Genome-Wide Analysis of WRKY Gene Family and Negative Regulation of GhWRKY25 and GhWRKY33 Reveal Their Role in Whitefly and Drought Stress Tolerance in Cotton
Abstract
:1. Introduction
2. Materials and Methods
2.1. Classification and Characterization of WRKYs
2.2. Construction of TRV-Based Vectors
2.3. Plant Growth Conditions
2.4. Agrobacterium-Based Infiltration
2.5. RNA Isolation and cDNA Synthesis
2.6. Real-Time Quantitative PCR Based Expression Analysis
2.7. Drought Assay
2.8. Whitefly Bioassay
3. Results
3.1. Classification of GhWRKYs through Multiple Sequence Alignment
3.2. Conserved Domain Analyses
3.3. Phylogenetic Relationship
3.4. Promotor Analysis of WRKY25 and WRKY33
3.5. Development of TRV-Based Constructs for GhWRKY25 and GhWRKY33
3.6. VIGS-Based Functional Analysis of GhWRKY25 and GhWRKY33 under Drought Stress and Whitefly Infestation
3.6.1. Downregulation of Targeted Genes
3.6.2. Drought Bioassay
3.6.3. Whitefly Bioassay
3.6.4. Relative Expression of Other Whitefly-Responsive Genes
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, X.-M.; Lövei, G.L.; Ferrante, M.; Yang, N.-W.; Wan, F.-H. The potential of trap and barrier cropping to decrease densities of the whitefly Bemisia tabaci MED on cotton in China. Pest Manag. Sci. 2020, 76, 366–374. [Google Scholar] [CrossRef]
- Chandi, R.S.; Kataria, S.K.; Fand, B.B. Effect of temperature on biological parameters of cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Int. J. Trop. Insect Sci. 2021, 41, 1823–1833. [Google Scholar] [CrossRef]
- Mahmood, M.A.; Naqvi, R.Z.; Siddiqui, H.A.; Amin, I.; Mansoor, S. Current knowledge and implementations of Bemisia tabaci genomic technologies for sustainable control. J. Pest Sci. 2022, 1–14. [Google Scholar] [CrossRef]
- Azhar, M.T.; Rehman, A. Overview on effects of water stress on cotton plants and productivity. In Biochemical, Physiological and Molecular Avenues for Combating Abiotic Stress Tolerance in Plants; Elsevier: Amsterdam, The Netherlands, 2018; pp. 297–316. [Google Scholar]
- Zhu, J.-K. Abiotic stress signaling and responses in plants. Cell 2016, 167, 313–324. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pandey, S.P.; Somssich, I.E. The role of WRKY transcription factors in plant immunity. Plant Physiol. 2009, 150, 1648–1655. [Google Scholar] [CrossRef] [Green Version]
- Chen, F.; Hu, Y.; Vannozzi, A.; Wu, K.; Cai, H.; Qin, Y.; Mullis, A.; Lin, Z.; Zhang, L. The WRKY transcription factor family in model plants and crops. Crit. Rev. Plant Sci. 2017, 36, 311–335. [Google Scholar] [CrossRef]
- Chen, X.; Li, C.; Wang, H.; Guo, Z. WRKY transcription factors: Evolution, binding and action. Phytopathol. Res. 2019, 1, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Cheng, X.; Zhao, Y.; Jiang, Q.; Yang, J.; Zhao, W.; Taylor, I.A.; Peng, Y.-L.; Wang, D.; Liu, J. Structural basis of dimerization and dual W-box DNA recognition by rice WRKY domain. Nucleic Acids Res. 2019, 47, 4308–4318. [Google Scholar] [CrossRef] [Green Version]
- Yamasaki, K.; Kigawa, T.; Watanabe, S.; Inoue, M.; Yamasaki, T.; Seki, M.; Shinozaki, K.; Yokoyama, S. Structural basis for sequence-specific DNA recognition by an Arabidopsis WRKY transcription factor. J. Biol. Chem. 2012, 287, 7683–7691. [Google Scholar] [CrossRef] [Green Version]
- Ciolkowski, I.; Wanke, D.; Birkenbihl, R.P.; Somssich, I.E. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function. Plant Mol. Biol. 2008, 68, 81–92. [Google Scholar] [CrossRef]
- Maeo, K.; Hayashi, S.; Kojima-Suzuki, H.; Morikami, A.; Nakamura, K. Role of conserved residues of the WRKY domain in the DNA-binding of tobacco WRKY family proteins. Biosci. Biotechnol. Biochem. 2001, 65, 2428–2436. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mingyu, Z.; Zhengbin, Z.; Shouyi, C.; Jinsong, Z.; Hongbo, S. WRKY transcription factor superfamily: Structure origin and functions. Afr. J. Biotechnol. 2012, 11, 8051–8059. [Google Scholar]
- Wang, Z.; Zhu, Y.; Wang, L.; Liu, X.; Liu, Y.; Phillips, J.; Deng, X. A WRKY transcription factor participates in dehydration tolerance in Boea hygrometrica by binding to the W-box elements of the galactinol synthase (BhGolS1) promoter. Planta 2009, 230, 1155–1166. [Google Scholar] [CrossRef] [PubMed]
- Rinerson, C.I.; Rabara, R.C.; Tripathi, P.; Shen, Q.J.; Rushton, P.J. The evolution of WRKY transcription factors. BMC Plant Biol. 2015, 15, 1–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, C.; Yuan, J.; Xiang, L. Literature Review of Plant WRKY Transcription Factors. Hans J. Agric. Sci. 2020, 10, 628–633. [Google Scholar]
- Ülker, B.; Somssich, I.E. WRKY transcription factors: From DNA binding towards biological function. Curr. Opin. Plant Biol. 2004, 7, 491–498. [Google Scholar] [CrossRef] [Green Version]
- Sheikh, A.H.; Hussain, R.M.F.; Tabassum, N.; Badmi, R.; Marillonnet, S.; Scheel, D.; Lee, J.; Sinha, A. Possible role of WRKY transcription factors in regulating immunity in Oryza sativa ssp. indica. Physiol. Mol. Plant Pathol. 2021, 114, 101623. [Google Scholar] [CrossRef]
- Wani, S.H.; Anand, S.; Singh, B.; Bohra, A.; Joshi, R. WRKY transcription factors and plant defense responses: Latest discoveries and future prospects. Plant Cell Rep. 2021, 40, 1071–1085. [Google Scholar] [CrossRef]
- Yao, D.-M.; Zou, C.; Shu, Y.-N.; Liu, S.-S. WRKY Transcription Factors in Nicotiana tabacum Modulate Plant Immunity against Whitefly via Interacting with MAPK Cascade Pathways. Insects 2021, 12, 16. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, L. The WRKY transcription factor superfamily: Its origin in eukaryotes and expansion in plants. BMC Evol. Biol. 2005, 5, 1. [Google Scholar] [CrossRef] [Green Version]
- Zhou, L.; Wang, N.-N.; Kong, L.; Gong, S.-Y.; Li, Y.; Li, X.-B. Molecular characterization of 26 cotton WRKY genes that are expressed differentially in tissues and are induced in seedlings under high salinity and osmotic stress. Plant Cell Tissue Organ Cult. (PCTOC) 2014, 119, 141–156. [Google Scholar] [CrossRef]
- Dou, L.; Zhang, X.; Pang, C.; Song, M.; Wei, H.; Fan, S.; Yu, S. Genome-wide analysis of the WRKY gene family in cotton. Mol. Genet. Genom. 2014, 289, 1103–1121. [Google Scholar] [CrossRef]
- Finatto, T.; Viana, V.E.; Woyann, L.G.; Busanello, C.; Maia, L.C.d.; Oliveira, A.C.d. Can WRKY transcription factors help plants to overcome environmental challenges? Genet. Mol. Biol. 2018, 41, 533–544. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rushton, P.J.; Somssich, I.E.; Ringler, P.; Shen, Q.J. WRKY transcription factors. Trends Plant Sci. 2010, 15, 247–258. [Google Scholar] [CrossRef] [PubMed]
- Kanazawa, A.; Inaba, J.-i.; Kasai, M.; Shimura, H.; Masuta, C. RNA-mediated epigenetic modifications of an endogenous gene targeted by a viral vector. Plant Signal. Behav. 2011, 6, 1090–1093. [Google Scholar] [CrossRef] [Green Version]
- Burch-Smith, T.M.; Anderson, J.C.; Martin, G.B.; Dinesh-Kumar, S.P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. Plant J. 2004, 39, 734–746. [Google Scholar] [CrossRef]
- van Kammen, A. Virus-induced gene silencing in infected and transgenic plants. Trends Plant Sci. 1997, 2, 409–411. [Google Scholar] [CrossRef]
- Helliwell, C.A.; Waterhouse, P.M. Constructs and methods for hairpin RNA mediated gene silencing in plants. In Methods in Enzymology; Academic Press: New York, NY, USA, 2005; Volume 392, pp. 24–35. [Google Scholar]
- Liu, X.; Song, Y.; Xing, F.; Wang, N.; Wen, F.; Zhu, C. GhWRKY25, a group I WRKY gene from cotton, confers differential tolerance to abiotic and biotic stresses in transgenic Nicotiana benthamiana. Protoplasma 2016, 253, 1265–1281. [Google Scholar] [CrossRef]
- Wang, N.-N.; Xu, S.-W.; Sun, Y.-L.; Liu, D.; Zhou, L.; Li, Y.; Li, X.-B. The cotton WRKY transcription factor (GhWRKY33) reduces transgenic Arabidopsis resistance to drought stress. Sci. Rep. 2019, 9, 724. [Google Scholar] [CrossRef] [Green Version]
- Jia, S.; Wang, Y.; Zhang, G.; Yan, Z.; Cai, Q. Strawberry FaWRKY25 transcription factor negatively regulated the resistance of strawberry fruits to Botrytis cinerea. Genes 2020, 12, 56. [Google Scholar] [CrossRef]
- Andreasson, E.; Jenkins, T.; Brodersen, P.; Thorgrimsen, S.; Petersen, N.H.; Zhu, S.; Qiu, J.L.; Micheelsen, P.; Rocher, A.; Petersen, M. The MAP kinase substrate MKS1 is a regulator of plant defense responses. EMBO J. 2005, 24, 2579–2589. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Zhu, L.; Hull, J.J.; Liang, S.; Daniell, H.; Jin, S.; Zhang, X. Transcriptome analysis reveals a comprehensive insect resistance response mechanism in cotton to infestation by the phloem feeding insect Bemisia tabaci (whitefly). Plant Biotechnol. J. 2016, 14, 1956–1975. [Google Scholar] [CrossRef]
- Gao, X.; Shan, L. Functional genomic analysis of cotton genes with agrobacterium-mediated virus-induced gene silencing. In Virus-Induced Gene Silencing; Springer: Berlin/Heidelberg, Germany, 2013; pp. 157–165. [Google Scholar]
- Wu, K.-L.; Guo, Z.-J.; Wang, H.-H.; Li, J. The WRKY Family of Transcription Factors in Rice and Arabidopsis and Their Origins. DNA Res. 2005, 12, 9–26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.; Zhang, S. Phosphorylation of 1-aminocyclopropane-1-carboxylic acid synthase by MPK6, a stress-responsive mitogen-activated protein kinase, induces ethylene biosynthesis in Arabidopsis. Plant Cell 2004, 16, 3386–3399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Naalden, D.; van Kleeff, P.J.; Dangol, S.; Mastop, M.; Corkill, R.; Hogenhout, S.A.; Kant, M.R.; Schuurink, R.C. Spotlight on the Roles of Whitefly Effectors in Insect–Plant Interactions. Front. Plant Sci. 2021, 12, 661141. [Google Scholar] [CrossRef]
- Zaidi, S.S.-e.-A.; Naqvi, R.Z.; Asif, M.; Strickler, S.; Shakir, S.; Shafiq, M.; Khan, A.M.; Amin, I.; Mishra, B.; Mukhtar, M.S.; et al. Molecular insight into cotton leaf curl geminivirus disease resistance in cultivated cotton (Gossypium hirsutum). Plant Biotechnol. J. 2020, 18, 691–706. [Google Scholar] [CrossRef] [Green Version]
- Alon, M.; Malka, O.; Eakteiman, G.; Elbaz, M.; Moyal Ben Zvi, M.; Vainstein, A.; Morin, S. Activation of the Phenylpropanoid pathway in Nicotiana tabacum improves the performance of the whitefly Bemisia tabaci via reduced jasmonate signaling. PLoS ONE 2013, 8, e76619. [Google Scholar] [CrossRef]
- Zou, C.; Shu, Y.-N.; Yang, J.-J.; Pan, L.-L.; Zhao, J.; Chen, N.; Liu, S.-S.; Wang, X.-W. Begomovirus-associated betasatellite virulence factor βC1 attenuates tobacco defense to whiteflies via interacting with plant SKP1. Front. Plant Sci. 2020, 11, 574557. [Google Scholar] [CrossRef]
Primers Name | Primer Sequence | Ta °C | Amplicon Size (bp) |
---|---|---|---|
W25-GhV-F | GCCGGAATTCAAACCATGTCGTCTCATTCG | 54 °C | 293 |
W25-GhV-R | GCCTGGTACCAGGGTTCCCTTTCACCACTT | ||
W33-GhV-F | GCCGGAATTCGACATCCTGGGAGCCAAATA | 54 °C | 283 |
W33-GhV-R | 5′-GCCTGGTACCTGACCCTTAGGCCTTTT | ||
MPK6-Gh-F | GCTGAGTTGGGGTTTTTGAATG | 54 °C | 194 |
MPK6-Gh-R | GATGATAGGTAAGGATGAGCTAGTGC | ||
HSP20-Gh-F | TCACATCGTTTCCTTCACTTTCC | 54 °C | 135 |
HSP20-Gh-R | TCACATCGTTTCCTTCACTTTCC | ||
WRKY40-Gh-F | ACCATGCACGCCCTTCTCC | 54 °C | 139 |
WRKY40-Gh-R | CCGTCCCCATACCCCTCTG | ||
ERF1-Gh-F | GCTCAAAAGCTAATAATGAAGGGG | 54 °C | 147 |
ERF1-Gh-R | AGTATCAAAGGTTCCAAGCCAAA | ||
JAZ1-Gh-F | TTATGGTGGACGAGTGATTGTGTT | 54 °C | 131 |
JAZ1-Gh-R | TTGATTGGACTTCTGGCTATGCT |
Function | Motif Name | Motif Sequence | WRKY25 | WRKY33 |
---|---|---|---|---|
Abscisic acid responsiveness | ABRE | ACGTG | 0 | 2 |
A cis-acting regulatory element essential for the anaerobic induction | ARE | AAACCA | 0 | 1 |
Part of a conserved DNA module involved in light responsiveness | ATCT-motif | AATCTAATCC | 0 | 1 |
Common cis-acting elements in promoter and enhancer regions | CAAT-box | CAAT | 21 | 15 |
Cis-acting regulatory element related to meristem expression | CAT-box | GCCACT | 0 | 1 |
Erases cellular memories of developmental age | DRE1 | ACCGAGA | 0 | 1 |
The estrogen-responsive element | ERE | ATTTCATA | 2 | 6 |
Cis-acting regulatory element involved in light responsiveness | G-Box | CACGTT | 2 | |
Light-responsive element | GT1-motif | GGTTAA | 0 | 1 |
Induction of apoptosis | MYC | CATTTG | 1 | 2 |
Regulator of responses | Myb | TAACTG | 1 | 0 |
The binding site for transcription factors to regulate cellular responses | STRE | AGGGG | 2 | 2 |
Core promoter element around −30 of transcription start | TATA-Box | TATA | 29 | 33 |
Gibberellin-responsive element | P-Box | CCTTTTG | 2 | 0 |
Cis-acting element involved in salicylic acid responsiveness | TCA-element | CCATCTTTTT | 0 | 1 |
WRKY TFs bind to regulate gene expression under different stress conditions | W-box | TTGACC | 0 | 2 |
Part of a conserved DNA module involved in light responsiveness | Box-4 | ATTAAT | 3 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ehsan, A.; Naqvi, R.Z.; Azhar, M.; Awan, M.J.A.; Amin, I.; Mansoor, S.; Asif, M. Genome-Wide Analysis of WRKY Gene Family and Negative Regulation of GhWRKY25 and GhWRKY33 Reveal Their Role in Whitefly and Drought Stress Tolerance in Cotton. Genes 2023, 14, 171. https://doi.org/10.3390/genes14010171
Ehsan A, Naqvi RZ, Azhar M, Awan MJA, Amin I, Mansoor S, Asif M. Genome-Wide Analysis of WRKY Gene Family and Negative Regulation of GhWRKY25 and GhWRKY33 Reveal Their Role in Whitefly and Drought Stress Tolerance in Cotton. Genes. 2023; 14(1):171. https://doi.org/10.3390/genes14010171
Chicago/Turabian StyleEhsan, Aiman, Rubab Zahra Naqvi, Maryam Azhar, Muhammad Jawad Akbar Awan, Imran Amin, Shahid Mansoor, and Muhammad Asif. 2023. "Genome-Wide Analysis of WRKY Gene Family and Negative Regulation of GhWRKY25 and GhWRKY33 Reveal Their Role in Whitefly and Drought Stress Tolerance in Cotton" Genes 14, no. 1: 171. https://doi.org/10.3390/genes14010171