—1570.5Pig manure—31.97.5150Pig manure—31.97.5150
PPig manure—942.3Pig manure—31.9-150Pig manure—31.9-150
CHChicken manure—529.5Chicken manure—25.47.5150Chicken manure—25.47.5150
CChicken manure—317.7Chicken manure—25.4-150Chicken manure—25.4-150
SHSheep manure—1152.8Sheep manure—31.37.5150Sheep manure—31.37.5150
SSheep manure—628.8Sheep manure—31.3-150Sheep manure—31.3-150
Note: CK, no fertilization; P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid.
Table 3. Manure properties.
Table 3. Manure properties.
Manure TypepH
/		EC
(dS/m)		OM
(g/kg)		TN
(g/kg)		TP
(g/kg)		TK
(g/kg)
Pig manure8.685.6632.74.74.09.6
Chicken manure8.427.2235.95.95.411.3
Sheep manure8.886.7729.94.84.18.5
Note: EC, electrical conductivity; OM, organic matter; TN, total nitrogen; TP, total phosphorus; TK, total potassium.
Table 4. Water properties.
Table 4. Water properties.
Water SourcepH
/		Electrical Conductivity (dS/m)NO3−-N
(mg/L)		NH4+-N
(mg/L)
Groundwater7.252.810.221.94
Table 5. The primer sequences of the genes.
Table 5. The primer sequences of the genes.
Target GenesSequence (5′-3′)References
gdhAGCCATCGGYCCWTACAAGGG[31]
ATGTCRCCNGCCGGAACGTC
amoA-1STAATGGTCTGGCTTAGACG[32]
GCGGCCATCCATCTGTATGT
amoA-2GGGGTTTCTACTGGTGGT[33]
CCCCTCKGSAAAGCCTTCTT
amoBTGGTAYGACATKAWATGG[34]
RCGSGGCARGAACATSGG
narGTAYGTSGGGCAGGARAAACTG[35]
CGTAGAAGAAGCTGGTGCTGT
nirK-1GGMATGGTKCCSTGGCA[36]
GCCTCGATCAGRTTRTGGTT
nirK-2ATGGCGCCATCATGGTNYTNCC[37]
TCGAAGGCCTCGATNARRTTRTG
nirK-3TGCACATCGCCAACGGNATGTWYGG[37]
GGCGCGGAAGATGSHRTGRTCNAC
nirS-1GTSAACGTSAAGGARACSGG[38]
GASTTCGGRTGSGTCTTGA
nirS-2ATCGTCAACGTCAARGARACVGG[37]
TTCGGGTGCGTCTTSABGAASAG
nirS-3TGGAGAACGCCGGNCARGTNTGG[37]
GATGATGTCCACGGCNACRTANGG
nosZCGYTGTTCMTCGACAGCCAG[39]
CGSACCTTSTTGCCSTYGCG
nifHAAAGGYGGWATCGGYAARTCCACCAC[40]
TGSGCYTTGTCYTCRCGGATBGGCAT
16S rRNAGGGTTGCGCTCGTTGC[41]
ATGGYTGTCGTCAGCTCGTG
Table 6. Soil properties after the third growing season.
Table 6. Soil properties after the third growing season.
Treatment
/		WC
(%)		EC
(dS/m)		pH
/		OM
(g/kg)		NH4+-N
(mg/kg)		NO3−-N
(mg/kg)		AP
(mg/kg)		AK
(mg/kg)		TN
(g/kg)
OS20.68 ± 0.010.29 ± 0.028.35 ± 0.0525.24 ± 2.930.98 ± 0.25128.12 ± 21.4534.33 ± 8.01366.00 ± 63.380.85 ± 0.04
CK14.05 ± 0.56 b1.25 ± 0.08 ab8.21 ± 0.24 a22.18 ± 0.54 c18.10 ± 1.75 b71.72 ± 14.17 c36.90 ± 1.66 b671.06 ± 34.12 b1.11 ± 0.01 b
PH15.73 ± 0.91 ab1.57 ± 0.06 a8.15 ± 0.06 a26.09 ± 1.05 ab20.14 ± 1.98 b169.69 ± 8.90 ab69.04 ± 0.94 a733.65 ± 20.97 b1.52 ± 0.08 a
P15.23 ± 0.72ab1.07 ± 0.08 b8.29 ± 0.11 a25.75 ± 0.85 ab30.08 ± 2.35 ab199.53 ± 9.99 ab69.21 ± 1.00 a776.01 ± 33.89 b1.44 ± 0.10 a
CH13.97 ± 0.70 b1.52 ± 0.05 ab8.21 ± 0.11a25.17 ± 0.95 b37.25 ± 2.56 a182.57 ± 4.18 ab58.24 ± 2.13 a932.75 ± 42.80 a1.46 ± 0.06 a
C15.24 ± 0.54ab1.40 ± 0.05 ab8.30 ± 0.13 a25.53 ± 0.39 b33.20 ± 3.31 a118.56 ± 14.96 bc59.74 ± 0.86 a781.17 ± 39.07 b1.42 ± 0.03 a
SH16.66 ± 0.88 a1.07 ± 0.07 b8.31 ± 0.02 a28.22 ± 0.14 a37.45 ± 2.24 a134.73 ± 15.16 bc66.77 ± 1.73 a751.71 ± 25.28 b1.38 ± 0.07 a
S14.88 ± 0.87 ab1.27 ± 0.04 ab8.33 ± 0.11 a27.21 ± 1.07 ab26.25 ± 3.00 ab230.05 ± 7.40 a66.18 ± 1.73 a778.49 ± 30.85 b1.41 ± 0.05 a
Note: OS, original soil; CK, no fertilization; P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid; WC, water content; EC, electrical conductivity; OM, organic matter; AP, available phosphorus; AK, available potassium; TN, total nitrogen. The data are expressed as the mean ± standard deviation. Lower-case letters in each column indicate significant differences between groups.
Table 7. Increase rate in the abundance of N-cycle functional genes in different treatments compared to CK (%).
Table 7. Increase rate in the abundance of N-cycle functional genes in different treatments compared to CK (%).
PHPCHCSHSAverage Increase 2
16S rRNA54.3667.05−7.1142.8785.65106.9758.30
gdhA41.6948.73−2.1178.47152.58174.2682.27
amoA-113.112.0911.92103.9044.79131.2451.18
amoA-2143.40174.5067.14123.8947.35358.21152.42
amoB97.38777.90109.63234.31279.46376.06312.46
narG135.9090.10−7.32118.31131.87148.05102.82
nirK-1154.52601.59−30.0120.47135.71150.59172.15
nirK-2−1.60167.68−48.0186.29102.9062.3061.59
nirK-383.76143.622.730.2782.19229.5190.35
nirS-1126.20121.0631.39148.43109.83207.01123.99
nirS-299.22161.0332.9685.26129.31187.55115.89
nirS-364.77218.86−8.22148.4253.58120.8499.71
nosZ-28.3350.67−24.478.0073.18107.8937.27
nifH−3.5284.33−14.35144.6974.1783.8561.53
Average increase 172.68193.528.1695.97107.33174.60
Note: P, pig manure; C, chicken manure; S, sheep manure; H, fulvic acid. Average increase 1 is the average of the increase rate in the abundance of all genes in each treatment, and average increase 2 is the average of increase rate in the abundance of 16S rRNA or one N-cycle functional gene in all treatments.
Table 8. Soil properties correlated with N-cycle functional genes analyzed by stepwise regression analysis.
Table 8. Soil properties correlated with N-cycle functional genes analyzed by stepwise regression analysis.
GenesExplanatory VariablesR2
16s rRNANO3−-N, OM, AK0.77 ***
gdhApH, OM0.60 ***
amoA-1NA
amoA-2NO3−-N0.59 ***
amoBWC, EC, OM, AP0.77 ***
narGNH4+-N, NO3−-N, OM, AP0.72 ***
nirK-1WC, pH, EC, OM, AP, AK0.85 ***
nirK-2EC, AP0.59 ***
nirK-3NO3−-N, OM, AK, TN0.86 ***
nirS-1AP0.46 ***
nirS-2EC, NO3−-N, AP, AK0.84 ***
nirS-3AP0.26 *
nosZEC, OM, AP, AK0.69 ***
nifHNA
Note: WC, water content; EC, electrical conductivity; OM, organic matter; AP, available phosphorus; AK, available potassium; TN, total nitrogen; NA, no optimal fitting model; R2, the proportion of variance explained by model; ***, p < 0.001; *, p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, S.; Li, Z.; Liu, C.; Sun, J.; Song, J.; Li, X.; Liu, Y. Effects of Different Manures in Combination with Fulvic Acid on the Abundance of N-Cycling Functional Genes in Greenhouse Soils. Agriculture 2023, 13, 2224. https://doi.org/10.3390/agriculture13122224

AMA Style

Zhao S, Li Z, Liu C, Sun J, Song J, Li X, Liu Y. Effects of Different Manures in Combination with Fulvic Acid on the Abundance of N-Cycling Functional Genes in Greenhouse Soils. Agriculture. 2023; 13(12):2224. https://doi.org/10.3390/agriculture13122224

Chicago/Turabian Style

Zhao, Shouqiang, Zhongyang Li, Chuncheng Liu, Jiuming Sun, Jibin Song, Xiaotong Li, and Yuan Liu. 2023. "Effects of Different Manures in Combination with Fulvic Acid on the Abundance of N-Cycling Functional Genes in Greenhouse Soils" Agriculture 13, no. 12: 2224. https://doi.org/10.3390/agriculture13122224

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop