Role of Genetic Thrombophilia Markers in Thrombosis Events in Elderly Patients with COVID-19
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Cohort
2.2. Target Parameters and Risk Factors
2.3. Genetic Analysis
2.4. Statistical Analysis
3. Results
3.1. Initial Characteristics
3.2. Thrombotic Complications
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Favas, T.T.; Dev, P.; Chaurasia, R.N.; Chakravarty, K.; Mishra, R.; Joshi, D.; Mishra, V.N.; Kumar, A.; Singh, V.K.; Pandey, M.; et al. Neurological manifestations of COVID-19: A systematic review and meta-analysis of proportions. Neurol. Sci. 2020, 41, 3437–3470. [Google Scholar] [CrossRef] [PubMed]
- Groff, D.; Sun, A.; Ssentongo, A.E.; Ba, D.M.; Parsons, N.; Poudel, G.R.; Lekoubou, A.; Oh, J.S.; Ericson, J.E.; Ssentongo, P.; et al. Short-term and long-term Rates of Postacute Sequelae of SARS-CoV-2 Infection: A Systematic Review. JAMA Netw. Open 2021, 4, 2128568. [Google Scholar] [CrossRef]
- Castiello, T.; Georgiopoulos, G.; Finocchiaro, G.; Claudia, M.; Gianatti, A.; Delialis, D.; Aimo, A.; Prasad, S. COVID-19 and myocarditis: A systematic review and overview of current challenges. Hear. Fail. Rev. 2022, 27, 251–261. [Google Scholar] [CrossRef] [PubMed]
- Calderon-Lopez, M.T.; Garcia-Leon, N.; Gomez-Arevalillo, S.; Martin-Serrano, P.; Matilla-Garcia, A. Coronavirus disease 2019 and coagulopathy: Other prothrombotic coagulation factors. Blood Coagul. Fibrinolysis 2021, 32, 44–49. [Google Scholar] [CrossRef]
- Cui, S.; Chen, S.; Li, X.; Liu, S.; Wang, F. Prevalence of venous thromboembolism in patients with severe novel coronavirus pneumonia. Thromb. Haemost. 2020, 18, 1421–1424. [Google Scholar] [CrossRef]
- Thachil, J.; Tang, N.; Gando, S.; Falanga, A.; Cattaneo, M.; Levi, M.; Clark, C.; Iba, T. ISTH interim guidance on recognition and management of coagulopathy in COVID-19. Thromb. Haemost. 2020, 18, 1023–1026. [Google Scholar] [CrossRef]
- Wu, C.; Chen, X.; Cai, Y.; Xia, J.; Zhou, X.; Xu, S.; Huang, H.; Zhang, L.; Zhou, X.; Du, C.; et al. Risk factors associated with acute respiratory distress syndrome and death in patients with coronavirus disease 2019 pneumonia in Wuhan, China. JAMA Intern. Med. 2020, 180, 934–943. [Google Scholar] [CrossRef]
- Zhou, F.; Yu, T.; Du, R.; Fan, G.; Liu, Y.; Liu, Z.; Xiang, J.; Wang, Y.; Song, B.; Gu, X.; et al. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: A retrospective cohort study. Lancet 2020, 395, 1054–1062. [Google Scholar] [CrossRef]
- Holst, A.G.; Jensen, G.; Prescott, E. Risk factors for venous thromboembolism results from the Copenhagen City Heart Study. Circulation 2010, 121, 1896–1903. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Zhou, M.; Dong, X.; Qu, J.; Gong, F.; Han, Y.; Qiu, Y.; Wang, J.; Liu, Y.; Wei, Y.; et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: A descriptive study. Lancet 2020, 395, 507–513. [Google Scholar] [CrossRef]
- Saadatnia, M.; Salehi, M.; Movahedian, A.; Shariat, S.Z.S.; Salari, M.; Tajmirriahi, M.; Asadimobarakeh, E.; Salehi, R.; Amini, G.; Ebrahimi, H.; et al. Factor V Leiden, factor V Cambridge, factor II GA20210, and methylenetetetrahydrofolate reductase in cerebral venous and sinus thrombosis: A case-control study. J. Res. Med. Sci. 2015, 20, 554–562. [Google Scholar]
- Dautaj, A.; Krasi, G.; Bushati, V.; Precone, V.; Gheza, M.; Fioretti, F.; Sartori, M.; Costantini, A.; Benedetti, S.; Bertelli, M. Hereditary thrombophilia. Thromb. J. 2006, 4, 1–17. [Google Scholar]
- Russo, P.D.; Damante, G.; Pasca, S.; Turello, M.; Barillari, G. Thrombophilic mutations as a risk factor for retinal vein occlusion: A case-control study. Clin. Appl. Thromb. Hemost. 2015, 21, 373–377. [Google Scholar] [CrossRef]
- D’Andrea, G.; Margaglione, M. Rare Defects: Looking at the Dark Face of the Thrombosis. Int. J. Environ. Res. Public Health 2021, 18, 9146. [Google Scholar] [CrossRef] [PubMed]
- Badulescu, O.V.; Sirbu, P.D.; Filip, N.; Bordeianu, G.; Cojocaru, E.; Budacu, C.C.; Badescu, M.C.; Bararu-Bojan, I.; Veliceasa, B.; Ciocoiu, M. Hereditary Thrombophilia in the Era of COVID-19. Healthcare 2022, 10, 993. [Google Scholar] [CrossRef] [PubMed]
- Manderstedt, E.; Lind-Halldén, C.; Halldén, C.; Elf, J.; Svensson, P.J.; Dahlbäck, B.; Engström, G.; Melander, O.; Baras, A.; Lotta, L.A.; et al. Regeneron Genetics Center. Classic Thrombophilias and Thrombotic Risk Among Middle-Aged and Older Adults: A Population-Based Cohort Study. J. Am. Heart Assoc. 2022, 11, 023018. [Google Scholar] [CrossRef] [PubMed]
- Stevens, S.M.; Woller, S.C.; Bauer, K.A.; Kasthuri, R.; Cushman, M.; Streiff, M.; Lim, W.; Douketis, J.D. Guidance for the evaluation and treatment of hereditary and acquired thrombophilia. J. Thromb. Thrombolysis 2016, 41, 154–164. [Google Scholar] [CrossRef]
- Konstantinides, S.V.; Meyer, G.; Becattini, C.; Bueno, H.; Geersing, G.-J.; Harjola, V.-P.; Huisman, M.V.; Humbert, M.; Jennings, S.C.; Jiménez, D.; et al. ESC Scientific Document Group. 2019 ESC Guidelines for the diagnosis and management of acute pulmonary embolism developed in collaboration with the European Respiratory Society (ERS). Eur. Heart J. 2020, 41, 543–603. [Google Scholar] [CrossRef]
- Ali, E.W.; Ibrahim, I.K. Multi-factorial Mechanism Behind COVID-19. Related Thrombosis. Med. Arch. 2022, 76, 62–65. [Google Scholar] [CrossRef]
- Avci, B.A.; Doğan, M.; Batar, B.; Yildirim, İ.; Serdal, E.; Gezer, S.; Onar, Ç.L.; Akpinar, S.; Turgut, B. Patients with severe coronavirus disease 2019 have high frequency of factor 5 Leiden and prothrombin gene mutations. Blood Coagul. Fibrinolysis 2023, 34, 14–19. [Google Scholar] [CrossRef]
- Stevens, H.; Canovas, R.; Tran, H.; Peter, K.; McFadyen, J.D. Inherited Thrombophilias Are Associated With a Higher Risk of COVID-19-Associated Venous Thromboembolism: A Prospective Population-Based Cohort Study. Circulation 2022, 145, 940–942. [Google Scholar] [CrossRef] [PubMed]
- Morena-Barrio, M.E.; Bravo-Pérez, C.; Morena-Barrio, B.; Orlando, C.; Cifuentes, R.; Padilla, J.; Miñano, A.; Herrero, S.; Marcellini, S.; Revilla, N.; et al. A pilot study on the impact of congenital thrombophilia in COVID-19. Eur. J. Clin. Investig. 2021, 51, 13546. [Google Scholar] [CrossRef]
- Kiraz, K.; Guzeldag, S.; Eren, E.; Goksu, M.; Bayram, A. Investigation of the relationship between inherited thrombophilia and novel coronavirus pneumonia. Future Virol. 2021, 16, 341–345. [Google Scholar] [CrossRef]
- Abdullaev, A.; Fevraleva, I.; Odilov, A.; Volkov, A.; Babichenko, I.; Sudarikov, A. Thrombotic events and the profile of hereditary thrombophilia factors in COVID-19 patients. HemaSphere 2021, 5, 641. [Google Scholar]
- Miesbach, W.; Makris, M. COVID-19: Coagulopathy, Risk of Thrombosis, and the Rationale for Anticoagulation. Clin. Appl. Thromb. Hemost. 2020, 26, 1076029620938149. [Google Scholar] [CrossRef] [PubMed]
- Al-Ani, F.; Chehade, S.; Lazo-Langne, A. Thrombosis risk associated with COVID-19 infection. A scoping review. Thromb. Res. 2020, 192, 152–160. [Google Scholar] [CrossRef] [PubMed]
- Stubbs, M.T.; Bode, W. A player of many parts: The spotlight falls on thrombin’s structure. Thromb. Res. 1993, 69, 1–58. [Google Scholar] [CrossRef]
- Degen, S.J.F.; MacGillivray, R.T.A.; Davie, E.W. Characterization of the complementary deoxyribonucleic acid and gene coding for human prothrombin. Biochemistry 1983, 22, 2087–2097. [Google Scholar] [CrossRef]
- Whinna, H.C.; Church, F.C. Interaction of thrombin with antithrombin, heparin cofactor II, and protein C inhibitor. J. Protein Chem. 1993, 12, 677–688. [Google Scholar] [CrossRef]
- Sun, G.; Jia, Y.; Meng, J.; Ou, M.; Zhu, P.; Cong, S.; Luo, Y.; Sui, W.; Dai, Y. A genetic risk factor for thrombophilia in a Han Chinese family. Mol. Med. Rep. 2017, 15, 1668–1672. [Google Scholar] [CrossRef]
- Ge, X.H.; Zhu, F.; Wang, B.L.; Wang, C.M.; Zhu, B.; Guan, S.; Ci, H.B.; Sai, L.M.; Jiang, X.K.; Ren, H.; et al. Association between prothrombin gene polymorphisms and hereditary thrombophilia in Xinjiang Kazakhs population. Blood Coagul. Fibrinolysis 2014, 25, 114–118. [Google Scholar] [CrossRef] [PubMed]
- D’Ambrosio, R.L.; D’Andrea, G.; Cappucci, F.; Chetta, M.; Perna, P.D.; Brancaccio, V.; Grandone, E.; Margaglione, M. Polymorphisms in factor II and factor VII genes modulate oral anticoagulation with warfarin. Haematologica 2004, 89, 1510–1516. [Google Scholar] [PubMed]
Target Gene | Nucleotide Mutation/ Amino Acid Substitution/ NCBI SNP | Primer/ Probe | Sequence (5′ to 3′) |
---|---|---|---|
FV | G1691A Arg506Gln rs6025 | Forward Reverse w Reverse mt Probe | GACATCGCCTCTGGGCTA CAAGGACAAAATACCTGTATTCCAC CAAGGACAAAATACCTGTATTCCAT (FAM)GCCTGTCCAGGGAT(BHQ1)CTGCTCTTAC |
FII | G20210A -- rs1799963 | Forward Reverse w Reverse mt Probe | TGGAACCAATCCCGTGAAAGAA ACTGGGAGCATTGAGGATC-3 ACTGGGAGCATTGAGGATT (ROX)GAGAGTCACTTTTATTGGGAACCATAG(BHQ2) |
FII | C494T Thr165Met rs5896 | Forward w Forward mt Reverse Probe | ACCCCGACAGCAGCACCTC ACCCCGACAGCAGCACCTT AGCTTACCACAGACAGGGATG (Cy5)GTGCTACACTACAGACCCCACCGTGA(RTQ2) |
MTHFR | C677T Ala222Va rs1801133 | Forward w Forward mt Reverse Probe | GAGAAGGTGTCTGCGGGATC GAGAAGGTGTCTGCGGGATT CATGCCTTCACAAAGCGGAAG (R&G)GATTTCATCATCACGCAGCTTTTCTTTGAGGCTG(BQH2) |
MTHFR | A1298C Glu429Ala rs1801131 | Forward w Forward mt Reverse Probe | GGAGGAGCTGACCAGTGAACA-3’ GAGGAGCTGACCAGTGAACC-3’ GTGACCATTCCGGTTTGGTTCT-3′ (ROX)-GTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAG(BQH2) |
PAI-I | (–675) 5G > 4G -- rs1799889 | Forward w Forward mt Reverse Probe | AGTCTGGACACGTGGGTG AGTCTGGACACGTGGGTA-3’ CAGCCACGTGATTGTCTAGG-3’ (Cy5)AGCCGTGTATCATCGGAGGCGG(BHQ2) |
Gender, n (%) | Average Age, Years | Vaccinated, n (%) | Assessment of the Degree of Lung Damage on CT Scan n (%) | Thrombotic Complications, (%) | Total Thrombosis, n (%) | ||
---|---|---|---|---|---|---|---|
Female 112 (63.7) Male, 64 (36.3) | 73 | 52 (29.6) | CT1 CT2 CT3 CT4 | 51 (30.0) 63 (36.8) 44 (25.0) 18 (10.2) | VTE PE MI ACE | 41 (23.7) 5 (2.9) 2 (1.2) 1 (0.58) | 44 (25.0), of which 5 (11.4) had combined thromboses |
Characteristics of Patients | Thrombosis Happened (44) n (%) | No Thrombosis (132), n (%) | Estimation of Interrelationship Parameters |
---|---|---|---|
Average age | 72 | 72.5 | 0.89 |
Female, n (%) Male, n (%) | 28 (63.6) | 84 (63.6) | OR = 1.0 (CI 95% 0.49–2.03) |
16 (36.4) | 48 (36.4) | p = 1.0 | |
Hospitalization period (days) | 18.5 (4–66) | 11 (3–55) | p = 0.0001 |
ICU, n(%) | 32 (72.73) | 59 (44.7) | OR = 3.29 (CI 95% 1.56–6.96) |
p = 0.0013 | |||
Hospital mortality | 21 (47.73) | 25 (18.94) | OR = 3.87 (CI 95% 1.86–8.07) |
p = 0.0002 |
Target Gene/ Mutation | Genotype | Total | Thrombosis Happened, n (%) | No Thrombosis, n (%) | Estimation of Interrelationship Parameters |
---|---|---|---|---|---|
FV G1691A | no mutation | 168 | 40 (90.9) | 128 (97.0) | p = 0.09 OR = 3.2 (CI 95% 0.76–13.38) |
heterozygote | 8 | 4 (9.1) | 4 (3.0) | ||
FII G20210A | No mutation | 173 | 42 (95.5) | 131(99.2) | p = 0.09 OR = 6.24 (CI 95% 0.55–70.54) |
heterozygote | 3 | 2 (4.5) | 1 (0.8) | ||
FII C494 | no mutation | 121 | 25 (56.8) | 96 (72.7) | p = 0.048 OR = 2.03 (CI 95% 0.99–4.12) |
heterozygote + homozygote | 55 | 19 (43.2) | 36 (27.2) | ||
MTHFR C677T | no mutation + heterozygote | 156 | 38 (86.4) | 118 (89.4) | p = 0.58 OR = 1.33 (CI 95% 0.48–3.70) |
homozygote | 20 | 6 (13.6) | 14 (10.6) | ||
MTHFR A1298C | no mutation + heterozygote | 165 | 7 (4.2) | 125 (95,8) | p = 0.37 OR = 1.79 (CI 95% 0.49–6.42) |
homozygote | 11 | 4 (36.4) | 7 (63.6) | ||
PAI-I (–675) 5G/4G | no mutation + heterozygote | 119 | 28 (63.6) | 91 (68.9) | p = 0.52 OR = 1.26 (CI 95% 0.61–2.60) |
homozygote | 57 | 16 (36.4) | 41 (31.1) |
Absence/Presence of Genetic Risk Factors Being Studied | Thrombosis Happened/n (%) | No Thrombosis, n (%) | Estimation of Interrelationship Parameters |
---|---|---|---|
No genetic risk factors | 16 (36.4) | 72 (54.5) | p = 0.037 OR = 2.10 (CI 95% 1.04–4.24) |
Single or more genetic risk factor | 28 (63.6) | 60(45.5) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fevraleva, I.; Mamchich, D.; Vinogradov, D.; Chabaeva, Y.; Kulikov, S.; Makarik, T.; Margaryan, V.; Manasyan, G.; Novikova, V.; Rachina, S.; et al. Role of Genetic Thrombophilia Markers in Thrombosis Events in Elderly Patients with COVID-19. Genes 2023, 14, 644. https://doi.org/10.3390/genes14030644
Fevraleva I, Mamchich D, Vinogradov D, Chabaeva Y, Kulikov S, Makarik T, Margaryan V, Manasyan G, Novikova V, Rachina S, et al. Role of Genetic Thrombophilia Markers in Thrombosis Events in Elderly Patients with COVID-19. Genes. 2023; 14(3):644. https://doi.org/10.3390/genes14030644
Chicago/Turabian StyleFevraleva, Irina, Daria Mamchich, Dmitriy Vinogradov, Yulia Chabaeva, Sergey Kulikov, Tatiana Makarik, Vahe Margaryan, Georgiy Manasyan, Veronika Novikova, Svetlana Rachina, and et al. 2023. "Role of Genetic Thrombophilia Markers in Thrombosis Events in Elderly Patients with COVID-19" Genes 14, no. 3: 644. https://doi.org/10.3390/genes14030644