Physiological and Molecular Responses of Vitis vinifera cv. Tempranillo Affected by Esca Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Experimental Design
2.2. Photosynthetic Pigment Contents and Photosynthetic Efficiency
2.3. Determination of Lipid Peroxidation
2.4. Determination of Proline Content
2.5. Phenolics Content and PPO Activity
2.6. Determination of Antioxidant Capacity
2.7. Ascorbate and Glutathione Contents
2.8. RNA Extraction and Synthesis of cDNA
2.9. Identification and Amplification of the Genes Studied
2.10. Statistical Analyses
3. Results and Discussion
3.1. Pigments and Photosynthetic Efficiency
3.2. Lipid Peroxidation and Proline Content
3.3. Total Phenols, Flavonoids, Phenylpropanoid Glycosides (PPGs), Anthocyanins, Antioxidant Capacity (FRAP), and Polyphenol Oxidase (PPO) Activity
3.4. Ascorbate and Glutathione Content
3.5. Gene Expression
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sosnowski, M.; Wicks, T.J.; Scott, E. Control of Eutypa dieback in grapevines using remedial surgery. Phytopathol. Mediterr. 2011, 50, S277–S284. [Google Scholar] [CrossRef]
- Hofstetter, V.; Buyck, B.; Croll, D.; Viret, O.; Couloux, A.; Gindro, K. What if esca disease of grapevine were not a fungal disease? Fungal Divers. 2012, 1, 51–67. [Google Scholar] [CrossRef]
- De la Fuente, M.; Fontaine, F.; Gramaje, D.; Armengol, J.; Smart, R.; Nagy, Z.A.; Borgo, M.; Rego, C.; Corio-Costet, M.F. Grapevine Trunk Diseases: A review, OIV Collective Expertise Document, 1st ed.; OIV Publications: Paris, France, 2016; ISBN 979-10-91799-60-7. [Google Scholar]
- Gramaje, D.; Urbez-Torres, J.R.; Sosnowski, M.R. Managing grapevine trunk diseases with respect to etiology and epidemiology: Current strategies and future prospects. Plant Dis. 2018, 102, 12–39. [Google Scholar] [CrossRef]
- Goufo, P.; Marques, A.C.; Cortez, I. Exhibition of local but not systemic induced phenolic defenses in Vitis vinifera L. affected by brown wood streaking, grapevine leaf stripe, and apoplexy (Esca Complex). Plants 2019, 8, 412. [Google Scholar] [CrossRef] [PubMed]
- Ouadi, L.; Bruez, E.; Bastien, S.; Vallance, J.; Lecomte, P.; Domec, J.C.; Rey, P. Ecophysiological impacts of Esca, a devastating grapevine trunk disease, on Vitis vinifera L. PLoS ONE 2019, 14, e0222586. [Google Scholar] [CrossRef]
- Casadomet, E.; Senero, M.; Pérez Ross, J.; Bueno, M.; Moral, F.; Rebollo, J.; Del Moral, J. Representación de la intensidad y distribución de las cepas con síntomas de EMV, mediante la utilización de técnicas geoestadísticas y de análisis espacial, en un viñedo de la comarca de Tierra de Barros (Badajoz). Phytoma 2015, 274, 131–132. [Google Scholar]
- Arias, A.; Del Moral, J. La Eutipiosis de la Vid. Agricultura 1981, 592, 827–830. [Google Scholar]
- García-Jiménez, J.; Raposo, R.; Armegol, J. Enfermedades Fúngicas de la Madera de la Vid; Jiménez Díaz, R.F., Seguí, M., Eds.; Enfermedades de Hongos y Oomicetos. Naturaleza y Control Integrado; Phytoma: Valencia, Spain, 2010; pp. 161–173. [Google Scholar]
- Luque, J.; Elena, G.; Armengol, J.; Legorburu, J. Las enfermedades de la madera de la vid reflexiones sobre un panorama complejo. Phytoma 2014, 260, 18–24. [Google Scholar]
- Agustí-Brisach, C.; Lopez-Moral, A.; Raya-Ortega, M.C.; Franco, R.; Roca-Castillo, L.F.; Trapero, A. Occurrence of grapevine trunk diseases affecting the native cultivar Pedro Ximénez in southern Spain. Eur. J. Plant Pathol. 2019, 153, 599–625. [Google Scholar] [CrossRef]
- Bertsch, C.; Ramírez-Suero, M.; Magnin-Robert, M.; Larignon, P.; Chong, J.; Abou Mansour, F.; Spagnolo, A.; Clement, C.; Fontaine, F. Grapevine trunk disease: Complex and still poorly understood. Plant Pathol. 2013, 62, 243–265. [Google Scholar] [CrossRef]
- Úrbez-Torres, J.R.; Haag, P.; Bowen, P.; O’Gorman, D.T. Grapevine trunk diseases in British Columbia: Incidence and characterization of the fungal pathogens associated with Esca and Petri diseases of grapevine. Plant Dis. 2014, 98, 469–482. [Google Scholar] [CrossRef] [PubMed]
- Aroca, A.; García-Figueres, F.; Bracamonte, L.; Luque, J.; Raposo, R. A survey of trunk disease pathogens within roostocks of grape vine in Spain. Eur. J. Plant Pathol. 2006, 115, 195–202. [Google Scholar] [CrossRef]
- Aroca, A.; Gramaje, D.; Armegol, J.; García-Jiménez, J.; Raposo, R. Evaluation of the grapevine nursery propagation process as a source of Phaeocremonium spp. and Pheomoniella chlamydospora and ocurrence of trunk disease pathogens in roostock mother vines in Spain. Eur. J. Plant Pathol. 2010, 126, 165–174. [Google Scholar] [CrossRef]
- Giménez-Jaime, A.; Aroca, A.; Raposo, R.; García-Jiménez, J.; Armegol, J. Occurrence of fungal pathogens associated with grapevine nurseries and the decline of young vines in Spain. J. Phytopathol. 2006, 154, 598–602. [Google Scholar] [CrossRef]
- Surico, G. Towards a redefinition of the diseases with the esca complex of grapevine. Phytopathol. Mediterr. 2009, 48, 5–10. [Google Scholar] [CrossRef]
- Mugnai, L.; Graniti, A.; Surico, G. Esca (Black Measles) and Brown Wood-Streaking: Two old and elusive diseases of grapevines. Plant Dis. 1999, 83, 404–418. [Google Scholar] [CrossRef] [PubMed]
- Larignon, P.; Dubos, B. Fungi associated with esca disease in grapevine. Eur. J. Plant Pathol. 1997, 103, 147–157. [Google Scholar] [CrossRef]
- Graniti, A.; Surico, G.; Mugnai, L. Esca of grapevine: A disease complex or a complex of diseases? Phytopathol. Mediterr. 2000, 39, 16–20. [Google Scholar]
- Fourie, P.H.; Halleen, F. Investigation on the occurrence of Phaeomoniella chlamydospora in canes of rootstock mother vines. Australas. Plant Pathol. 2002, 31, 425–426. [Google Scholar] [CrossRef]
- Retief, E.; McLeod, A.; Fourie, P.H. Potential inoculum sources of Phaeomoniella chlamydospora in South African grapevine nurseries. Eur. J. Plant Pathol. 2006, 115, 331–339. [Google Scholar] [CrossRef]
- Bruno, G.; Sparapano, L.; Graniti, A. Effects of three esca-associated fungi on Vitis vinifera L.: IV. Diffusion through the xylem of metabolites produced by two tracheiphilous fungi in the woody tissue of grapevine leads to esca-like symptoms on leaves and berries. Physiol. Mol. Plant Pathol. 2007, 71, 106–124. [Google Scholar] [CrossRef]
- Fontaine, F.; Pinto, C.; Vallet, J.; Clement, C.; Gomes, A.C.; Spagnolo, A. The effects of grapevine trunk diseases (GTDs) on vine physiology. Eur. J. Plant Pathol. 2016, 144, 707–721. [Google Scholar] [CrossRef]
- Luini, E.; Fleurat-Lessard, P.; Rousseau, L.; Roblin, G.; Berjeaud, J.M. Inhibitory effects of polypeptides secreted by the grapevine pathogens Phaeomoniella chlamydospora and Phaeoacremonium aleophilum on plant cell activities. Physiol. Mol. Plant Pathol. 2010, 74, 403–411. [Google Scholar] [CrossRef]
- Sánchez-Amat, A.; Solano, F. A pluripotent polyphenol oxidase from the melanogenic marine Alteromonas sp shares catalytic capabilities of tyrosinases and laccases. Biochem. Biophys. Res. Commun. 1997, 240, 787–792. [Google Scholar] [CrossRef]
- Abou-Mansour, E.; Polier, J.; Pezet, R.; Tabacchi, R. Purification and partial characterisation of a 60 KDa laccase from Fomitiporia mediterranea. Phytopathol. Mediterr. 2009, 48, 447–453. [Google Scholar] [CrossRef]
- Calzarano, F.; Seghetti, L.; Del Carlo, M.; Cichelli, A. Effect of esca on the quality of berries, musts and wines. Phytopathol. Mediterr. 2004, 43, 125–135. [Google Scholar]
- Lorrain, B.; Ky, I.; Pasquier, G.; Jourdes, M.; Dubrana, L.G.; Gény, L.; Rey, P.; Donéche, B.; Teissedre, P.L. Effect of Esca disease on the phenolic and sensory attributes of Cabernet Sauvignon grapes, musts and wines. Aust. J. Grape Wine Res. 2012, 18, 64–72. [Google Scholar] [CrossRef]
- Martin, L.; Fontaine, F.; Castaño, F.J.; Songy, A.; Roda, R.; Vallet, J.; Ferrer-Gallego, R. Specific profile of Tempranillo grapevines related to esca-leaf symptoms and climate conditions. Plant Physiol. Biochem. 2019, 135, 575–587. [Google Scholar] [CrossRef]
- Songy, A.; Fernandez, O.; Clément, C.; Larignon, P.; Fontaine, F. Grapevine trunk diseases under thermal and water stresses. Planta 2019, 249, 1655–1679. [Google Scholar] [CrossRef]
- Calzarano, F.; Pagnani, G.; Pisante, M.; Bellocci, M.; Cillo, G.; Metruccio, E.G.; Di Marco, S. Factors involved on tiger-stripe foliar symptom expression of esca of grapevine. Plants 2021, 10, 1041. [Google Scholar] [CrossRef]
- Wellburn, A.R. The spectral determination of chlorophyll a and chlorophyll b, as well as total carotenoids, using various solvents with spectrophotometers of different resolution. J. Plant Physiol. 1994, 144, 307–313. [Google Scholar] [CrossRef]
- Kim, D.; Jeong, S.W.; Leo, C.Y. Antioxidant capacity of phenolic phytochemicals from various cultivars of plums. Food Chem. 2003, 81, 321–326. [Google Scholar] [CrossRef]
- Oxborough, K.; Baker, N.R. Resolving chlorophyll a fluorescence images of photosynthetic efficiency into photochemical and non-photochemical components-calculation of qP and Fv/Fm; without measuring Fo. Photosynth. Res. 1997, 54, 135–142. [Google Scholar] [CrossRef]
- Madhava Rao, K.V.; Sresty, T.V.S. Antioxidative parameters in the seedling of pigempea (Cajanus cajan L. Milspaugh) in response to Zn and Ni stresses. Plant Sci. 2000, 157, 113–128. [Google Scholar] [CrossRef]
- Fu, J.; Huang, B. Involvement of antioxidants and lipid peroxidation in the adaptation of two cool-season grasses to localized drought stress. Environ. Exp. Bot. 2001, 45, 105–114. [Google Scholar] [CrossRef]
- Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
- Singleton, V.L.; Salgues, M.; Zaya, J.; Troudsale, E. Caftaric acid disappearance and conversion to products of enzymatic oxidation in grape must and wine. Am. J. Enol. Vitic. 1985, 36, 50–56. [Google Scholar]
- Gálvez, M.; Martín-Cordero, C.; Houghton, P.J.; Ayuso, M.J. Antioxidant activity of methanol extracts obtained from Plantago species. J. Agric. Food Chem. 2008, 53, 1927–1933. [Google Scholar] [CrossRef]
- Giusti, M.M.; Wrolstad, R.E. Charecterization and measurement of anthocyanins by UV-visible spectroscopy. Curr. Protoc. Food Anal. Chem. 2001, F1.2.1–F1.2.13. [Google Scholar] [CrossRef]
- MohdMaidin, N.; Oruna-Concha, M.J.; Jauregi, P. Surfactant TWEEN20 provides stabilisation effect on anthocyanins extracted from red grape pomace. Food Chem. 2019, 271, 224–231. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Walker, J.R.L. Polarographic and spectrophotometric assay of diphenol oxidases (Polyphenol Oxidase). Curr. Protoc. Food Anal. Chem. 2001, C4.1.1–C4.1.15. [Google Scholar] [CrossRef]
- Rios, J.J.; Rosales, M.A.; Blasco, B.; Cervilla, L.M.; Romero, L.; Ruiz, J.M. Biofortification of Se and induction of the antioxidant capacity in lettuce plants. Sci. Hortic. 2008, 116, 248–255. [Google Scholar] [CrossRef]
- Benzie, I.F.F.; Strain, J.J. The ferric reducing ability of plasma (FRAP) as a measure of antioxidant power: The FRAP assay. Anal. Biochem. 1996, 239, 70–76. [Google Scholar] [CrossRef] [PubMed]
- De Pinto, M.C.; Francis, D.; De Gara, L. The redox state of ascorbate-dehydroascorbate pair as a specific sensor of cell division in tobacco TBY-2 cells. Protoplasma 1999, 209, 90–97. [Google Scholar] [CrossRef]
- Gamm, M.; Héloir, M.C.; Kelloniemi, J.; Poinssot, B.; Wendehenne, D.; Adrian, M. Identification of reference genes suitable for qRT-PCR in grapevine and application for the study of the expression of genes involved in pterostilbene synthesis. Mol. Genet. Genom. 2011, 285, 273–285. [Google Scholar] [CrossRef]
- Pilati, S.; Perazzolli, M.; Malossini, A.; Cestaro, A.; Demattè, L.; Fontana, P.; Dal Ri, A.; Viola, R.; Velasco, R.; Moser, C. Genome-wide transcriptional analysis of grapevine berry ripening reveals a set of genes similarly modulated during three seasons and the occurrence of an oxidative burst at vèraison. BMC Genom. 2007, 8, 428. [Google Scholar] [CrossRef]
- Joseph, J.T.; Poolakkalody, N.J.; Shah, J.M. Plant reference genes for development and stress response studies. J. Biosci. 2018, 43, 173–187. [Google Scholar] [CrossRef]
- Ortega, A.; de Marcos, A.; Illescas-Miranda, J.; Mena, M.; Fenoll, C. The tomato genome encodes SPCH, MUTE, and FAMA candidates that can replace the endogenous functions of their Arabidopsis orthologs. Front. Plant Sci. 2019, 10, 1300. [Google Scholar] [CrossRef]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef]
- Filimon, V.R.; Rotaru, L.; Filimon, R. Quantitative investigation of leaf photosynthetic pigments during annual biological cycle of Vitis vinifera L. table grape cultivars. S. Afr. J. Enol. Vitic. 2016, 37, 1–14. [Google Scholar] [CrossRef]
- Lisar, S.Y.S.; Motafakkerazad, R.; Hossain, M.M.; Rahman, I.M.M. Water stress in plants: Causes, effects and responses. In Water Stress; Rahman, I.M.M., Hasegawa, H., Eds.; IntechOpen: London, UK, 2012. [Google Scholar] [CrossRef]
- Bertamini, M.; Nedunchezhian, N.; Tomasi, F.; Grando, M.S. Phytoplasma [Stolbur-subgroup (Bois Noir-BN)] infection inhibits photosynthetic pigments, ribulose-1,5-bisphosphate carboxylase and photosynthetic activities in field grown grapevine (Vitis vinifera L. cv. Chardonnay) leaves. Physiol. Mol. Plant Pathol. 2002, 61, 357–366. [Google Scholar] [CrossRef]
- Petit, A.N.; Vaillant, N.; Boulay, M.; Clément, C.; Fontaine, F. Alteration of photosynthesis in grapevines affected by esca. Ecol. Epidemiol. 2006, 96, 1060–1066. [Google Scholar] [CrossRef] [PubMed]
- Rusjan, D.; Halbwirth, H.; Stich, K.; Mikulic-Petkovsek, M.; Veberic, R. Biochemical response of grapevine variety ‘Chardonnay’ (Vitis vinifera L.) to infection with grapevine yellows (Bois noir). Eur. J. Plant Pathol. 2012, 134, 231–237. [Google Scholar] [CrossRef]
- Valtaud, C.; Thibault, F.; Larignon, P.; Bertsch, C.; Fleurat-Lessard, P.; Bourbouloux, A. Systemic damage in leaf metabolism caused by esca infection in grapevines. Aust. J. Grape Wine Res. 2011, 17, 101–110. [Google Scholar] [CrossRef]
- Santos, C.; Fragoeiro, S.; Phillips, A. Physiological response of grapevine cultivars and a rootstock to infection with Phaeoacremonium and Phaeomoniella isolates: An in vitro approach using plants and calluses. Sci. Hortic. 2005, 103, 187–198. [Google Scholar] [CrossRef]
- Quirino, B.F.; Noh, Y.S.; Himelblau, E.; Amasino, R.M. Molecular aspects of leaf senescence. Trends Plant Sci. 2000, 5, 278–282. [Google Scholar] [CrossRef]
- Magnin-Robert, M.; Letousey, P.; Spagnolo, A.; Rabenoelina, F.; Jacquens, L.; Mercier, L.; Clément, C.; Fontaine, F. Leaf stripe form of esca induces alteration of photosynthesis and defence reactions in presymptomatic leaves. Funct. Plant Biol. 2011, 38, 856–866. [Google Scholar] [CrossRef]
- Letousey, P.; Baillieul, F.; Perrot, G.; Rabenoelina, F.; Boulay, M.; Vaillant-Gaveau, N.; Clément, C.; Fontaine, F. Early events prior to visual symptoms in the apoplectic form of grapevine esca disease. Phytopathology 2010, 100, 424–431. [Google Scholar] [CrossRef]
- Zhou, X.; Sun, C.; Zhu, P.; Liu, F. Effects of antimony stress on photosynthesis and growth of Acorus calamus. Front. Plant Sci. 2018, 9, 579. [Google Scholar] [CrossRef]
- Ozden, M.; Demirel, U.; Kahraman, A. Effects of proline on antioxidant system in leaves of grapevine (Vitis vinifera L.) exposed to oxidative stress by H2O2. Sci. Hortic. 2009, 119, 163–168. [Google Scholar] [CrossRef]
- Fabro, G.; Kovacs, I.; Pavet, V.; Szabados, L.; Alvarez, M.E. Proline accumulation and AtP5CS2 gene activation are induced by plant-pathogen incompatible interactions in Arabidopsis. Mol. Plant Microbe Interact. 2004, 17, 343–350. [Google Scholar] [CrossRef] [PubMed]
- Cecchini, N.M.; Monteoliva, M.I.; Alvarez, M.E. Proline dehydrogenase contributes to pathogen defense in Arabidopsis. Plant Physiol. 2011, 155, 1947–1959. [Google Scholar] [CrossRef]
- Yan, Z.; Guo, S.; Shu, S.; Sun, J.; Tezuka, T. Effects of proline on photosyntesis, roots reactive oxygen species (ROS) metabolism in two melon cultivar (Cucumis melo L.) under NaCl stress. Afr. J. Biotechnol. 2011, 10, 18381–18390. [Google Scholar] [CrossRef]
- Baskaran, A.; Muruganandam, A. Enhancing role of proline in scavenging free radicals by antioxidative defence system during stress in black gram and cluster vean. Int. J. Pharm. Sci. Rev. Res. 2017, 43, 211–216. [Google Scholar]
- Naliwajski, M.; Skłodowska, M. The relationship between the antioxidant system and proline metabolism in the leaves of cucumber plants acclimated to salt stress. Cells 2021, 10, 609. [Google Scholar] [CrossRef]
- Lima, M.R.M.; Felgueiras, M.L.; Cunha, A.; Chicau, G.; Ferreres, F.; Dias, A.C.P. Differential phenolic production in leaves of Vitis vinifera cv. Alvarinho affected with esca disease. Plant Physiol. Biochem. 2017, 112, 45–52. [Google Scholar] [CrossRef]
- Carvalho, L.C.; Vidigal, P.; Amâncio, S. Oxidative stress homeostasis in grapevine (Vitis vinifera, L.). Front. Environ. Sci. 2015, 3, 20. [Google Scholar] [CrossRef]
- Christen, D.; Schönmann, S.; Jermini, M.; Strasser, R.J.; Défago, G. Characterization and early detection of grapevine (Vitis vinifera) stress responses to esca disease by in situ chlorophyll fluorescence and comparison with drought stress. Environ. Exp. Bot. 2007, 60, 504–514. [Google Scholar] [CrossRef]
- Atak, A.; Göksel, Z.; Çelik, H. Relations between downy/powdery mildew diseases and some phenolic compounds in Vitis spp. Turk. J. Agric. For. 2017, 41, 69–81. [Google Scholar] [CrossRef]
- Lutz, M.; Jorquera, K.; Cancino, B.; Ruby, R.; Henriquez, C. Phenolics and antioxidant capacity of table grape (Vitis vinifera L.) cultivars grown in Chile. J. Food Sci. 2011, 76, C1088–C1093. [Google Scholar] [CrossRef] [PubMed]
- Spagnolo, A.; Magnin-Robert, M.; Alayi, T.D.; Cilindre, C.; Mercier, L.; Schaeffer-Reis, C.; Van Dorsselaer, A.; Clément, C.; Fontaine, F. Changes in green stems of Vitis vinifera L. cv. Chardonnay in response to esca proper and apoplexy revealed by proteomic and transcriptomic analyses. J. Proteome Res. 2012, 11, 461–475. [Google Scholar] [CrossRef] [PubMed]
- Pasquier, G.; Lapaillerie, D.; Vilain, S.; Dupuy, J.W.; Lomenech, A.M.; Clavero, S.; Gény, L.; Bonneu, M.; Teissedre, P.L.; Donèche, B. Impact of foliar symptoms of “esca proper” on proteins related to defense and oxidative stress of grape skins during ripening. Proteomics 2013, 13, 108–118. [Google Scholar] [CrossRef]
- Bortolami, G.; Gambetta, G.A.; Cassan, C.; Delmas, C.E.L. Grapevines under drought do not express esca leaf symptoms. Proc. Nat. Acad. Sci. USA 2021, 118, e2112825118. [Google Scholar] [CrossRef] [PubMed]
- Kuźniak, E.; Skłodowska, M. Ascorbate, glutathione and related enzymes in chloroplasts of tomato leaves infected by Botrytis cinerea. Plant Sci. 2001, 160, 723–731. [Google Scholar] [CrossRef]
- Sgherri, C.; Ranieri, A.; Quartacci, M.F. Antioxidative responses in Vitis vinifera infected by grapevine fanleaf virus. J. Plant Physiol. 2013, 170, 121–128. [Google Scholar] [CrossRef]
- Bruno, G.; Ippolito, M.P.; Mannerucci, F.; Bragazzi, L.; Tommasi, F. Physiological responses of “Italia” grapevines infected with esca pathogens. Phytopathol. Mediterr. 2021, 60, 321–336. [Google Scholar] [CrossRef]
- Yamasaki, H.; Sakihama, Y.; Ikehara, N. Flavonoid-peroxidase reactions as a detoxification mechanism of plant cells against H2O2. Plant Physiol. 1997, 115, 1405–1412. [Google Scholar] [CrossRef]
- Valtaud, C.; Foyer, C.H.; Fleurat-Lessard, P.; Bourbouloux, A. Systemic effects on leaf glutathione metabolism and defence protein expression caused by esca infection in grapevines. Funct. Plant Biol. 2009, 36, 260–279. [Google Scholar] [CrossRef]
- Løvdal, T.; Lillo, C. Reference gene selection for quantitative real-time PCR normalization in tomato subjected to nitrogen, cold, and light stress. Anal. Biochem. 2009, 387, 238–242. [Google Scholar] [CrossRef] [PubMed]
- Petriccione, M.; Mastrobuoni, F.; Zampella, L.; Scortichini, M. Reference gene selection for normalization of RT-qPCR gene expression data from Actinidia deliciosa leaves infected with Pseudomonas syringae pv. actinidiae. Sci. Rep. 2015, 5, 16961. [Google Scholar] [CrossRef] [PubMed]
- Winkel-Shirley, B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001, 126, 485–493. [Google Scholar] [CrossRef] [PubMed]
- Koes, R.; Verweij, W.; Quattrocchio, F. Flavonoids: A colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 2005, 10, 236–242. [Google Scholar] [CrossRef] [PubMed]
- Grotewold, E. The genetics and biochemistry of floral pigments. Ann. Rev. Plant Biol. 2006, 57, 761–780. [Google Scholar] [CrossRef]
- Lefevere, H.; Bauters, L.; Gheysen, G. Salicylic Acid Biosynthesis in Plants. Front. Plant Sci. 2020, 11, 338. [Google Scholar] [CrossRef]
- Mayer, A.M. Polyphenol oxidases in plants and fungi: Going places? A review. Phytochemistry 2006, 67, 2318–2331. [Google Scholar] [CrossRef]
- Aziz, E.; Batool, R.; Akhtar, W.; Rehman, S.; Gregersen, P.L.; Mahmood, T. Expression analysis of the polyphenol oxidase gene in response to signaling molecules, herbivory and wounding in antisense transgenic tobacco plants. Biotechnology 2019, 9, 55. [Google Scholar] [CrossRef]
- Kaya, E.D.; Bağci, O. Purification and biochemical characterization of polyphenol oxidase extracted from Kirmizi Kismis grape (Vitis vinifera L.). J. Food Biochem. 2020, 45, e13627. [Google Scholar] [CrossRef]
- Thipyapong, P.; Hunt, M.D.; Steffens, J.C. Antisense downregulation of polyphenol oxidase results in enhanced disease susceptibility. Planta 2004, 220, 105–117. [Google Scholar] [CrossRef]
- Lambert, C.; Khiook, I.L.K.; Lucas, S.; Télef-Micoleau, N.; Mérillon, J.-M.; Cluzet, S. A Faster and a stronger defense response: One of the key elements in grapevine explaining its lower level of susceptibility to esca? Phytopathology 2013, 103, 1028–1034. [Google Scholar] [CrossRef]
- Goto-Yamamoto, N.; Wana, G.H.; Masaki, K.; Kobayashi, S. Structure and transcription of three chalcone synthase genes of grapevine (Vitis vinifera). Plant Sci. 2002, 162, 867–872. [Google Scholar]
- Gaiotti, F.; Pastore, C.; Filippetti, I.; Lovat, L.; Belfiore, N.; Tomasi, D. Low night temperature at veraison enhances the accumulation of anthocyanins in Corvina grapes (Vitis vinifera L.). Sci. Rep. 2018, 8, 8719. [Google Scholar] [CrossRef] [PubMed]
- Austin, M.B.; Noel, J.P. The chalcone synthase superfamily of type III polyketide synthases. Nat. Prod. Rep. 2003, 20, 79–110. [Google Scholar] [CrossRef] [PubMed]
Tmax (°C) | Tmin (°C) | Tmedia (°C) | % RHmax | % RHmin | % RH | Radiation (MJ m−2 day−1) | Net Radiation (MJ m−2 day−1) | Rainfall (mm) | |
---|---|---|---|---|---|---|---|---|---|
January | 14.0 | 0.6 | 6.5 | 99.1 | 55.9 | 84.3 | 9.4 | 2.2 | 32.9 |
February | 16.4 | 5.7 | 10.6 | 98.0 | 56.6 | 82.6 | 10.3 | 3.9 | 69.3 |
March | 19.3 | 5.9 | 12.1 | 95.6 | 45.8 | 76.1 | 15.6 | 7.1 | 42.4 |
April | 25.4 | 8.6 | 17.0 | 88.8 | 25.5 | 56.7 | 22.6 | 10.8 | 8.9 |
May | 28.3 | 12.5 | 20.6 | 90.0 | 29.0 | 57.4 | 25.1 | 13.4 | 21.6 |
June | 34.3 | 16.6 | 25.5 | 82.6 | 20.2 | 48.9 | 27.8 | 15.0 | 4.2 |
July | 35.3 | 15.7 | 25.5 | 82.4 | 17.6 | 47.5 | 28.3 | 14.6 | 2.6 |
August | 35.3 | 16.1 | 25.6 | 81.2 | 17.3 | 46.5 | 25.0 | 12.3 | 12.5 |
September | 31.2 | 12.9 | 22.0 | 84.0 | 20.8 | 50.1 | 21.2 | 9.3 | 0 |
October | 29.1 | 10.7 | 19.4 | 89.0 | 27.1 | 58.4 | 15.1 | 5.2 | 16.0 |
November | 19.9 | 4.5 | 11.4 | 96.1 | 37.4 | 72.1 | 10.6 | 2.4 | 36.2 |
December | 14.7 | 2.5 | 7.8 | 98.3 | 55.3 | 84.2 | 8.3 | 1.4 | 37.0 |
Mean annual | 25.3 | 9.4 | 17.0 | 90.4 | 34.0 | 63.7 | 18.3 | 8.1 | 283.6 1 |
Gene | F/R | Sequence 5′-3′ | Gene Information//Accession Number |
---|---|---|---|
SOD | F | CTGCGGGTTGGTGTTCTAAT | Superoxide dismutase, chloroplastic/cytosolic// |
R | TTCCCATATGGTGGTTCCAT | XM_002281814 | |
PAL | F | ACAACAATGGACTGCCATCA | Phenylalanine ammonia lyase// XM_003633939 |
R | GGAGGAGATTAAGCCCAAGG | ||
PPO | F | GGCTTTTCTTCCCTTTCCAC | Polyphenol oxidase, chloroplastic-like// XR_002029618 |
R | ATTACAGTCGGAGGCAGGTG | ||
Actin 1 | F | ACTGCTGAACGGGAAATTGT | Actin 2 (act2) mRNA Actin2-S1// AF369525 |
R | AGTCCTCTTCCAGCCATCT | ||
ChS1 | F | AGCCAGTGAAGCAGGTAGCC | Chalcone synthase 1// AB015872 |
R | GTGATCCGGAAGTAGTAAT | ||
ChS3 | F | GTTTCGGACCAGGGCTCACT | Chalcone synthase 3// AB066274 |
R | GGCAAGTAAAGTGGAAACAG | ||
VATP16 | F | CTTCTCCTGTATGGGAGCTG | V-type proton ATPase 16 kDa proteolipid subunit// XM_002269086 |
R | CCATAACAACTGGTACAATCGAC |
Chl a (µg g−1 FW) | Chl b (µg g−1 FW) | Chl a+b (µg g−1 FW) | Chl a/b | Carotenoids (µg g−1 FW) | Car/Chl | FV/FM | |
---|---|---|---|---|---|---|---|
Healthy June | 1686.9 ± 84.5 a | 844.8 ± 82.3 a | 2531.7 ± 166.9 a | 1.99 ± 0.09 b | 256.5 ± 17.9 a | 0.103 ± 0.010 b | 0.808 ± 0.050 a |
Esca-diseased June | 865.9 ± 46.3 c | 401.9 ± 27.9 c | 1267.7 ± 74.3 c | 2.16 ± 0.03 a | 161.1 ± 3.5 b | 0.128 ± 0.005 a | 0.671 ± 0.062 b |
Healthy August | 956.0 ± 60.1 b | 481.2 ± 24.5 b | 1437.2 ± 83.7 b | 1.99 ± 0.04 b | 119.6 ± 4.6 c | 0.084 ± 0.003 d | 0.781 ± 0.047 a |
Esca-diseased August | 818.4 ± 38.6 c | 399.5 ± 19.8 c | 1217.9 ± 58.4 c | 2.05 ± 0.01 b | 115.2 ± 6.2 c | 0.094 ± 0.001 c | 0.475 ± 0.071 c |
Lipid Peroxidation (µmol MDA g−1 FW) | Proline Content (µg g−1 FW) | |
---|---|---|
Healthy June | 30.94 ± 0.68 b | 36.88 ± 1.95 c |
Esca-diseased June | 28.80 ± 1.60 b | 71.82 ± 0.54 b |
Healthy August | 41.54 ± 3.21 a | 118.15 ± 5.55 a |
Esca-diseased August | 43.19 ± 2.34 a | 111.04 ± 67.71 a |
Lipid Peroxidation (µmol MDA g−1 FW) | Proline Content (µg g−1 FW) | FRAP (µg g−1 FW) | PPO Activity (U mg−1 Protein) | |
Healthy | 75.53 ± 4.73 a | 591.73 ± 41.26 a | 53.04 ± 2.74 a | 26.36 ± 2.41 b |
Esca-diseased | 41.75 ± 1.80 b | 579.50 ± 34.56 a | 27.17 ± 1.45 b | 232.06 ± 32.27 a |
Total Phenols (µg g−1 FW) | Total Flavonoids (µg g−1 FW) | Total PPGs (µg g−1 FW) | Total Anthocyanins (mg g−1 FW) | |
Healthy | 2359.98 ± 11.94 a | 3049.49 ± 217.32 a | 7730.54 ± 182.76 a | 451.02 ± 20.21 a |
Esca-diseased | 1384.87 ± 83.45 b | 2343.33 ± 11.17 b | 5084.38 ± 179.72 b | 422.28 ± 36.10 a |
AsA (µmol g−1 FW) | DHA (µmol g−1 FW) | AsA + DHA (µmol g−1FW) | AsA/DHA | |
Healthy | 1.48 ± 0.09 a | 0.58 ± 0.05 a | 2.06 ± 0.09 a | 2.83 ± 0.32 a |
Esca-diseased | 0.49 ± 0.07 b | 0.42 ± 0.04 b | 0.91 ± 0.09 b | 1.22 ± 0.18 b |
GSH (nmol g−1 FW) | GSSG (µmol g−1 FW) | GSH + GSSG (µmol g−1 FW) | GSH/GSSG | |
Healthy | 12.88 ± 1.18 a | 2.22 ± 0.93 b | 15.04 ± 0.78 b | 11.91 ± 5.46 a |
Esca-diseased | 12.18 ± 1.09 a | 5.33 ± 0.70 a | 17.51 ± 1.44 a | 2.59 ± 0.44 b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
García, J.A.; Garrido, I.; Ortega, A.; del Moral, J.; Llerena, J.L.; Espinosa, F. Physiological and Molecular Responses of Vitis vinifera cv. Tempranillo Affected by Esca Disease. Antioxidants 2022, 11, 1720. https://doi.org/10.3390/antiox11091720
García JA, Garrido I, Ortega A, del Moral J, Llerena JL, Espinosa F. Physiological and Molecular Responses of Vitis vinifera cv. Tempranillo Affected by Esca Disease. Antioxidants. 2022; 11(9):1720. https://doi.org/10.3390/antiox11091720
Chicago/Turabian StyleGarcía, José Antonio, Inmaculada Garrido, Alfonso Ortega, Jerónimo del Moral, José Luis Llerena, and Francisco Espinosa. 2022. "Physiological and Molecular Responses of Vitis vinifera cv. Tempranillo Affected by Esca Disease" Antioxidants 11, no. 9: 1720. https://doi.org/10.3390/antiox11091720