Next Article in Journal
Antioxidant and Anti-Inflammatory Capacities of Fractions and Constituents from Vicia tetrasperma
Next Article in Special Issue
NPR1 Translocation from Chloroplast to Nucleus Activates Plant Tolerance to Salt Stress
Previous Article in Journal
GlyNAC (Glycine and N-Acetylcysteine) Supplementation in Old Mice Improves Brain Glutathione Deficiency, Oxidative Stress, Glucose Uptake, Mitochondrial Dysfunction, Genomic Damage, Inflammation and Neurotrophic Factors to Reverse Age-Associated Cognitive Decline: Implications for Improving Brain Health in Aging
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 12
Issue 5
10.3390/antiox12051043
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Strigolactone Alleviates the Adverse Effects of Salt Stress on Seed Germination in Cucumber by Enhancing Antioxidant Capacity

by
Changxia Li
*,
Xuefang Lu
,
Yunzhi Liu
,
Junrong Xu
and
Wenjin Yu
*
College of Agriculture, Guangxi University, Nanning 530004, China
*
Authors to whom correspondence should be addressed.
Antioxidants 2023, 12(5), 1043; https://doi.org/10.3390/antiox12051043
Submission received: 22 March 2023 / Revised: 21 April 2023 / Accepted: 3 May 2023 / Published: 4 May 2023
(This article belongs to the Special Issue The Roles of Environmental Factors in Regulation of Oxidative Stress in Plants)
Browse Figures
Versions Notes

Abstract

:
Strigolactones (SLs), as a new phytohormone, regulate various physiological and biochemical processes, and a number of stress responses, in plants. In this study, cucumber ‘Xinchun NO. 4’ is used to study the roles of SLs in seed germination under salt stress. The results show that the seed germination significantly decreases with the increase in the NaCl concentrations (0, 1, 10, 50, and 100 mM), and 50 mM NaCl as a moderate stress is used for further analysis. The different concentrations of SLs synthetic analogs GR24 (1, 5, 10, and 20 μM) significantly promote cucumber seed germination under NaCl stress, with a maximal biological response at 10 μM. An inhibitor of strigolactone (SL) synthesis TIS108 suppresses the positive roles of GR24 in cucumber seed germination under salt stress, suggesting that SL can alleviate the inhibition of seed germination caused by salt stress. To explore the regulatory mechanism of SL-alleviated salt stress, some contents, activities, and genes related to the antioxidant system are measured. The malondialdehyde (MDA), H2O2, O2−, and proline contents are increased, and the levels of ascorbic acid (AsA) and glutathione (GSH) are decreased under salt stress conditions, while GR24 treatment reduces MDA, H2O2, O2−, and proline contents, and increases AsA and GSH contents during seed germination under salt stress. Meanwhile, GR24 treatment enhances the decrease in the activities of antioxidant enzymes caused by salt stress [superoxide dismutase (SOD), peroxidase (POD), catalase (CAT) and ascorbate peroxidase (APX)], following which antioxidant-related genes SOD, POD, CAT, APX, and GRX2 are up-regulated by GR24 under salt stress. However, TIS108 reversed the positive effects of GR24 on cucumber seed germination under salt stress. Together, the results of this study revealed that GR24 regulates the expression levels of genes related to antioxidants and, therefore, regulates enzymatic activity and non-enzymatic substances and enhances antioxidant capacity, alleviating salt toxicity during seed germination in cucumber.

1. Introduction

Salt stress is a serious ecological problem that negatively affects crop growth [1], development [2], and productivity worldwide [3]. Meanwhile, salt stress is usually accompanied by oxidative damage due to the excess production of reactive oxygen species (ROS), causing membrane lipids, and thereby inhibiting plant growth and development including seed germination [4], seedling growth [5], plant life, and so on [6]. Additionally, salt stress interferes with photosynthetic activity and respiration; impairs ion homeostasis and osmotic and hormonal balance; and reduces enzyme activity, protein and nucleic acid synthesis, and organic solute accumulation during plant growth and development [7]. Consequently, the enhancement of resistance to salinity in horticultural plants is currently an urgent requirement.
To survive such stress, plants have evolved different mechanisms. One of the main ways is to regulate the dynamic changes in plant gas signaling. It is reported that the signaling of gases, such as nitric oxide (NO) [8], hydrogen gas (H2) [9], hydrogen sulfide (H2S) [10], and carbon monoxide (CO) [11], play a vitally important role in responding to salt stress. In addition, plant hormones can effectively alleviate salt-stress damage, thereby promoting the adaptation to unfavorable growth conditions. For example, brassinolide (BL) is a natural product. The exogenous application of BL donor brassinosteroids (BRs) can not only promote plant growth and development but also reduce the damage caused by abiotic stresses such as salt [12] and drought [13]. Abscisic acid (ABA) is an important plant hormone with a critical role in the regulation of salt stress responses [14]. Exposure to salt stress induces the accumulation of ABA, resulting in increased tolerance [15]. This is also reported in auxin, cytokinins (CK), jasmonate (JA), gibberellin (GA), and ethylene (ET) for the alleviation of salt stress in plants [16]. Strigolactones (SLs), a class of carotenoid-derived phytohormones, have recently been identified as a new class of phytohormones. Mostofa et al. [13] have reported that SLs regulate plant adaptation to abiotic stresses, particularly nutrient deficiency, drought, and salinity. Meanwhile, SLs regulate various physiological and molecular processes during the adaptation of plants to abiotic stresses, such as root development, shoot branching, reproductive development, and leaf senescence [13].
Seed germination is an important biological process and a considerable stage in agricultural production, which is crucial for plant life cycles and crop production. Seed quality and seed germination evenness directly affect the final productivity. Thus, the regulation mechanism of the seed germination process is one of the important fields of biological research. This critical developmental step is regulated by diverse endogenous and exogenous factors [17]. Previous results reveal that seed germination is positively regulated by some novel singling molecules, such as H2S [18], H2O2 [19], Ga2+ [19], ABA [19], NO [20], and CO [21]. Additionally, an increasing number of studies have recently reported that plant hormones promote seed germination, such as ABA, auxin, ET, GA, CK, JA, and BRs [22]. Simultaneously, singling molecules [22] or plant hormones [23] alleviate the inhibition of seed germination caused by a series of abiotic stresses. SLs promote Arabidopsis seed germination under high temperature stress [24]. Tomato seedlings are resistant to the adverse effects of high salt stress when SLs, a synthetic strigolactone (GR24), are applied [25]. Limited data are available on the nature of strigolactone (SL) actions in seed germination under salt stress. In the present study, we investigate the impact of treatments with GR24 on cucumber seed germination under salt stress. In addition to the impact, we also evaluate the regulatory mechanisms of GR24 during cucumber seed germination under salt stress from the aspect of the antioxidant system.

2. Materials and Methods

2.1. Plant Material and Treatment

Seeds of cucumber (Cucumis sativus L. ‘Xinchun NO. 4’) are selected based on uniformity in size and health. Cucumber seeds are soaked in 0.1% sodium hypochlorite solution for 2 min and then placed in sterile Petri plates on filter paper moistened with distilled water (the control) and different treatments for 48 h: firstly, NaCl (1, 10, 50, and 100 mM); secondly, NaCl (50 mM) + GR24 (SLs synthetic analogs; 1, 5, 10, and 20 μM); thirdly, distilled water (the control), NaCl (50 mM), NaCl (50 mM) + GR24 (5 μM), and NaCl (50 mM) + TIS108 (an inhibitor of strigolactone synthesis; 1 μM). They are allowed to germinate in the dark in an illumination incubator at 29 ± 1 °C for 48 h. Each process is set to three replicates. After 48 h, the seeds are freshly preserved at −80 °C refrigerator and used for the following analysis.

2.2. Determination of Germination Rate, Radicle Long, and Lateral Root Number of Seeds

When the germ length exceeds half of the length of seeds, it is defined as germination according to the study of Huang et al. 2021 [26]. The germination rate is calculated, the radicle long is measured from the root tip to the germ and hypocotyl junction, and lateral root number is recorded. Seed vitality is determined by triphenyl tetrazolium chloride (TTC) solution [27]. The cut seeds are immersed under 0.5% (w/v) TTC solution in a Petri dish and incubated at 29 ± 1 °C for 2 h. Then, the TTC solution is removed, and the seeds are washed with distilled water three times and photographed. Thirty seeds are analyzed for each treatment with three replicates.

2.3. Determination of MDA, H2O2, O2−, and Proline Contents

The malondialdehyde (MDA) content is analyzed by using the method described by Ma et al. [28], with several modifications. Germinated seeds (0.5 g) are homogenized in 5 mL of 10% trichloroacetic acid (TCA) and then centrifuged at 10,000× g for 10 min at 4 °C. The 1 mL supernatant liquor taken is added to 1 mL of 0.6% 2-thiobarbituric acid (TBA). The mixture is boiled in a water bath at 100 °C for 20 min and then centrifuged for 15 min at 10,000× g. The absorbance of the supernatant is measured at 450, 532, and 600 nm after cooling to room temperature. MDA content (10−3 μmol·g−1) = 6.45 × (OD532 − OD600) − 0.56 × OD450.
The H2O2 content is determined as described by Prochazkova et al. [29], with slight modifications. Germinated seeds (0.5 g) are homogenized in cold 100% acetone (5 mL) and then centrifuged at 12,000× g for 20 min at 4 °C. The supernatant (1.0 mL) taken is added to a mixture consisting of 0.1 mL of 10% titanium tetrachloride and 0.2 mL of an ammonia–water mixture. The mixtures are centrifuged at 12,000× g for 15 min at 4 °C after a reaction for 5 min and the supernatant is discarded. H2SO4 (2 M, 3 mL) is added to dissolve the sediment; the absorbance is measured at 412 nm.
The H2O2 content is expressed as millimoles per gram of fresh weight (FW).
The method described by Hu et al. [30] is adopted to determine O2− content. Samples (0.5 g) are homogenized with 5 mL of extraction buffer that contained 1 mM ethylene-diaminetetraacetic acid (EDTA), 0.3% Triton X-100, and 2% polyvinylpyrrolidone (PVP). Subsequently, the mixtures are centrifuged at 12,000× g for 20 min at 4 °C. The mixture comprises 1 mL of 50 mM potassium phosphate buffer, 1 mL of 1 mM hydroxylamine hydrochloride, and 1 mL of crude extract in a reaction tube and incubates at 25 °C for 1 h. After, the mixture is continually incubated at 25 °C for 20 min when 1 mL of 17 mM sulfanilic acid and 1 mL of 7 mM α -naphthylamine are added to the reaction tube. Lastly, the absorbance is measured at 530 nm and the micromoles per minute per gram of FW are used to express the O2− content.
Proline content is measured by the Storey and Jones method with some modifications [31]. The 5 mL 3% sulfosalicylic acid is added to 0.5 g germinated seeds, which are used to obtain the proline extract by boiling water bath for 15 min. The glacial acetic acid and acid ninhydrin (2 mL) is added to the proline extract, which is heated in a boiling water bath for 30 min. Then, the extraction solution is cooled quickly on ice to room temperature and toluene (5 mL) is added. Finally, the absorbance is measured at 520 nm. Proline content is expressed as milligram per gram of FW.

2.4. Determination of AsA and GSH Contents

The titrimetric method with 2,6-dicloro-phenol-indophenol reagent described by Contreras-Calderón et al. [32], with several modifications, is used. The germinated seeds (0.5 g) and 5 mL of 2% oxalic acid solution are mixed together. The mixture is homogenized, diluted to 50 mL with 2% oxalic acid solution, and then filtered. The filtered solution (10 mL) is titrated with 0.01% 2,6-dichloro-phenol-indophenol solution. The final point occurs when the solution has a pink color for 30 s. The ascorbic acid content is expressed as milligrams per g of FW.
The glutathione (GSH) content is measured with an enzyme-linked immunosorbent assay (ELISA) kit (Solarbio Science & Technology, Beijing, China) according to the manufacturer’s instructions.

2.5. Determination of SOD, POD, CAT, and APX Activities

The superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX) activities are measured with an ELISA kit (Solarbio Science & Technology, Beijing, China) according to the manufacturer’s instructions.

2.6. Total RNA Extraction and Gene Expression Analysis

Total RNA in germinated seeds is extracted using TRIzol reagent described by Zhao et al. [33], with slight modifications. In brief, the samples (0.1 g) are ground into powder with a grinding miller. TRIzol (1 mL) is added to the powder and incubated for 10 min on ice. Then, 200 µL chloroform is added and incubated for 5 min; following that, the mixture is centrifuged at 12,000× g for 15 min at 4 °C and the supernatant is collected. An equal volume of isopropanol is mixed with supernatant, which is incubated at −20 °C for more than 1 h. Then, the mixture is centrifuged at 12,000× g for 15 min at 4 °C and sediment is collected. The collected sediment is washed with 75% ethanol twice. The sediment is dissolved with RNase-free ddH2O, which is defined as RNA. RNA quality and quantity are assessed using a NanoDrop spectrophotometer and an Agilent 2100 spectrophotometer, and more than 1 µg RNA samples are used for the cDNA synthesis. cDNA synthesis is applied with the 5 × Evo M-MLVRT Master Mix (AG, Changsha, China) according to the manufacturer’s instructions. The cDNA is amplified with 2 × SYBR Green Pro Taq HS Premix (AG, China). Then, gene-specific primers are shown in Table 1. The reactions are controlled by the following conditions: 30 s at 95 °C, then 5 s at 95 °C, and 30 s at 60 °C for 40 cycles. The expression levels of SOD, POD, CAT, APX, and GRX2 genes are presented as values relative to the corresponding control samples under the indicated conditions, with normalization of data to the geometric average of internal tomato Actin [34]. The expression level of the gene is calculated by 2−∆∆CT. Briefly, ∆CT = CT (target gene) − CT (internal reference gene). ∆∆CT = ∆CT (test group) − ∆CT (control group). Each sample is set to three biological replicates.

2.7. Statistical Analysis

Where indicated, all the experiments are performed with three replicates and results are expressed as mean ± SE. All data are analyzed using Microsoft Excel (Redmond, WA, USA). Using SPSS 22.0 (SPSS Institute Inc., Chicago, IL, USA), Duncan’s multiple range is used to compare mean values at the p < 0.05 significance level. All figures are prepared with OriginPro 2017 (OriginLab Institute Inc., Northampton, MA, USA).

3. Results

3.1. Salt Stress Inhibits Seed Germination in Cucumber

As shown in Figure 1a, the germination rate of seeds significantly decreases with the increase in NaCl concentrations. Compared with the control (0 mM NaCl), the germination rate of seeds treated with 1, 10, 50, or 100 mM NaCl decreases by 1.68, 5.08, 23.73, and 33.90%, respectively. Likewise, the application of NaCl of different concentrations from 1 to 100 mM decreases the radicle long and lateral root number of seeds (Figure 1a,b). The germination rate, radicle long, and lateral root number of seeds treated with 50 mM NaCl all exhibit a significant decrease and increase in comparison with 10 mM NaCl and 100 mM NaCl, respectively (Figure 1a–c). These results are in full agreement with the changes of seeds revealed in Figure 1d and seed vitality in Figure 1e. Therefore, treatments with 1–10 mM, 50 mM, and 100 mM NaCl could be termed as mild, moderate, and severe salt stress, respectively. As 50 mM NaCl induces moderate salt stress, the concentration is used for the next experiment.

3.2. Effects of Exogenous GR24 on Seed Germination under Salt Stress

To understand the effects of exogenous GR24 on seed germination under salt stress, we performed dose-response experiments with GR24. As shown in Figure 1, the germination of cucumber seeds is significantly decreased under salt stress in comparison with the control. However, different concentrations of GR24 (1–20 μM) significantly alleviates the decrease in germination rate, radicle long, lateral root number, and seed vitality of seeds caused by salt stress (Figure 2). Moreover, treatments with 10 and 20 μM GR24 result in the increase almost reaching the level of the control (Figure 2). These results show that the effect of GR24 on seed germination under salt condition was dose-dependent (Figure 2). Therefore, GR24 (10 μM), being the most effective under our experimental conditions, is used further for studies.
To further testify to the alleviation of GR24 in seed germination under salt stress, TIS108 (an inhibitor of strigolactone synthesis) is applied. The decreases in the germination rate, radicle long, lateral root number, and vitality of seeds caused by NaCl were distinctly increased by NaCl + GR24 (Figure 3). However, when TIS108 is added to the NaCl treatment, the germination rate, radicle long, lateral root number, and vitality of seeds are significantly decreased (Figure 3). These results demonstrate that GR24 can improve seed germination in cucumber under salt stress.

3.3. Effects of GR24 on MDA, H2O2, O2−, and Proline Contents during Seed Germination under Salt Stress

Compared with the control (distilled water), the treatment of NaCl results in an obvious enhancement in the MDA, H2O2, O2−, and proline contents (Figure 4). The MDA, H2O2, O2−, and proline contents of the treatment with NaCl plus GR24 is lower than that of the NaCl treatment (Figure 4). Treatment with NaCl + TIS108 causes a significant increase in MDA content compared with treatment with NaCl (Figure 4a). NaCl + TIS108 treatment has no significant influence on the H2O2, O2−, and proline contents under salt stress (Figure 4). These results indicate that the MDA, H2O2, O2−, and proline contents of the seeds are decreased by GR24 under salt stress, suggesting that GR24 improves salt-inhibited seed germination by inhibiting lipid peroxidation.

3.4. Effects of GR24 on AsA and GSH Contents during Seed Germination under Salt Stress

During seed germination, the ascorbic acid (AsA) content is declined by salt stress. Compared with the NaCl treatment, the content of AsA in the treatment with NaCl + GR24 increases by 184% (Figure 5a). However, the AsA content of the NaCl + GR24 treatment is more than that of the NaCl + TIS108 treatment (Figure 5a). The change in the GSH content is similar to that in the AsA content (Figure 5). Under salt stress, the increase in the GSH content decreases significantly when TIS108 is added (Figure 5b). The increase in the GSH content caused by NaCl + GR24 is distinctly decreased by NaCl + TIS108 (Figure 5b). These results demonstrate that endogenous GR24 increases the antioxidant AsA and GSH contents under salt condition.

3.5. Effects of GR24 on SOD, POD, CAT, and APX Activities during Seed Germination under Salt Stress

Compared with the control, the NaCl treatment induces lower activities of SOD, POD, CAT, and APX. When GR24 is added to NaCl, SOD, POD, CAT, and APX activities remarkably increase (Figure 6). However, a significant decrease in SOD, POD, CAT, and APX activities in the NaCl + TIS108 treatment is observed (Figure 6). These results suggest that GR24 alleviates seed germination under salt stress by increasing the antioxidant enzymes’, SOD, POD, CAT, and APX, activities.

3.6. Effects of GR24 on the Gene Expression Level Related to Antioxidant Enzymes during Seed Germination under Salt Stress

As shown in Figure 7, the expression levels of SOD, POD, CAT, APX, and GRX2 genes are significantly down-regulated under salt stress. The NaCl + GR24 treatment shows higher SOD, POD, CAT, APX, and GRX2 expression than the NaCl treatment (Figure 7). Conversely, the expression levels of SOD, POD, CAT, APX, and GRX2 genes are decreased by the NaCl + TIS108 treatment (Figure 7). These results demonstrate that the genes related to antioxidant enzymes are involved in the alleviation of salt-induced seed germination.

4. Discussion

Seed germination is one of the stages most sensitive to adverse environmental conditions; meanwhile, it is also an important biological process that determines plant life cycles and crop production [35]. Salt stress is an essential limiting element in seed germination, which leads to a reduction in germination rates and a delay in the initiation of germination [36,37,38]. The germination rate, radicle long, lateral root number, and vitality of seeds are commonly used as indicators that reflect seed germination and vigor [39]. In this study, the germination rate, radicle long, and lateral root number, as well as seed vitality, are significantly decreased by an NaCl treatment (Figure 1), which further confirms the negative effect of salt stress on seed germination. Previous studies indicate that SLs improve seed germination in plants [40]. This study examines whether SLs positively influence cucumber seed germination under salt stress. In the present study, GR24 responds to salt stress in a dose-dependent manner during seed germination, and the greatest biological response is observed in 10 µM GR24 treatment (Figure 2). However, the SLs’ synthesis inhibitor TIS108 reserves the positive roles of GR24 in seed germination under salt stress (Figure 3). These results imply that SLs alleviate the inhibition of cucumber seed germination caused by salt stress. Genes in the Suppressor of MAX2 1-Like (SMXL) family are known downstream elements of the SLs’ signaling pathways; they regulate the salt stress responses of soybean during seed germination, potentially via MAX2-mediated SLs-dependent and -independent pathways [41]. The application of GR24 also enhances salt resistance in rice seedlings [42]. The exogenous application of GR24 enhances plant tolerance to low light stress, thus improving tomato seedlings growth [43]. The applied exogenous GR24 could effectively alleviate salinity–alkalinity stress in apple seedlings [44]. Exogenous GR24 also alleviates salt stress in cucumber seedlings [45]. Exogenous GR24 might alleviate the low light stress-induced growth inhibition of cucumber seedlings [46]. Based on the results mentioned above, SLs may be applied as a potential approach to reduce the negative impact of abiotic stress on seed germination and seedling growth in plants.
Salt toxicity can cause an increase in the formation and accumulation of ROS, such as H2O2 and O2−, which directly or indirectly damages the cellular components, enzymes, and biological membranes, and even cell death [38,47,48,49]. MDA is formed by the reaction of ROS with lipid molecules of tissues and is toxic to biomacromolecules. It is well known that MDA, H2O2, and O2− are often used as indicators for oxidative damage in plants under various environmental conditions [35,50,51]. Additionally, proline as an organic solute is well known for its osmotic adjustment activity and role in enhancing salt tolerance through the protection of cellular membranes and enzyme integrity [52]. Our results showed that NaCl stress-induced oxidative stress in cucumber is indicated by the increase in MDA, H2O2, O2−, and proline levels during seed germination (Figure 4). These findings are in line with the salinity-induced oxidative stress described in previous studies in rice [53], maize [54], cucumber [55], bean [47], and tomato [56]. However, GR24 treatment decreases the MDA, H2O2, O2−, and proline contents of seeds under salt stress (Figure 4). When GR24 is inhibited, the increased MDA, H2O2, O2−, and proline contents are decreased, indicating that SLs can alleviate oxidative damage caused by salt stress under seed germination by decreasing MDA, H2O2, O2−, and proline levels. MORE AXILLARY GROWTH2 (MAX2) is a key gene in the signal transduction pathway of SLs. Zhang et al. [57] proved that CsMAX2-overexpressing lines had a low MDA content after salt, drought, and ABA stress, which is lower than that of WT plants. The proline content and lipid peroxidation of seeds primed with GR24 is enhanced or reduced, respectively, under heat stress [58]. Under low light stress, GR24 also increases the accumulation of carbohydrates and reduces the levels of H2O2 and MDA in cucumber seedlings [46]. Exogenous GR24 pretreatment can scavenge salt-induced excessive ROS, thus alleviating oxidative stress under salt stress in cucumber [45]. This also further suggests that H2O2 pathways might play a positive role in exogenous GR24 alleviating salt stress in cucumber seedlings [45]. GR24 application reduces MDA and H2O2 contents in low light-stressed tomato seedlings [43]. It is speculated that the SLs might be directly involved in the regulation of stress resistance by reducing MDA, H2O2, O2−, and proline contents, thus alleviating oxidative stress in plants.
To protect themselves against oxidative stress, plants have evolved ROS scavenging systems [59]. It is well known that the coordinated action of antioxidant substances, including AsA and GSH and antioxidant enzymes such as SOD, CAT, APX and POD, plays a significant role in scavenging ROS to protect cell membranes, which is thought to be a major mechanism of resistance to salt stress in plants [38,47,49]. Our results demonstrate a significant decrease in the AsA and GSH contents in NaCl-treated plants compared with non-treated plants (Figure 5). Cucumber seeds treated with GR24+NaCl have higher AsA and GSH contents than those in NaCl treatment alone, while the increase is decreased by TIS108 (Figure 5). The results suggest that SLs increase the contents of the non-enzyme substances, AsA and GSH, to alleviate salt stress-caused oxidative damage during seed germination. GR24 treatment effectively increases AsA levels in tomato seedlings under salt stress, while TIS108 blocks the increase in AsA content [25]. Thus, SLs may play an important role in improving salinity tolerance in plants by enhancing antioxidant capacity. GR24 also enhances the activities of SOD, APX, and POD antioxidant enzymes in lupine seedlings under heat stress [58]. Our results also show that GR24 treatment with a suitable concentration significantly improves the activities of SOD, CAT, APX, and POD in cucumber seeds under salt stress (Figure 6). The increased enzyme activities match the lower MDA, H2O2, and O2− levels (Figure 3 and Figure 6). Additionally, the expression levels of the SOD, POD, CAT, APX, and GRX2 genes are up-regulated by GR24, but their expression is down-regulated by TIS108 under salt stress (Figure 7). Under salinity–alkalinity stress, exogenous GR24 increases the activities of SOD, POD, and CAT enzymes, thereby eliminating ROS production and improving the salinity–alkalinity tolerance of apple [44]. RNA-seq analysis revealed that differentially expressed genes related to oxidation and the antioxidant system are up-regulated by exogenous application GR24 under salt stress in cucumber seedlings [45]. These results give strong evidence that a higher antioxidant defense capacity is one of the important mechanisms for exogenous GR24 to alleviate oxidative stress and improve stress tolerance.

5. Conclusions

In conclusion, this study clarifies the vital role of SLs in alleviating salt stress during cucumber seed germination. Moreover, the results reveal a mechanism of SLs-relieved salt toxicity during seed germination, which involves an antioxidant system: GR24 decreases the increase in MDA, H2O2, O2−, and proline contents caused by salt stress by increasing AsA and GSH contents and enhancing SOD, POD, POD, and APX activities, following the up-regulation of POD, CAT, APX, and GRX2 genes during seed germination. Collectively, these findings provide new insights into the biological functions of SLs in plant growth and stress response. However, the mechanisms underlying SLs and abiotic stress are quite complex, and future works should further explore the deeper mechanisms of SLs-alleviated seed germination under salt stress conditions, including the mining of critical genes and receptors.

Author Contributions

Conceptualization, C.L.; Methodology, C.L., X.L., Y.L. and J.X.; Formal Analysis, X.L., Y.L. and J.X.; investigation, C.L. and X.L.; data curation, C.L.; Writing—Original Draft Preparation, C.L.; Writing—Review & Editing, C.L. and W.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Nature Science Foundation of China (31660568), Guangxi science and technology major project (GuikeAA22068088), and start-up funding for introduced talents in Guangxi University (to C.L.).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Manivannan, P.; Jaleel, C.A.; Sankar, B.; Somasundaram, R.; Murali, P.V.; Sridharan, R.; Panneerselvam, R. Salt stress mitigation by calicium chloride in Vigna radiata (L.) Wilczek. Acta Biol. Cracov. Ser. Bot. 2007, 49, 105–109. [Google Scholar]
  2. Hussain, S.; Zhang, J.H.; Zhong, C.; Zhu, L.F.; Cao, X.C.; Yu, S.M.; Bohr, J.A.; Hu, J.J.; Jin, Q.Y. Effects of salt stress on rice growth, development characteristics, and the regulating ways: A review. J. Integr. Agric. 2017, 16, 2357–2374. [Google Scholar] [CrossRef]
  3. Sakr, M.T.; El-Metwally, M.A. Alleviation of the harmful effects of soil salt stress on growth, yield and endogenous antioxidant content of wheat plant by application of antioxidants. Pak. J. Biol. Sci. 2009, 12, 624–630. [Google Scholar] [CrossRef] [PubMed]
  4. Ibrahim, E.A. Seed priming to alleviate salinity stress in germinating seeds. J. Plant Physiol. 2016, 192, 38–46. [Google Scholar] [CrossRef]
  5. Hussain, S.; Khaliq, A.; Tanveer, M.; Matloob, A.; Hussain, H.A. Aspirin priming circumvents the salinity-induced effects on wheat emergence and seedling growth by regulating starch metabolism and antioxidant enzyme activities. Acta Physiol. Plant 2018, 40, 68. [Google Scholar] [CrossRef]
  6. Zhao, S.H.; Zhang, Q.K.; Liu, M.Y.; Zhou, H.P.; Ma, C.L.; Wang, P.P. Regulation of plant responses to salt stress. Int. J. Mol. Sci. 2021, 22, 4609. [Google Scholar] [CrossRef]
  7. Hao, S.H.; Wang, Y.R.; Yan, Y.X.; Liu, Y.H.; Wang, J.Y.; Chen, S. A review on plant responses to salt stress and their mechanisms of salt resistance. Horticulturae 2021, 7, 132. [Google Scholar] [CrossRef]
  8. Wei, L.J.; Zhang, J.; Wei, S.H.; Hu, D.L.; Liu, Y.Y.; Feng, L.; Li, C.X.; Qi, N.N.; Wang, C.L.; Liao, W.B. Nitric oxide enhanced salt stress tolerance in tomato seedlings, involving phytohormone equilibrium and photosynthesis. Int. J. Mol. Sci. 2022, 23, 4539. [Google Scholar] [CrossRef]
  9. Li, C.X.; Yu, W.J.; Wu, Y.C.; Li, Y.Q. Roles of hydrogen gas in plants under abiotic stress: Current knowledge and perspectives. Antioxidants 2022, 11, 1999. [Google Scholar] [CrossRef]
  10. Liu, H.; Wang, J.C.; Liu, J.H.; Liu, T.; Xue, S.W. Hydrogen sulfide (H2S) signaling in plant development and stress responses. aBIOTECH 2021, 2, 32–63. [Google Scholar] [CrossRef]
  11. Liu, K.L.; Xu, S.; Xuan, W.; Ling, T.F.; Cao, Z.Y.; Huang, B.K.; Sun, Y.G.; Fang, L.; Liu, Z.Y.; Zhao, N.; et al. Carbon monoxide counteracts the inhibition of seed germination and alleviates oxidative damage caused by salt stress in Oryza sativa. Plant Sci. 2007, 172, 544–555. [Google Scholar] [CrossRef]
  12. Su, Q.F.; Zheng, X.D.; Tian, Y.K.; Wang, C.H. Exogenous brassinolide alleviates salt stress in Malus hupehensis ehd. by regulating the transcription of NHX-Type Na+ (K+)/H+ antiporters. Front. Plant Sci. 2020, 11, 38–54. [Google Scholar] [CrossRef]
  13. Barros Junior, U.O.; Lima, M.D.R.; Alsahli, A.A.; Lobato, A.K.S. Unraveling the roles of brassinosteroids in alleviating drought stress in young Eucalyptus urophylla plants: Implications on redox homeostasis and photosynthetic apparatus. Physiol. Plant 2021, 172, 748–761. [Google Scholar] [CrossRef]
  14. Marusig, D.; Tombesi, S. Abscisic acid mediates drought and salt stress responses in Vitis vinifera-a review. Int. J. Mol. Sci. 2020, 21, 8648. [Google Scholar] [CrossRef]
  15. Huang, Y.Y.; Zhou, J.H.; Li, Y.X.; Quan, R.D.; Wang, J.; Huang, R.F.; Qin, H. Salt stress promotes abscisic acid accumulation to affect cell proliferation and expansion of primary roots in rice. Int. J. Mol. Sci. 2021, 22, 10892. [Google Scholar] [CrossRef]
  16. Yu, Z.P.; Duan, X.B.; Luo, L.; Dai, S.J.; Ding, Z.J.; Xia, G.M. How plant hormones mediate salt stress responses. Trends Plant Sci. 2020, 25, 1117–1130. [Google Scholar] [CrossRef]
  17. Ahmed, M.Z.; Khan, M.A. Tolerance and recovery responses of playa halophytes to light, salinity and temperature stresses during seed germination. Flora-Morphol. Distrib. Funct. Ecol. Plants 2010, 205, 764–771. [Google Scholar] [CrossRef]
  18. Zhou, Z.H.; Wang, Y.; Ye, X.Y.; Li, Z.G. Signaling molecule hydrogen sulfide improves seed germination and seedling growth of maize (Zea mays L.) under high temperature by inducing antioxidant system and osmolyte biosynthesis. Front. Plant Sci. 2018, 9, 1288. [Google Scholar] [CrossRef]
  19. Cheng, M.J.; Guo, Y.L.; Liu, Q.; Nan, S.W.; Xue, Y.X.; Wei, C.H.; Zhang, Y.; Luan, F.S.; Zhang, X.; Li, H. H2O2 and Ca2+ signaling crosstalk counteracts ABA to induce seed germination. Antioxidants 2022, 11, 1594. [Google Scholar] [CrossRef]
  20. Pandey, S.; Kumari, A.; Shree, M.; Kumar, V.; Singh, P.; Bharadwaj, C.; Loake, G.J.; Parida, S.K.; Masakapalli, S.K.; Gupta, K.J. Nitric oxide accelerates germination via the regulation of respiration in chickpea. J. Exp. Bot. 2019, 70, 4539–4555. [Google Scholar] [CrossRef]
  21. Jia, Y.J.; Li, R.J.; Yang, W.J.; Chen, Z.; Hu, X.Y. Carbon monoxide signal regulates light-initiated seed germination by suppressing SOM expression. Plant Sci. 2018, 272, 88–98. [Google Scholar] [CrossRef] [PubMed]
  22. Ren, Y.F.; Wang, W.; He, J.Y.; Zhang, L.Y.; Wei, Y.J.; Yang, M. Nitric oxide alleviates salt stress in seed germination and early seedling growth of pakchoi (Brassica chinensis L.) by enhancing physiological and biochemical parameters. Ecotoxicol. Environ. Saf. 2020, 187, 109785. [Google Scholar] [CrossRef] [PubMed]
  23. Vishal, B.; Kumar, P.P. Regulation of seed germination and abiotic stresses by gibberellins and abscisic acid. Front. Plant Sci. 2018, 9, 838. [Google Scholar] [CrossRef] [PubMed]
  24. Toh, S.; Kamiya, Y.; Kawakami, N.; Nambara, E.; McCourt, P.; Tsuchiya, Y. Thermoinhibition uncovers a role for strigolactones in Arabidopsis seed germination. Plant Cell Physiol. 2012, 53, 107–117. [Google Scholar] [CrossRef]
  25. Liu, H.W.; Li, C.X.; Yan, M.; Zhao, Z.X.; Huang, P.P.; Wei, L.J.; Wu, X.T.; Wang, C.L.; Liao, W.B. Strigolactone is involved in nitric oxide-enhanced the salt resistance in tomato seedlings. J. Plant Res. 2022, 135, 337–350. [Google Scholar] [CrossRef]
  26. Huang, P.; Li, C.; Liu, H.; Zhao, Z.; Liao, W. Hydrogen gas improves seed germination in cucumber by regulating sugar and starch metabolisms. Horticulturae 2021, 7, 456. [Google Scholar] [CrossRef]
  27. Zhang, Y.; Chen, B.; Xu, Z.; Shi, Z.; Chen, S.; Huang, X.; Chen, S.; Wang, X. Involvement of reactive oxygen species in endosperm cap weakening and embryo elongation growth during lettuce seed germination. J. Exp. Bot. 2014, 65, 3189–3200. [Google Scholar] [CrossRef]
  28. Ma, Q.; Zhang, T.; Zhang, P.; Wang, Z.Y. Melatonin attenuates postharvest physiological deterioration of cassava storage roots. J. Pineal. Res. 2016, 60, 424–434. [Google Scholar] [CrossRef]
  29. Prochazkova, D.; Sairam, R.K.; Srivastava, G.C. Oxidative stress and antioxidant activity as the basis of senescence in maize leaves. Plant. Sci. 2001, 161, 765–771. [Google Scholar] [CrossRef]
  30. Hu, H.; Liu, D.; Li, P. Methane delays the senescence and browning in daylily buds by restablished redox homeostasis. J. Sci. Food Agric. 2018, 98, 1977–1987. [Google Scholar] [CrossRef]
  31. Storey, R.; Jones, R.G.W. Betaine and choline levels in plants and their relationship to NaCl stress. Plant Sci. Lett. 1975, 4, 161–168. [Google Scholar] [CrossRef]
  32. Contreras-Calderón, J.; Calderón-Jaimes, L.; Guerra-Hernández, E.; García-Villanova, B. Antioxidant capacity, phenolic content and vitamin c in pulp, peel and seed from 24 exotic fruits from Colombia. Food Res. Int. 2011, 44, 2047–2053. [Google Scholar] [CrossRef]
  33. Zhao, Z.X.; Li, C.X.; Liu, H.W.; Yang, J.J.; Huang, P.P.; Liao, W. The involvement of glucose in hydrogen gas-medicated adventitious rooting in cucumber. Plants 2021, 10, 1937. [Google Scholar] [CrossRef]
  34. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-11 CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  35. He, J.; Ren, Y.; Chen, X.; Chen, H. Protective roles of nitric oxide on seed germination and seedling growth of rice (Oryza sativa L.) under cadmium stress. Ecotoxicol. Environ. Saf. 2014, 108, 114–119. [Google Scholar] [CrossRef]
  36. Kumar, A.; Rodrigues, V.; Verma, S.; Singh, M.; Sundaresan, V. Effect of salt stress on seed germination, morphology, biochemical parameters, genomic template stability, and bioactive constituents of Andrographis paniculata Nees. Acta Physiol. Plant. 2021, 43, 68. [Google Scholar] [CrossRef]
  37. Kataria, S.; Baghel, L.; Guruprasad, K.N. Pre-treatment of seeds with static magnetic field improves germination and early growth characteristics under salt stress in maize and soybean. Biocatalysis Agric. Biotechnol. 2017, 10, 83–90. [Google Scholar] [CrossRef]
  38. Ali, Q.; Daud, M.K.; Haider, M.Z.; Ali, S.; Rizwan, M.; Aslam, N.; Noman, A.; Iqbal, N.; Shahzad, F.; Deeba, F.; et al. Seed priming by sodium nitroprusside improves salt tolerance in wheat (Triticum aestivum L.) by enhancing physiological and biochemical parameters. Plant Physiol. Bioch. 2017, 119, 50–58. [Google Scholar] [CrossRef]
  39. Li, Z.; Pei, X.; Yin, S.; Lang, X.; Zhao, X.; Qu, G.Z. Plant hormone treatments to alleviate the effects of salt stress on germination of Betula platyphylla seeds. J. For. Res. 2019, 30, 779–787. [Google Scholar] [CrossRef]
  40. Aroca, R.; Ruiz-Lozano, J.M.; Zamarreño, Á.M.; Paz, J.A.; García-Mina, J.M.; Pozo, M.J.; López-Ráez, J.A. Arbuscular mycorrhizal symbiosis influences strigolactone production under salinity and alleviates salt stress in lettuce plants. J. Plant Physiol. 2013, 170, 47–55. [Google Scholar] [CrossRef]
  41. Fu, X.J.; Wang, J.; Shangguan, T.W.; Wu, R.; Li, S.J.; Chen, G.; Xu, S.C. SMXLs regulate seed germination under salinity and drought stress in soybean. Plant Growth Regul. 2022, 96, 397–408. [Google Scholar] [CrossRef]
  42. Ling, F.L.; Su, Q.W.; Jiang, H.; Cui, J.J.; He, X.L.; Wu, Z.H.; Zhang, Z.A.; Liu, J.; Zhao, Y.J. Effects of strigolactone on photosynthetic and physiological characteristics in salt-stressed rice seedlings. Sci. Rep. 2020, 10, 6183. [Google Scholar] [CrossRef] [PubMed]
  43. Lu, T.; Yu, H.J.; Li, Q.; Chai, L.; Jiang, W.J. Improving plant growth and alleviating photosynthetic inhibition and oxidative stress from low-light stress with exogenous GR24 in tomato (Solanum lycopersicum L.) seedlings. Front. Plant Sci. 2019, 10, 490. [Google Scholar] [CrossRef] [PubMed]
  44. Ma, C.Q.; Bian, C.J.; Liu, W.J.; Sun, Z.J.; Xi, X.L.; Guo, D.M.; Liu, X.L.; Tian, Y.K.; Wang, C.H.; Zheng, X.D. Strigolactone alleviates the salinity-alkalinity stress of Malus hupehensis seedlings. Front. Plant Sci. 2022, 13, 901782. [Google Scholar] [CrossRef] [PubMed]
  45. Zhang, X.H.; Zhang, L.; Ma, C.; Su, M.; Wang, J.; Zheng, S.; Zhang, T.G. Exogenous strigolactones alleviate the photosynthetic inhibition and oxidative damage of cucumber seedlings under salt stress. Sci. Hortic. 2022, 297, 110962. [Google Scholar] [CrossRef]
  46. Zhou, X.P.; Tan, Z.M.; Zhou, Y.G.; Guo, S.R.; Sang, T.; Wang, Y.; Shu, S. Physiological mechanism of strigolactone enhancing tolerance to low light stress in cucumber seedlings. BMC Plant Biol. 2022, 22, 30. [Google Scholar] [CrossRef]
  47. Farhangi-Abriz, S.; Torabian, S. Antioxidant enzyme and osmotic adjustment changes in bean seedlings as affected by biochar under salt stress. Ecotoxicol. Environ. Saf. 2017, 137, 64–70. [Google Scholar] [CrossRef]
  48. Yu, L.X.; Zhang, C.J.; Shang, H.Q.; Wang, X.F.; Wei, M.; Yang, F.J.; Shi, Q.H. Exogenous hydrogen sulfide enhanced antioxidant capacity, amylase activities and salt tolerance of cucumber hypocotyls and radicles. J. Integr. Agric. 2013, 12, 445–456. [Google Scholar] [CrossRef]
  49. Fan, H.F.; Du, C.X.; Ding, L.; Xu, Y.L. Effects of nitric oxide on the germination of cucumber seeds and antioxidant enzymes under salinity stress. Acta Physiol. Plant. 2013, 35, 2707–2719. [Google Scholar] [CrossRef]
  50. Siddiqui, M.H.; Alamri, S.A.; Al-Khaishany, M.Y.; Al-Qutami, M.A.; Ali, H.M.; AL-Rabiah, H.; Kalaji, H.M. Exogenous application of nitric oxide and spermidine reduces the negative effects of salt stress on tomato. Hortic. Environ. Biotechnol. 2017, 58, 537–547. [Google Scholar] [CrossRef]
  51. Ahmadi, F.I.; Karimi, K.; Struik, P.C. Effect of exogenous application of methyl jasmonate on physiological and biochemical characteristics of Brassica napus L. cv. Talaye under salinity stress. S. Afr. J. Bot. 2018, 115, 5–11. [Google Scholar] [CrossRef]
  52. Kumar, S.; Beena, A.S.; Awana, M.; Singh, A. Physiological, biochemical, epigenetic and molecular analyses of wheat (Triticum aestivum) genotypes with contrasting salt tolerance. Front. Plant Sci. 2017, 8, 1151. [Google Scholar] [CrossRef]
  53. Chawla, S.; Jain, S.; Jain, V. Salinity induced oxidative stress and antioxidant system in salt-tolerant and salt-sensitive cultivars of rice (Oryza sativa L.). J. Plant Biochem. Biotechnol. 2013, 22, 27–34. [Google Scholar] [CrossRef]
  54. AbdElgawad, H.; Zinta, G.; Hegab, M.M.; Pandey, R.; Asard, H.; Abuelsoud, W. High salinity induces different oxidative stress and antioxidant responses in maize seedlings organs. Front. Plant Sci. 2016, 7, 276. [Google Scholar] [CrossRef]
  55. Turan, M.; Ekinci, M.; Kul, R.; Boynueyri, F.G.; Yildirim, E. Mitigation of salinity stress in cucumber seedlings by exogenous hydrogen sulfide. J. Plant Res. 2022, 135, 517–529. [Google Scholar] [CrossRef]
  56. Raziq, A.; Wang, Y.; Din, A.; Sun, J.; Shu, S.; Guo, S.A. Comprehensive evaluation of salt tolerance in tomato (Var. Ailsa Craig): Responses of physiological and transcriptional changes in RBOH’s and ABA biosynthesis and signalling genes. Int. J. Mol. Sci. 2022, 23, 1603. [Google Scholar] [CrossRef]
  57. Zhang, R.M.; Dong, Y.L.; Li, Y.Y.; Ren, G.Y.; Chen, C.; Jin, X.X. SLs signal transduction gene CsMAX2 of cucumber positively regulated to salt, drought and ABA stress in Arabidopsis thaliana L. Gene 2023, 864, 147282. [Google Scholar] [CrossRef]
  58. Omoarelojie, L.O.; Kulkarni, M.G.; Finnie, J.F.; Pospíšil, T.; Strnad, M.; Van Staden, J. Synthetic strigolactone (rac-GR24) alleviates the adverse effects of heat stress on seed germination and photosystem II function in lupine seedlings. Plant Physiol. Biochem. 2020, 155, 965–979. [Google Scholar] [CrossRef]
  59. Zhou, Y.; Wen, Z.L.; Zhang, J.W.; Chen, X.J.; Cui, J.X.; Xu, W.; Liu, H.Y. Exogenous glutathione alleviates salt-induced oxidative stress in tomato seedlings by regulating glutathione metabolism, redox status, and the antioxidant system. Sci. Hortic. 2017, 220, 90–101. [Google Scholar] [CrossRef]
Antioxidants 12 01043 g001 550
Figure 1. Effects of different NaCl concentrations (0, 1, 10, 50, and 100 mM) on germination rate (a), radicle long (b), lateral root number (c), and seed vitality (d,e), respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05).
Figure 1. Effects of different NaCl concentrations (0, 1, 10, 50, and 100 mM) on germination rate (a), radicle long (b), lateral root number (c), and seed vitality (d,e), respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05).
Antioxidants 12 01043 g001
Antioxidants 12 01043 g002 550
Figure 2. Effects of different concentrations of GR24 on germination rate (a), radicle long (b), lateral root number (c), and seed vitality (d,e) under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05).
Figure 2. Effects of different concentrations of GR24 on germination rate (a), radicle long (b), lateral root number (c), and seed vitality (d,e) under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05).
Antioxidants 12 01043 g002
Antioxidants 12 01043 g003 550
Figure 3. Effects of GR24 and TIS108 on germination rate (a), radicle long (b), lateral root number (c), and seed vitality (d,e) under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05).
Figure 3. Effects of GR24 and TIS108 on germination rate (a), radicle long (b), lateral root number (c), and seed vitality (d,e) under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05).
Antioxidants 12 01043 g003
Antioxidants 12 01043 g004 550
Figure 4. Effects of GR24 and TIS108 on MDA (a), H2O2 (b), O2− (c), and proline (d) contents of cucumber seeds under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05). MDA, Malondialdehyde; H2O2, hydrogen peroxide; O2−, superoxide anion.
Figure 4. Effects of GR24 and TIS108 on MDA (a), H2O2 (b), O2− (c), and proline (d) contents of cucumber seeds under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05). MDA, Malondialdehyde; H2O2, hydrogen peroxide; O2−, superoxide anion.
Antioxidants 12 01043 g004
Antioxidants 12 01043 g005 550
Figure 5. Effects of GR24 and TIS108 on AsA (a) and GSH (b) contents of cucumber seeds under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05). AsA, ascorbate; GSH, glutathione.
Figure 5. Effects of GR24 and TIS108 on AsA (a) and GSH (b) contents of cucumber seeds under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05). AsA, ascorbate; GSH, glutathione.
Antioxidants 12 01043 g005
Antioxidants 12 01043 g006 550
Figure 6. Effects of GR24 and TIS108 on SOD (a), POD (b), CAT (c), and APX (d) activities of cucumber seeds under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05). SOD, superoxide dismutase; POD, peroxidase; CAT, catalase; APX, ascorbate peroxidase.
Figure 6. Effects of GR24 and TIS108 on SOD (a), POD (b), CAT (c), and APX (d) activities of cucumber seeds under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05). SOD, superoxide dismutase; POD, peroxidase; CAT, catalase; APX, ascorbate peroxidase.
Antioxidants 12 01043 g006
Antioxidants 12 01043 g007 550
Figure 7. Effects of GR24 and TIS108 on the expression levels of SOD (a), POD (b), CAT (c), APX (d), and GRX2 (e) genes of cucumber seeds under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05).
Figure 7. Effects of GR24 and TIS108 on the expression levels of SOD (a), POD (b), CAT (c), APX (d), and GRX2 (e) genes of cucumber seeds under salt stress, respectively. The values (means ± SE) are the averages of three independent experiments (n = 20). Bars not sharing the same letters indicate statistically significant differences by Duncan’s multiple range test (p < 0.05).
Antioxidants 12 01043 g007
Table
Table 1. Primer sequence for qRT-PCR.
Table 1. Primer sequence for qRT-PCR.
Gene NameGene IDPrimer Sequence (5′–3′)
SODLOC101215417ACGGGTAATGTTTCTGGTCTCAAGC
CATGCAGCCATTGGTTGTGTCAC
PODLOC101212957AGACGGTGGTGGGAGTGGAATC
GAGCAACGATGTCAGCACAAGAAAC
CATLOC101216662GAGCAACGATGTCAGCACAAGAAAC
TCCAAGACGGTGCCTCTGAGTATC
APXLOC101212957AAAGTGCTACCCTGTTGTGAGTGAG
AAAGTGCTACCCTGTTGTGAGTGAG
GRX2LOC101205064TCGGTGGTTGCGATGGTAAGAAC
GCTGACCTCTGTGATGCTTCTCTG
ActinLOC101220617F: TTCTGGTGATGG TGTGAGTC
R: GGCAGTGGTGGTGAACATG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, C.; Lu, X.; Liu, Y.; Xu, J.; Yu, W. Strigolactone Alleviates the Adverse Effects of Salt Stress on Seed Germination in Cucumber by Enhancing Antioxidant Capacity. Antioxidants 2023, 12, 1043. https://doi.org/10.3390/antiox12051043

AMA Style

Li C, Lu X, Liu Y, Xu J, Yu W. Strigolactone Alleviates the Adverse Effects of Salt Stress on Seed Germination in Cucumber by Enhancing Antioxidant Capacity. Antioxidants. 2023; 12(5):1043. https://doi.org/10.3390/antiox12051043

Chicago/Turabian Style

Li, Changxia, Xuefang Lu, Yunzhi Liu, Junrong Xu, and Wenjin Yu. 2023. "Strigolactone Alleviates the Adverse Effects of Salt Stress on Seed Germination in Cucumber by Enhancing Antioxidant Capacity" Antioxidants 12, no. 5: 1043. https://doi.org/10.3390/antiox12051043

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop