Differences in Treatment Response in Bronchial Epithelial Cells from Idiopathic Pulmonary Fibrosis (IPF) Patients: A First Step towards Personalized Medicine?
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patient Characteristics
2.2. Collection and Culture of Bronchial Epithelial Cells
2.3. Confocal Imaging
2.4. ELISA
2.5. MTT Assay
2.6. LDH Assay
2.7. RNA Isolation and RT-PCR
2.8. Statistical Analysis
3. Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Raghu, G.; Chen, S.Y.; Yeh, W.S.; Maroni, B.; Li, Q.; Lee, Y.C.; Collard, H.R. Idiopathic pulmonary fibrosis in US Medicare beneficiaries aged 65 years and older: Incidence, prevalence, and survival, 2001–2011. Lancet Respir. Med. 2014, 2, 566–572. [Google Scholar] [CrossRef] [PubMed]
- Kreuter, M.; Swigris, J.; Pittrow, D.; Geier, S.; Klotsche, J.; Prasse, A.; Wirtz, H.; Koschel, D.; Andreas, S.; Claussen, M.; et al. Health related quality of life in patients with idiopathic pulmonary fibrosis in clinical practice: Insights-IPF registry. Respir. Res. 2017, 18, 139. [Google Scholar] [CrossRef] [PubMed]
- Meyer, K.C. Pulmonary fibrosis, part I: Epidemiology, pathogenesis, and diagnosis. Expert Rev. Respir. Med. 2017, 11, 343–359. [Google Scholar] [CrossRef] [PubMed]
- Du Bois, R.M. Strategies for treating idiopathic pulmonary fibrosis. Nat. Rev. Drug Discov. 2010, 9, 129–140. [Google Scholar] [CrossRef]
- Veith, C.; Drent, M.; Bast, A.; van Schooten, F.J.; Boots, A.W. The disturbed redox-balance in pulmonary fibrosis is modulated by the plant flavonoid quercetin. Toxicol. Appl. Pharmacol. 2017, 336, 40–48. [Google Scholar] [CrossRef]
- Anathy, V.; Lahue, K.G.; Chapman, D.G.; Chia, S.B.; Casey, D.T.; Aboushousha, R.; van der Velden, J.L.J.; Elko, E.; Hoffman, S.M.; McMillan, D.H.; et al. Reducing protein oxidation reverses lung fibrosis. Nat. Med. 2018, 24, 1128–1135. [Google Scholar] [CrossRef]
- Hecker, L.; Vittal, R.; Jones, T.; Jagirdar, R.; Luckhardt, T.R.; Horowitz, J.C.; Pennathur, S.; Martinez, F.J.; Thannickal, V.J. NADPH oxidase-4 mediates myofibroblast activation and fibrogenic responses to lung injury. Nat. Med. 2009, 15, 1077–1081. [Google Scholar] [CrossRef]
- Jiang, F.; Liu, G.S.; Dusting, G.J.; Chan, E.C. NADPH oxidase-dependent redox signaling in TGF-beta-mediated fibrotic responses. Redox Biol. 2014, 2, 267–272. [Google Scholar] [CrossRef]
- Kolb, M.; Bonella, F.; Wollin, L. Therapeutic targets in idiopathic pulmonary fibrosis. Respir. Med. 2017, 131, 49–57. [Google Scholar] [CrossRef]
- Kwapiszewska, G.; Gungl, A.; Wilhelm, J.; Marsh, L.M.; Thekkekara Puthenparampil, H.; Sinn, K.; Didiasova, M.; Klepetko, W.; Kosanovic, D.; Schermuly, R.T.; et al. Transcriptome profiling reveals the complexity of pirfenidone effects in idiopathic pulmonary fibrosis. Eur. Respir. J. 2018, 52, 1800564. [Google Scholar] [CrossRef] [Green Version]
- Conte, E.; Gili, E.; Fagone, E.; Fruciano, M.; Iemmolo, M.; Vancheri, C. Effect of pirfenidone on proliferation, TGF-beta-induced myofibroblast differentiation and fibrogenic activity of primary human lung fibroblasts. Eur. J. Pharm. Sci. 2014, 58, 13–19. [Google Scholar] [CrossRef]
- Oku, H.; Shimizu, T.; Kawabata, T.; Nagira, M.; Hikita, I.; Ueyama, A.; Matsushima, S.; Torii, M.; Arimura, A. Antifibrotic action of pirfenidone and prednisolone: Different effects on pulmonary cytokines and growth factors in bleomycin-induced murine pulmonary fibrosis. Eur. J. Pharmacol. 2008, 590, 400–408. [Google Scholar] [CrossRef]
- Hostettler, K.E.; Zhong, J.; Papakonstantinou, E.; Karakiulakis, G.; Tamm, M.; Seidel, P.; Sun, Q.; Mandal, J.; Lardinois, D.; Lambers, C.; et al. Anti-fibrotic effects of nintedanib in lung fibroblasts derived from patients with idiopathic pulmonary fibrosis. Respir. Res. 2014, 15, 157. [Google Scholar] [CrossRef]
- Sato, S.; Shinohara, S.; Hayashi, S.; Morizumi, S.; Abe, S.; Okazaki, H.; Chen, Y.; Goto, H.; Aono, Y.; Ogawa, H.; et al. Anti-fibrotic efficacy of nintedanib in pulmonary fibrosis via the inhibition of fibrocyte activity. Respir. Res. 2017, 18, 172. [Google Scholar] [CrossRef]
- Lehmann, M.; Buhl, L.; Alsafadi, H.N.; Klee, S.; Hermann, S.; Mutze, K.; Ota, C.; Lindner, M.; Behr, J.; Hilgendorff, A.; et al. Differential effects of Nintedanib and Pirfenidone on lung alveolar epithelial cell function in ex vivo murine and human lung tissue cultures of pulmonary fibrosis. Respir. Res. 2018, 19, 175. [Google Scholar] [CrossRef]
- Hu, M.; Che, P.; Han, X.; Cai, G.Q.; Liu, G.; Antony, V.; Luckhardt, T.; Siegal, G.P.; Zhou, Y.; Liu, R.M.; et al. Therapeutic targeting of SRC kinase in myofibroblast differentiation and pulmonary fibrosis. J. Pharmacol. Exp. Ther. 2014, 351, 87–95. [Google Scholar] [CrossRef]
- Ahangari, F.; Becker, C.; Foster, D.G.; Chioccioli, M.; Nelson, M.; Beke, K.; Wang, X.; Justet, A.; Adams, T.; Readhead, B.; et al. Saracatinib, a Selective Src Kinase Inhibitor, Blocks Fibrotic Responses in Preclinical Models of Pulmonary Fibrosis. Am. J. Respir. Crit. Care Med. 2022, 206, 1463–1479. [Google Scholar] [CrossRef]
- Jaeger, B.; Schupp, J.C.; Plappert, L.; Terwolbeck, O.; Artysh, N.; Kayser, G.; Engelhard, P.; Adams, T.S.; Zweigerdt, R.; Kempf, H.; et al. Airway basal cells show a dedifferentiated KRT17(high)Phenotype and promote fibrosis in idiopathic pulmonary fibrosis. Nat. Commun. 2022, 13, 5637. [Google Scholar] [CrossRef]
- Roskoski, R., Jr. Src protein-tyrosine kinase structure, mechanism, and small molecule inhibitors. Pharmacol. Res. 2015, 94, 9–25. [Google Scholar] [CrossRef]
- Grimminger, F.; Gunther, A.; Vancheri, C. The role of tyrosine kinases in the pathogenesis of idiopathic pulmonary fibrosis. Eur. Respir. J. 2015, 45, 1426–1433. [Google Scholar] [CrossRef] [Green Version]
- Selman, M.; King, T.E.; Pardo, A.; American Thoracic, S.; European Respiratory, S.; American College of Chest, P. Idiopathic pulmonary fibrosis: Prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 2001, 134, 136–151. [Google Scholar] [CrossRef] [PubMed]
- Warsinske, H.C.; Wheaton, A.K.; Kim, K.K.; Linderman, J.J.; Moore, B.B.; Kirschner, D.E. Computational Modeling Predicts Simultaneous Targeting of Fibroblasts and Epithelial Cells Is Necessary for Treatment of Pulmonary Fibrosis. Front. Pharmacol. 2016, 7, 183. [Google Scholar] [CrossRef] [PubMed]
- Veith, C.; Hristova, M.; Danyal, K.; Habibovic, A.; Dustin, C.M.; McDonough, J.E.; Vanaudenaerde, B.M.; Kreuter, M.; Schneider, M.A.; Kahn, N.; et al. Profibrotic epithelial TGF-beta1 signaling involves NOX4-mitochondria cross talk and redox-mediated activation of the tyrosine kinase FYN. Am. J. Physiol. Lung Cell. Mol. Physiol. 2021, 320, L356–L367. [Google Scholar] [CrossRef] [PubMed]
- Raghu, G.; Collard, H.R.; Egan, J.J.; Martinez, F.J.; Behr, J.; Brown, K.K.; Colby, T.V.; Cordier, J.F.; Flaherty, K.R.; Lasky, J.A.; et al. An official ATS/ERS/JRS/ALAT statement: Idiopathic pulmonary fibrosis: Evidence-based guidelines for diagnosis and management. Am. J. Respir. Crit. Care Med. 2011, 183, 788–824. [Google Scholar] [CrossRef] [PubMed]
- Kahn, N.; Kuner, R.; Eberhardt, R.; Meister, M.; Muley, T.; Winteroll, S.; Schnabel, P.A.; Ishizaka, A.; Herth, F.J.; Poustka, A.; et al. Gene expression analysis of endobronchial epithelial lining fluid in the evaluation of indeterminate pulmonary nodules. J. Thorac. Cardiovasc. Surg. 2009, 138, 474–479. [Google Scholar] [CrossRef]
- Wu, R. Growth of human lung tumor cells in culture. In Culture of Human Tumor Cells; Pfragner, R., Freshney, R.I., Eds.; Wiley-Liss Inc.: Hoboken, NJ, USA, 2004; pp. 1–21. [Google Scholar]
- Carnesecchi, S.; Deffert, C.; Donati, Y.; Basset, O.; Hinz, B.; Preynat-Seauve, O.; Guichard, C.; Arbiser, J.L.; Banfi, B.; Pache, J.C.; et al. A key role for NOX4 in epithelial cell death during development of lung fibrosis. Antioxid. Redox Signal. 2011, 15, 607–619. [Google Scholar] [CrossRef]
- Cantin, A.M.; Hubbard, R.C.; Crystal, R.G. Glutathione deficiency in the epithelial lining fluid of the lower respiratory tract in idiopathic pulmonary fibrosis. Am. Rev. Respir. Dis. 1989, 139, 370–372. [Google Scholar] [CrossRef]
- Odajima, N.; Betsuyaku, T.; Nagai, K.; Moriyama, C.; Wang, D.H.; Takigawa, T.; Ogino, K.; Nishimura, M. The role of catalase in pulmonary fibrosis. Respir. Res. 2010, 11, 183. [Google Scholar] [CrossRef]
- Kinnula, V.L.; Hodgson, U.A.; Lakari, E.K.; Tan, R.J.; Sormunen, R.T.; Soini, Y.M.; Kakko, S.J.; Laitinen, T.H.; Oury, T.D.; Paakko, P.K. Extracellular superoxide dismutase has a highly specific localization in idiopathic pulmonary fibrosis/usual interstitial pneumonia. Histopathology 2006, 49, 66–74. [Google Scholar] [CrossRef]
- Raghu, G.; Berk, M.; Campochiaro, P.A.; Jaeschke, H.; Marenzi, G.; Richeldi, L.; Wen, F.Q.; Nicoletti, F.; Calverley, P.M.A. The Multifaceted Therapeutic Role of N-Acetylcysteine (NAC) in Disorders Characterized by Oxidative Stress. Curr. Neuropharmacol. 2021, 19, 1202–1224. [Google Scholar]
- Vuorinen, K.; Ohlmeier, S.; Lepparanta, O.; Salmenkivi, K.; Myllarniemi, M.; Kinnula, V.L. Peroxiredoxin II expression and its association with oxidative stress and cell proliferation in human idiopathic pulmonary fibrosis. J. Histochem. Cytochem. 2008, 56, 951–959. [Google Scholar] [CrossRef] [Green Version]
- Knuppel, L.; Ishikawa, Y.; Aichler, M.; Heinzelmann, K.; Hatz, R.; Behr, J.; Walch, A.; Bachinger, H.P.; Eickelberg, O.; Staab-Weijnitz, C.A. A Novel Antifibrotic Mechanism of Nintedanib and Pirfenidone. Inhibition of Collagen Fibril Assembly. Am. J. Respir. Cell. Mol. Biol. 2017, 57, 77–90. [Google Scholar] [CrossRef]
- Rangarajan, S.; Kurundkar, A.; Kurundkar, D.; Bernard, K.; Sanders, Y.Y.; Ding, Q.; Antony, V.B.; Zhang, J.; Zmijewski, J.; Thannickal, V.J. Novel Mechanisms for the Antifibrotic Action of Nintedanib. Am. J. Respir. Cell. Mol. Biol. 2016, 54, 51–59. [Google Scholar] [CrossRef]
- Chua, R.L.; Veith, C.; Schneider, M.A.; Jechow, K.; Xu, E.C.; Kreuter, M.; Boots, A.W.; Elis, R.; Kahn, N.C.; Conrad, C. Profibrotic priming of airway cell types and drug responses in early-stage idiophatic pulmonary fibrosis. bioRxiv 2022. [Google Scholar] [CrossRef]
- Glass, D.S.; Grossfeld, D.; Renna, H.A.; Agarwala, P.; Spiegler, P.; DeLeon, J.; Reiss, A.B. Idiopathic pulmonary fibrosis: Current and future treatment. Clin. Respir. J. 2022, 16, 84–96. [Google Scholar] [CrossRef]
- Thannickal, V.J.; Antony, V.B. Is personalized medicine a realistic goal in idiopathic pulmonary fibrosis? Expert Rev. Respir. Med. 2018, 12, 441–443. [Google Scholar] [CrossRef]
- Bargagli, E.; Olivieri, C.; Bennett, D.; Prasse, A.; Muller-Quernheim, J.; Rottoli, P. Oxidative stress in the pathogenesis of diffuse lung diseases: A review. Respir. Med. 2009, 103, 1245–1256. [Google Scholar] [CrossRef]
- Rogliani, P.; Calzetta, L.; Cavalli, F.; Matera, M.G.; Cazzola, M. Pirfenidone, nintedanib and N-acetylcysteine for the treatment of idiopathic pulmonary fibrosis: A systematic review and meta-analysis. Pulm. Pharmacol. Ther. 2016, 40, 95–103. [Google Scholar] [CrossRef]
- Heukels, P.; Moor, C.C.; von der Thusen, J.H.; Wijsenbeek, M.S.; Kool, M. Inflammation and immunity in IPF pathogenesis and treatment. Respir. Med. 2019, 147, 79–91. [Google Scholar] [CrossRef]
- Maher, T.M.; Oballa, E.; Simpson, J.K.; Porte, J.; Habgood, A.; Fahy, W.A.; Flynn, A.; Molyneaux, P.L.; Braybrooke, R.; Divyateja, H.; et al. An epithelial biomarker signature for idiopathic pulmonary fibrosis: An analysis from the multicentre PROFILE cohort study. Lancet Respir. Med. 2017, 5, 946–955. [Google Scholar] [CrossRef]
- Prasse, A.; Binder, H.; Schupp, J.C.; Kayser, G.; Bargagli, E.; Jaeger, B.; Hess, M.; Rittinghausen, S.; Vuga, L.; Lynn, H.; et al. BAL Cell Gene Expression Is Indicative of Outcome and Airway Basal Cell Involvement in Idiopathic Pulmonary Fibrosis. Am. J. Respir. Crit. Care Med. 2019, 199, 622–630. [Google Scholar] [CrossRef] [PubMed]
- Adams, T.S.; Schupp, J.C.; Poli, S.; Ayaub, E.A.; Neumark, N.; Ahangari, F.; Chu, S.G.; Raby, B.A.; DeIuliis, G.; Januszyk, M.; et al. Single-cell RNA-seq reveals ectopic and aberrant lung-resident cell populations in idiopathic pulmonary fibrosis. Sci. Adv. 2020, 6, eaba1983. [Google Scholar] [CrossRef] [PubMed]
- Fingerlin, T.E.; Murphy, E.; Zhang, W.; Peljto, A.L.; Brown, K.K.; Steele, M.P.; Loyd, J.E.; Cosgrove, G.P.; Lynch, D.; Groshong, S.; et al. Genome-wide association study identifies multiple susceptibility loci for pulmonary fibrosis. Nat. Genet. 2013, 45, 613–620. [Google Scholar] [CrossRef] [PubMed]
- Wollin, L.; Wex, E.; Pautsch, A.; Schnapp, G.; Hostettler, K.E.; Stowasser, S.; Kolb, M. Mode of action of nintedanib in the treatment of idiopathic pulmonary fibrosis. Eur. Respir. J. 2015, 45, 1434–1445. [Google Scholar] [CrossRef]
- Kato, K.; Papageorgiou, I.; Shin, Y.J.; Kleinhenz, J.M.; Palumbo, S.; Hahn, S.; Irish, J.D.; Rounseville, S.P.; Knox, K.S.; Hecker, L. Lung-Targeted Delivery of Dimethyl Fumarate Promotes the Reversal of Age-Dependent Established Lung Fibrosis. Antioxidants 2022, 11, 492. [Google Scholar] [CrossRef]
- Khoo, J.K.; Montgomery, A.B.; Otto, K.L.; Surber, M.; Faggian, J.; Lickliter, J.D.; Glaspole, I. A Randomized, Double-Blinded, Placebo-Controlled, Dose-Escalation Phase 1 Study of Aerosolized Pirfenidone Delivered via the PARI Investigational eFlow Nebulizer in Volunteers and Patients with Idiopathic Pulmonary Fibrosis. J. Aerosol. Med. Pulm. Drug. Deliv. 2020, 33, 15–20. [Google Scholar] [CrossRef] [Green Version]
ID | Diagnosis | Gender | Age (Years) | DLCO (% Predicted) | FVC (l) | FVC (% Predicted) | Smoking Status |
---|---|---|---|---|---|---|---|
1 | ILD, UIP pattern | Male | 53 | 38.1 | 2.95 | 78.8 | Current, 55 py |
2 | ILD, UIP pattern | Male | 70 | 36.5 | 2.39 | 89.7 | Ex-smoker, 50 py |
3 | ILD, IgG4 associated, NSIP pattern | Male | 68 | 48.4 | 3.78 | 60.9 | Non-smoker |
4 | ILD, UIP pattern | Male | 77 | 39.3 | 3.44 | 89.4 | Ex-smoker, 25 py |
5 | LUSC | Male | 53 | 101.8 | 4.08 | 93 | Current, 20 py |
6 | Lipoma | Female | 55 | 98.4 | 3.49 | 113.3 | Ex-smoker, 15 py |
7 | LUSC | Male | 55 | 81.9 | 4.79 | 112.7 | Current, 25 py |
Gene of Interest | Accession Number | Forward Primer | Reverse Primer |
---|---|---|---|
Actin | NM_001101.5 | CCTGGCACCCAGCACAAT | GCCGATCCACACGGAGTACT |
NOX4 | NM_016931.5 | TGGCAAGAGAACAGACCTGA | TGGGTCCACAACAGAAAACA |
NRF2 | NM_006164.5 | ACACGGTCCACAGCTCATC | TCTTGCCTCCAAAGTATGTCAA |
HO-1 | NM_002133.3 | CTTCTTCACCTTCCCCAACA | GCTCTGGTCCTTGGTGTCAT |
γGCS | NM_001498.4 | CGACCAATGGAGGTGCAGTTA | ACCCTAGTGAGCAGTACCACGAA |
CAT | NM_001752.4 | GATGTGCATGCAGGACAATCAG | GCTTCTCAGCATTGTACTTGTCC |
SOD1 | NM_000454.5 | CCACACCTTCACTGGTCCAT | CTAGCGAGTTATGGCGACG |
SOD2 | NM_000636.4 | TGGACAAACCTCAGCCCTAACG | TGATGGCTTCCAGCAACTCCC |
GLRX | NM_002064.3 | CACTGCATCCGCCTATACAA | CAGCCACCAACCACACTAAC |
TRX1 | NM_003329.4 | GCACGCCAACATTCCAGTTT | ACGCAGATGGCAACTGGTTA |
TRX2 | NM_012473.4 | TGGTGGCCTGACTGTAACAC | ACTCAATGGCGAGGTCTGTG |
COL1A1 | NM_000088.4 | GGACACAGAGGTTTCAGTGG | CCAGTAGCACCATCATTTCC |
FN1 | NM_212482.4 | AGTGGGAGACCTCGAGAAGA | ACTGTGACAGCAGGAGCATC |
TGF-β | NM_000660.7 | CCCTGGACACCAACTATTGC | CTTCCAGCCGAGGTCCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Veith, C.; Schneider, M.A.; Maas, L.; van der Vliet, A.; van Schooten, F.J.; Kreuter, M.; Meister, M.; Boots, A.W.; Kahn, N. Differences in Treatment Response in Bronchial Epithelial Cells from Idiopathic Pulmonary Fibrosis (IPF) Patients: A First Step towards Personalized Medicine? Antioxidants 2023, 12, 443. https://doi.org/10.3390/antiox12020443
Veith C, Schneider MA, Maas L, van der Vliet A, van Schooten FJ, Kreuter M, Meister M, Boots AW, Kahn N. Differences in Treatment Response in Bronchial Epithelial Cells from Idiopathic Pulmonary Fibrosis (IPF) Patients: A First Step towards Personalized Medicine? Antioxidants. 2023; 12(2):443. https://doi.org/10.3390/antiox12020443
Chicago/Turabian StyleVeith, C., M. A. Schneider, L. Maas, A. van der Vliet, F. J. van Schooten, M. Kreuter, M. Meister, A. W. Boots, and N. Kahn. 2023. "Differences in Treatment Response in Bronchial Epithelial Cells from Idiopathic Pulmonary Fibrosis (IPF) Patients: A First Step towards Personalized Medicine?" Antioxidants 12, no. 2: 443. https://doi.org/10.3390/antiox12020443