Next Article in Journal
Elevated ETV6 Expression in Glioma Promotes an Aggressive In Vitro Phenotype Associated with Shorter Patient Survival
Previous Article in Journal
Hereditary Metabolic Bone Diseases: A Review of Pathogenesis, Diagnosis and Management
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 13
Issue 10
10.3390/genes13101881
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Complete Mitochondrial Genomes and Phylogenetic Positions of Two Longicorn Beetles, Anoplophora glabripennis and Demonax pseudonotabilis (Coleoptera: Cerambycidae)

by
De-Qiang Pu
1,*,
Hong-Ling Liu
1,
Xing-Long Wu
1 and
Zhi-Teng Chen
2
1
Key Laboratory of Integrated Pest Management of Southwest Crops, Institute of Plant Protection, Sichuan Academy of Agricultural Sciences, Chengdu 610066, China
2
School of Grain Science and Technology, Jiangsu University of Science and Technology, Zhenjiang 212004, China
*
Author to whom correspondence should be addressed.
Genes 2022, 13(10), 1881; https://doi.org/10.3390/genes13101881
Submission received: 5 September 2022 / Revised: 15 October 2022 / Accepted: 16 October 2022 / Published: 17 October 2022
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
Anoplophora glabripennis (Motschulsky, 1854) and Demonax pseudonotabilis Gressitt & Rondon, 1970 are two commonly found longicorn beetles from China. However, the lack of sufficient molecular data hinders the understanding of their evolution and phylogenetic relationships with other species of Cerambycidae. This study sequenced and assembled the complete mitochondrial genomes of the two species using the next-generation sequencing method. The mitogenomes of A. glabripennis and D. pseudonotabilis are 15,622 bp and 15,527 bp in length, respectively. The mitochondrial gene content and gene order of A. glabripennis and D. pseudonotabilis are highly conserved with other sequenced longicorn beetles. The calculation of nonsynonymous (Ka) and synonymous (Ks) substitution rates in PCGs indicated the existence of purifying selection in the two longicorn beetles. The phylogenetic analysis was conducted using the protein-coding gene sequences from available mitogenomes of Cerambycidae. The two species sequenced in this study are, respectively, grouped with their relatives from the same subfamily. The monophyly of Cerambycinae, Dorcasominae, Lamiinae, and Necydalinae was well-supported, whereas Lepturinae, Prioninae, and Spondylidinae were recovered as paraphyletic.

1. Introduction

Cerambycidae (longicorn beetle) is one of the most speciose families of Coleoptera, comprising over 4000 genera and 35,000 species worldwide [1,2,3]. Cerambycidae sensu stricto (s.s.) usually consists of the eight subfamilies: Cerambycinae, Dorcasominae, Lamiinae, Lepturinae, Necydalinae, Parandrinae, Prioninae, and Spondylidinae [4]. Cerambycidae sensu lato (s.l.) comprises Cerambycidae s.s., Disteniidae, Oxypeltidae, and Vesperidae [5]. The adults of longicorn beetles are morphologically diverse and phytophagous, usually feeding on living plant tissue, pollen, fruit, or tree sap [6]. Larvae of longicorn beetles usually have reduced or sometimes absent legs and they are mostly internal borers of their host plants [7,8,9,10]. In cultivated ecosystems, e.g., forest farms and tea gardens, the longicorn beetles are nonnegligible pests causing significant economic damage to the host plants [11,12].
The phylogeny and early evolution of Cerambycidae have been comprehensively reviewed by Haddad & Mckenna (2016) [13]. The phylogeny of longicorn beetles, especially the monophyly of Cerambycidae s.s. and s.l., as well as the subfamily and tribe-level relationship, remains debatable due to the high species richness and highly variable morphological characters [5,14,15]. Haddad et al. (2018) [5] reconstructed the higher-level phylogeny of Cerambycidae with anchored hybrid enrichment of nuclear genes. Their results recovered a monophyletic Cerambycidae s.s. in most analyses and a polyphyletic Cerambycidae s.l. as well as the monophyletic subfamilies of Cerambycidae s.s. except for the paraphyletic Cerambycinae [5]. Nie et al. (2020) [15] used 151 mitochondrial genomes (mitogenomes) representing all families of Chrysomeloidea and all subfamilies of Cerambycidae s.s. to explore the higher-level phylogeny of Chrysomeloidea, especially Cerambycidae and allied families. However, their study could not support the monophyly of Cerambycidae s.s. and all its subfamilies. The two subfamilies, Necydalinae and Parandrinae, were considered as tribes Necydalini and Parandrini, respectively [15]. Meanwhile, the mitogenomes of many important cerambycid clades remained poorly represented, which restricted the accuracy of the results.
The mitogenome is an informative molecular marker for taxonomic and evolutionary research and has become one of the most popular molecules used in current insect phylogenetic studies [16]. The development of next-generation sequencing techniques largely reduced the expense and experimental period to efficiently obtain the mitogenomes from all kinds of organisms. Diverse insect orders, such as Coleoptera [17,18], Lepidoptera [19], Hemiptera [20], etc., have combined the mitogenomes with dense taxon sampling to generate large-scale phylogenomic datasets for phylogenetic reconstruction and have revealed the strengths of mitogenomes in resolving the higher-level phylogenetic relationships. However, the available number of mitogenomes of Cerambycidae s.l. in the NCBI database is out of proportion to the remarkable species richness of longicorn beetles, which is a major impediment to better understanding the classification and evolution of this ecologically and economically significant group of insects.
To provide more genetic data for the longicorn beetles and investigate their phylogenetic relationships, this study sequenced and analyzed the mitogenomes of two commonly found longicorn beetles from China, A. glabripennis and D. pseudonotabilis [21,22]. Although the mitogenome of A. glabripennis (NC_008221) has been sequenced in a previous study [23], it is still very important to sequence more mitogenomes for the same species already listed in GenBank considering the existence of intraspecific variation of mitogenomes between different geographic populations [24]. Phylogenetic trees of Cerambycidae s.l. is constructed based on the newly sequenced as well as the known mitogenomic data to investigate the phylogenetic positions of the two newly sequenced species and provide more information for resolving the relationships within Cerambycidae s.l.

2. Materials and Methods

2.1. Sample Collection, DNA Extraction, and Mitogenome Sequencing

Adult specimens of A. glabripennis and D. pseudonotabilis were collected by Malaise traps set in the tea garden of Hongyan Town (29°59′31.42″ N, 103°10′34.45″ E), Mingshan County, Ya’an City, Sichuan Province of China, in 2016. The specimens were identified based on the morphological characteristics under a light microscope and were deposited in Sichuan Academy of Agricultural Sciences (specimen voucher: SAASCO1 (A. glabripennis) and SAASCO2 (D. pseudonotabilis)). All experiments and procedures for this study complied with the current animal ethics guidelines and did not involve any protected animals.
The total genomic DNA was extracted by E.Z.N.A. Tissue DNA Kit (Omega, Norcross, GA, USA). At least 1 µg of purified DNA was used to construct the TruSeq DNA library with an insert size of 400 bp according to standard protocols. The library was sequenced using the Illumina HiSeq 4000 platform (Personal Gene Technology Co., Ltd., Nanjing, China) with paired-end reads of 2 × 150 bp. A total of 21,616,708 and 22,096,010 raw reads were obtained for A. glabripennis and D. pseudonotabilis, respectively. Over 97.8% of bases in the raw reads were regarded as correctly identified with an accuracy rate above 99%. The unpaired, short, and low-quality raw reads were filtered by fastp [25] to obtain clean reads. The above quality-control and data-filtering process generated 21,584,444 and 22,059,322 high-quality reads for A. glabripennis and D. pseudonotabilis, respectively.

2.2. Mitogenome Assembly, Annotation, and Analyses

Before the assembly, the high-quality reads were trimmed again using BBDuk with default settings implemented in Geneious Prime [26]. The high-quality reads of A. glabripennis and D. pseudonotabilis were, respectively, mapped to the reference mitogenome of the previously sequenced A. glabripennis (NC_008221) [23] and amplified bilaterally by Geneious Prime [26], with the parameters set as follows: 95% minimum overlap identity, 50 bp minimum overlap, and maximum ambiguity as 4. The completeness of each circular mitogenome was confirmed when both ends of the final assembled contigs overlapped (100% coverage). The assembled mitogenomes of A. glabripennis and D. pseudonotabilis were deposited in GenBank under the accession numbers OP096420 and OP096419, respectively.
The two mitogenomes were annotated in the MITOS web server [27]. The resultant gene boundaries of the protein-coding genes (PCGs) were checked manually by the NCBI’s ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/, accessed on 9 August 2022). The location and secondary structures of the transfer RNA (tRNA) and ribosomal RNA (rRNA) genes were predicted and visualized by MITOS. The mitogenome structure and GC skews were visualized by the CGView Server [28]. The nucleotide composition, skews, codon usage, and relative synonymous codon usage (RSCU) were calculated by MEGA11 [29]. The synonymous substitution rate (Ks) and nonsynonymous substitution rate (Ka) were calculated using KaKs_Calculator v2.0, with the mitogenome of Aoria nigripes (Baly, 1860) (Chrysomelidae) as the outgroup [30,31]. The alignment file of each PCG was uploaded to the Datamonkey web server for a more thorough exploration of selective pressure in PCGs of the two newly sequenced mitogenomes. BUSTED (Branch-Site Unrestricted Statistical Test for Episodic Diversification) was used to test whether each PCG has experienced positive selection [32]. FEL (fixed-effects likelihood) was employed to infer site-specific Ks and Ka values and detect the following four types of sites in each PCG: diversifying sites, purifying sites, neutral sites, and invariable sites [33]. Tandem repeats in the control regions were identified using the Tandem Repeats Finder web server [34]. The stem-loop structures in the control region were predicted by the Mfold web server with default settings [35].

2.3. Phylogenetic Analyses Methods

The phylogenetic relationships were reconstructed based on the nucleotide sequences of 13 PCGs derived from 186 mitogenomes of Cerambycidae s.l. (Table 1). Overall, 30 of the 186 mitogenomes were originally unannotated in GenBank; they were re-annotated by MITOS and manual homology alignments in this study. Other mitogenomes from GenBank that had incomplete set of 13 PCGs or incorrect PCG sequences were omitted from the dataset. The mitogenome of A. nigripes (Chrysomelidae) was used as the outgroup [31]. The 13 PCGs were, respectively, aligned using MUSCLE with a codon mode [36], followed by the deletion of stop codons and the concatenation of sequences by SequenceMatrix v1.7.8 [37]. The best-fit partitioning schemes and substitution models for each PCG region were determined by PartitionFinder v2.1.1 using the Bayesian information criterion (BIC) and a greedy search algorithm of all available models [38]. Phylogenies were inferred using maximum-likelihood (ML) and Bayesian inference (BI) methods. The best-fit model was GTR+I+G for two partitioned subsets: one subset included ND1, ND4, ND4L, and ND5; the other subset included the remaining 9 PCGs. IQ-Tree was used to perform the ML analysis under the edge-unlinked partition model for 5000 ultrafast bootstraps as well as the Shimodaira–Hasegawa-like approximate likelihood-ratio test [39,40,41]. The BI analysis was conducted by MrBayes v3.2.7 [42] with four independent Markov chains for 30 million generations and sampled every 100 generations. The first 25% of the trees were discarded as burn-in. FigTree v1.4.4 was used to edit and visualize the phylogenetic trees [43].

3. Results and Discussion

3.1. Genome Structure and Composition

The assembled complete mitogenomes of A. glabripennis and D. pseudonotabilis are circular DNA molecules of 15,622 bp and 15,527 bp in length (Figure 1), respectively, which is within the range of the sequenced mitogenomes of Cerambycidae in GenBank (Table 1). Due to the presence of a shorter COX1 gene, the newly obtained A. glabripennis mitogenome is slightly shorter than the previously sequenced mitogenome (15,774 bp) based on samples from Hebei Province [31]. Both newly sequenced mitogenomes contain the standard set of 37 mitochondrial genes (13 PCGs, 22 tRNA genes, and 2 rRNA genes) as all other longicorn beetles. The gene order is identical to all other species of Cerambycidae as well as the ancestral mitogenome type of Drosophila yakuba Burla, 1954 [14,44,45]. Among the 37 genes, 23 (9 PCGs and 14 tRNAs) genes are on the majority strand (J-strand), while the remaining 4 PCGs, 8 tRNAs, and 2 rRNA genes are on the minority strand (N-strand).
A total of nine gene overlapping regions were found in the A. glabripennis mitogenome with a total of 29 bp in length, and the longest overlapping sequence (8 bp) was located between trnCys and trnTyr. In the D. pseudonotabilis mitogenome, there are 12 overlapping regions with a total of 21 bp in length, and the longest overlapping sequences were only 4 bp in length. The universally found 7 bp overlapping regions between ATP8 and ATP6, as well as NAD4 and NAD4L in Cerambycidae and many other insects [14,15], are restricted to the overlapping between NAD4 and NAD4L in the A. glabripennis mitogenome, which might be resulted from the different annotation methods. In addition to the overlapping regions, multiple intergenic spacers are scattered throughout both mitogenomes (Table 2 and Table 3). The base composition is 38.8% A, 14.2% C, 9.2% G, and 37.8% T for the A. glabripennis mitogenome and 39.7% A, 14.5% C, 10.5% G, and 35.3% T for D. pseudonotabilis. The two mitogenomes are highly skewed towards A and T nucleotides, with an A + T content of 76.6% in A. glabripennis and 75.0% in D. pseudonotabilis (Table 1).

3.2. Protein-Coding Genes

The PCGs have identical arrangement and similar size between the two mitogenomes and also other cerambycids. Most PCGs of the two species start with the standard ATN start codons (ATA, ATC, ATG, and ATT), whereas ND1 of both mitogenomes begins with the special codon TTG (Table 2 and Table 3), which was similar to all other published Cerambycidae mitogenomes [14,15]. Most PCGs of each mitogenome have the complete termination codon TAN (TAA, TAT, or TAG), whereas four PCGs (COX1, COX2, ND4, and ND5) of A. glabripennis and four PCGs (COX1, COX3, ND3, and ND5) of D. pseudonotabilis end with an incomplete stop codon T. These incomplete stop codons are considered to be caused by the post-transcriptional polyadenylation [46] and can be completed by the addition of 3′ nucleotide residues to the neighboring mitochondrial genes.
The relative synonymous codon usage (RSCU) values indicate the most frequently used codon is TTA (Leu) for both mitogenomes (Figure 2), which appears to be a common feature of other sequenced longicorn beetles [14]. ATP8 of both mitogenomes has the highest A + T content among the 13 PCGs (Table 2 and Table 3). The Ka/Ks ratios for each PCG of each mitogenome are calculated to assess the selective pressure of the two cerambycid species (Figure 3A). The evolutionary rate of ND6 was the highest among the 13 PCGs. The Ka/Ks ratios of all the 13 PCGs calculated by KaKs_Calculator v2.0 were below 1, which suggests the existence of purifying selection in the two species (Figure 3A). The results of Ka/Ks calculation were similar to a recent mitogenomic work [47], which used DnaSP for the calculation. The gene-wide BUSTED analysis based on the likelihood-ratio test found no evidence of episodic diversifying selection in the PCGs. The site-specific FEL analysis detected ND4 and ND4L each had one codon site under diversifying positive selection at p ≤ 0.1 (Figure 3B). Nearly one-third of each PCG’s codon sites were under purifying selection at p ≤ 0.1. The calculation of KaKs_Calculator v2.0 was consistent with the results of FEL analysis that the PCGs with lower Ka/Ks ratios tended to have more purifying codon sites (Figure 3).

3.3. Transfer RNAs, Ribosomal RNAs, and Control Region

The two mitogenomes both contain the complete set of 22 tRNA genes typical of metazoan mitogenomes. These tRNAs range in size from 62 to 69 bp, which was consistent with previously sequenced mitogenomes of Cerambycidae [15]. The highest A + T content is found in trnGlu of both mitogenomes (Table 2 and Table 3). Most of the tRNAs have typical cloverleaf secondary structures, whereas the dihydrouridine (DHU) arm of trnSer1 is shortened in both mitogenomes (Figure 4), which is a common phenomenon in hexapods and metazoan mitogenomes [48]. Numerous mismatched base pairs are found in the secondary structures of tRNA genes, and all of them are G–U pairs.
The large ribosomal RNA (rrnL) gene and small ribosomal RNA (rrnS) gene are found in the conserved location between trnLeu1 and the control region (Table 2 and Table 3). The rrnL gene is 1272 bp long in A. glabripennis and 1266 bp long in D. pseudonotabilis, with an A + T content of 80.1% and 78.8%, respectively. The rrnS gene is 779 bp long in A. glabripennis and 774 bp long in D. pseudonotabilis, with an A + T content of 78.6% and 76.5%, respectively.
The control region (CR) is the longest non-coding area in the two mitogenomes (Figure 1) and is functional in the regulation, transcription, and replication processes of the mitogenomes [49]. The CR of A. glabripennis is 1104 bp long and has an A + T content of 79.3%; the CR of D. pseudonotabilis is 907 bp long and has an A + T content of 82.1% (Table 2 and Table 3). In the CR of A. glabripennis, 5.2 copies of 57 bp long tandem repeat “AAAATTTCATCAGCTAGCTCCGCTATATAAAATCGCCTACCTTTCAAATTTCCCCTA” are detected near the 5′ end of this region. A total of 22 standard (single stem with single loop) and another 7 more complicated stem-loop structures are predicted in the CR of A. glabripennis (Figure S1). There are 17 standard and 4 complicated stem-loop structures in the CR of D. pseudonotabilis (Figure S2). However, no tandem repeats are found in the CR of D. pseudonotabilis. Functions of these secondary structures are unclear.

3.4. Phylogenetic Analyses

The phylogenetic positions of A. glabripennis and D. pseudonotabilis are reconstructed based on the combined mitochondrial gene set of 13 PCGs. The ML and BI analyses generated similar tree topology (Figure 5 and Figure S3). The phylogenetic results are largely congruent with the recent comprehensive mitogenomic phylogenetic study of Nie et al. (2020) [15]. The monophyly of Cerambycidae s.s. is not well-supported in both ML and BI trees due to the inclusion of other families of Chrysomeloidea (Figure 5), which is similar to the results of Haddad et al. (2018) [5] and Nie et al. (2020) [15]. The positions of Disteniidae and Oxypeltidae are variable, and Oxypeltidae is recovered as the sister group to all other taxa in the BI tree (Figure S3). The phylogenetic position of Disteniidae remains uncertain, and this family has been recovered as the sister group to various other members of Cerambycidae s.l. based on either molecular or morphological datasets [5,9,15,50,51,52,53,54,55,56,57]. The monophyly of Cerambycidae s.s. is still one of the most debatable subjects in the phylogeny and evolution of Chrysomeloidea [5].
The monophyly of Cerambycinae, Dorcasominae, Lamiinae, and Necydalinae is well-supported in both ML and BI analyses (Figure 5 and Figure S3). The subfamily Parandrinae is placed within Prioninae and should be treated as a tribe of Prioninae, as suggested in previous studies [15,58]. Similarly, Necydalinae is nested in Lepturinae and should be regarded as a tribe of Lepturinae [15,50]. Spondylidinae is rendered paraphyletic by the species of Vesperidae, which differs from the monophyletic condition in Haddad et al. (2018) [5] and Nie et al. (2020) [15]. The non-monophyletic condition of Vesperidae has also been recovered based on morphological and molecular characters [54,55,59,60,61]. The two species sequenced in this study are, respectively, grouped with their relatives from the same subfamily.
Although numerous contributions have been made to explore the higher-level phylogeny of longhorn beetles, there are still some debatable points to be solved: the monophyly of Cerambycidae s.l. and s.s.; the relative relationship between Cerambycidae s.s., Disteniidae, Oxypeltidae, and Vesperidae; and the monophyly and relationship of subfamilies in Cerambycidae s.l., especially within Cerambycidae s.s. The incongruence between different molecular phylogenetic studies could be attributed to the usage of different molecular types, sample sizes, and analytical methods. The taxonomic misidentification of sequenced samples in online databases such as GenBank could also lead to bizarre tree topology, especially for those clades with few taxa. Most main clades of Cerambycidae s.l. still lack sufficient molecular data to clarify their phylogenetic positions. The sequencing of more mitogenomes, optimization of datasets and substitution models, and the supplement of nuclear genes are expected to improve the resolution of mitochondrial phylogenetic reconstruction of Cerambycidae s.l. in future works.

4. Conclusions

In this study, we sequenced and analyzed the mitogenomes of two longicorn beetles, which are important pests of cultivated ecosystems in China. The structure and content of the two mitogenomes are conserved in comparison to other sequenced mitogenomes of Cerambycidae, but the intraspecific mitogenomic variation is also detected. The monophyly of four subfamilies was supported by the phylogenetic analysis based on the nucleotide sequence of PCGs. The results provided basic genetic information for understanding the phylogeny and evolution of longicorn beetles.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes13101881/s1, Figure S1: Predicted stem-loop structures in the control region of A. glabripennis; Figure S2: Predicted stem-loop structures in the control region of D. pseudonotabilis; Figure S3: Bayesian inference phylogeny of Cerambycidae s.l. inferred from mitogenomic data. Numbers at the nodes are posterior probabilities.

Author Contributions

Conceptualization and original draft, D.-Q.P.; data curation and methodology, H.-L.L. and X.-L.W.; writing—review and editing, Z.-T.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Frontier Discipline Fund of Sichuan Academy of Agricultural Sciences (grant number 2019QYXK032) and Sichuan Tea Innovation Team of National Modern Agricultural Industry Technology System (grant number sccxtd-2020-10).

Institutional Review Board Statement

No special permits were required to retrieve and process the samples because the study did not involve any live vertebrates or regulated invertebrates.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in NCBI GenBank (Accession numbers: OP096420 and OP096419).

Acknowledgments

We are grateful to the editor and reviewers for their helpful comments.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Svacha, P.; Wang, J.J.; Chen, S.C. Larval morphology and biology of Philus antennatus and Heterophilus punctulatus, and systematic position of the Philinae (Coleoptera: Cerambycidae and Vesperidae). Ann. Soc. Entomol. Fr. 1997, 33, 323–369. [Google Scholar]
  2. Sama, G.; Buse, J.; Orbach, E.; Friedman, A.; Rittner, O.; Chikatunov, V. A new catalogue of the Cerambycidae (Coleoptera) of Israel with notes on their distribution and host plants. Munis Entomol. Zool. 2010, 5, 1–55. [Google Scholar] [CrossRef]
  3. Tavakilian, G.L.; Chevillotte, H. Titan: Base de Données Internationales sur les Cerambycidae ou Longicornes. Version 4.0. Available online: http://titan.gbif.fr (accessed on 1 August 2022).
  4. Svacha, P.; Lawrence, J.F. 2.1. Vesperidae Mulsant, 1839; 2.2 Oxypeltidae Lacordaire, 1868; 2.3 Disteniidae J. Thomson, 1861; 2.4 Cerambycidae Latreille, 1802. Handbook of Zoology, Band 4: Arthropoda: Insecta, Teilband/part 40 Coleoptera, Beetles. In Vol. 3: Morphology and Systematics (Phytophaga); Leschen, R.A.B., Beutel, R.G., Eds.; Walter de Gruyter: Berlin, Germany, 2014; pp. 16–177. [Google Scholar]
  5. Haddad, S.; Shin, S.; Lemmon, A.R.; Lemmon, E.M.; Svacha, P.; Farrell, B.; Ślipiński, A.; Windsor, D.; McKenna, D.D. Anchored hybrid enrichment provides new insights into the phylogeny and evolution of longhorned beetles (Cerambycidae). Syst. Entomol. 2018, 43, 68–89. [Google Scholar] [CrossRef]
  6. Monné, M.L.; Monné, M.A.; Mermudes, J.R.M. Inventário das espécies de Cerambycinae (Insecta, Coleoptera, Cerambycidae) do Parque Nacional do Itatiaia, RJ, Brasil. Biota Neotrop. 2009, 9, 283–312. [Google Scholar] [CrossRef] [Green Version]
  7. Cherepanov, A.I. Cerambycidae of Northern Asia (Prioninae, Disteniinae, Lepturinae, Aseminae); Nauka: Novosibirsk, Russia, 1979. [Google Scholar]
  8. Švácha, P.; Danilevsky, M.L. Cerambycoid larvae of Europe and Soviet Union (Coleoptera, Cerambycidae). Part I. Acta Univ. Carol. Biol. 1986, 30, 1–176. [Google Scholar]
  9. Švácha, P.; Danilevsky, M.L. Cerambycoid larvae of Europe and Soviet Union (Coleoptera, Cerambycidae). Part II. Acta Univ. Carol. Biol. 1987, 31, 121–284. [Google Scholar]
  10. Švácha, P.; Danilevsky, M.L. Cerambycoid larvae of Europe and Soviet Union (Coleoptera, Cerambycidae). Part III. Acta Univ. Carol. Biol. 1988, 32, 1–205. [Google Scholar]
  11. Linsley, E.G. Ecology of Cerambycidae. Annu. Rev. Entomol. 1959, 4, 99–138. [Google Scholar] [CrossRef]
  12. Nowak, D.J.; Pasek, J.E.; Sequeira, R.A.; Crane, D.E.; Mastro, V.C. Potential effect of Anoplophora glabripennis (Coleoptera: Cerambycidae) on urban trees in the United States. J. Econ. Entomol. 2001, 94, 116–122. [Google Scholar] [CrossRef]
  13. Haddad, S.; Mckenna, D.D. Phylogeny and evolution of the superfamily Chrysomeloidea (Coleoptera: Cucujiformia). Syst. Entomol. 2016, 41, 697–716. [Google Scholar] [CrossRef]
  14. Wang, J.; Dai, X.Y.; Xu, X.D.; Zhang, Z.Y.; Yu, D.N.; Storey, K.B.; Zhang, J.Y. The complete mitochondrial genomes of five longicorn beetles (Coleoptera: Cerambycidae) and phylogenetic relationships within Cerambycidae. PeerJ 2019, 7, e7633. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Nie, R.; Vogler, A.P.; Yang, X.K.; Lin, M. Higher-level phylogeny of longhorn beetles (Coleoptera: Chrysomeloidea) inferred from mitochondrial genomes. Syst. Entomol. 2021, 46, 56–70. [Google Scholar] [CrossRef]
  16. Cameron, S.L. Insect mitochondrial genomics: Implications for evolution and phylogeny. Annu. Rev. Entomol. 2014, 59, 95–117. [Google Scholar] [CrossRef] [Green Version]
  17. Timmermans, M.J.; Barton, C.; Haran, J.; Ahrens, D.; Culverwell, C.L.; Ollikainen, A.; Dodsworth, S.; Foster, P.G.; Bocak, L.; Vogler, A.P. Family-level sampling of mitochondrial genomes in Coleoptera: Compositional heterogeneity and phylogenetics. Genome Biol. Evol. 2016, 8, 161–175. [Google Scholar] [CrossRef] [PubMed]
  18. Linard, B.; Crampton-Platt, A.; Moriniere, J.; Timmermans, M.J.; Andújar, C.; Arribas, P.; Miller, K.E.; Lipecki, J.; Favreau, E.; Hunter, A.; et al. The contribution of mitochondrial metagenomics to large-scale data mining and phylogenetic analysis of Coleoptera. Mol. Phylogenet. Evol. 2018, 128, 1–11. [Google Scholar] [CrossRef] [Green Version]
  19. Timmermans, M.J.; Lees, D.C.; Simonsen, T.J. Towards a mitogenomic phylogeny of Lepidoptera. Mol. Phylogenet. Evol. 2014, 79, 169–178. [Google Scholar] [CrossRef]
  20. Li, H.; Leavengood, J.M., Jr.; Chapman, E.G.; Burkhardt, D.; Song, F.; Jiang, P.; Liu, J.; Zhou, X.; Cai, W. Mitochondrial phylogenomics of Hemiptera reveals adaptive innovations driving the diversification of true bugs. Proc. Biol. Sci. 2017, 284, 20171223. [Google Scholar] [CrossRef] [Green Version]
  21. Motschulsky, V. Diagnoses de Coléoptères nouveaux, trouvés par M. M. Tatarinoff et Gaschkéwitsh aux environs de Pékin. Etud. Ent. 1854, 2, 44–51. [Google Scholar]
  22. Gressitt, J.L.; Rondon, J.A.; von Breuning, S. Cerambycid-Beetles of Laos. Pacific Insects Monograph 24; Bishop Museum: Honolulu, HI, USA, 1970. [Google Scholar]
  23. Fang, J.; Qian, L.; Xu, M.; Yang, X.; Wang, B.; An, Y. The complete nucleotide sequence of the mitochondrial genome of the Asian longhorn beetle, Anoplophora glabripennis (Coleoptera: Cerambycidae). Mitochondrial DNA Part A 2016, 27, 3299–3300. [Google Scholar] [CrossRef]
  24. Liu, H.L.; Chen, S.; Chen, Q.D.; Pu, D.Q.; Chen, Z.T.; Liu, Y.Y.; Liu, X. The first mitochondrial genomes of the family Haplodiplatyidae (Insecta: Dermaptera) reveal intraspecific variation and extensive gene rearrangement. Biology 2022, 11, 807. [Google Scholar] [CrossRef]
  25. Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, 884–890. [Google Scholar] [CrossRef] [PubMed]
  26. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [Green Version]
  27. Bernt, M.; Donath, A.; Jühling, F.; Externbrink, F.; Florentz, C.; Fritzsch, G.; Pütz, J.; Middendorf, M.; Stadler, P.F. MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol. Phylogenet. Evol. 2013, 69, 313–319. [Google Scholar] [CrossRef] [PubMed]
  28. Grant, J.R.; Stothard, P. The CGView server: A comparative genomics tool for circular genomes. Nucleic Acids Res. 2008, 36, 181–184. [Google Scholar] [CrossRef] [PubMed]
  29. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  30. Wang, D.; Zhang, Y.; Zhang, Z.; Zhu, J.; Yu, J. KaKs_Calculator 2.0: A toolkit incorporating γ-series methods and sliding window strategies. Genom. Broteom. Bioinform. 2010, 8, 77–80. [Google Scholar] [CrossRef] [Green Version]
  31. Baly, J.S. Descriptions of new genera and species of Eumolpidae. J. Entomol. 1860, 1, 23–36. [Google Scholar] [CrossRef]
  32. Murrell, B.; Weaver, S.; Smith, M.D.; Wertheim, J.O.; Murrell, S.; Aylward, A.; Eren, K.; Pollner, T.; Martin, D.P.; Smith, D.M.; et al. Gene-wide identification of episodic selection. Mol. Biol. Evol. 2015, 32, 1365–1371. [Google Scholar] [CrossRef] [Green Version]
  33. Murrell, B.; Wertheim, J.O.; Moola, S.; Weighill, T.; Scheffler, K.; Kosakovsky Pond, S.L. Detecting individual sites subject to episodic diversifying selection. PLoS Genet. 2012, 8, e1002764. [Google Scholar] [CrossRef] [Green Version]
  34. Benson, G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999, 27, 573–580. [Google Scholar] [CrossRef] [Green Version]
  35. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef] [PubMed]
  36. Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Vaidya, G.; Lohman, D.J.; Meier, R. SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef]
  38. Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld., T.; Calcott., B. PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Biol. Evol. 2016, 34, 772–773. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; Von Haeseler, A.; Lanfear, R. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
  40. Minh, B.Q.; Nguyen, M.A.; von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef] [Green Version]
  41. Guindon, S.; Dufayard, J.F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef] [Green Version]
  42. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Green Version]
  43. Rambaut, A. FigTree Version 1.4.4. 2019. Available online: http://tree.bio.ed.ac.uk/software/fgtree/ (accessed on 8 August 2022).
  44. Burla, H. Zur Kenntnis der Drosophiliden der Elfenbeinkuste (Franzosisch West-Afrika). Rev. Suisse Zool. 1954, 61, 1–218. [Google Scholar] [CrossRef]
  45. Clary, D.O.; Wolstenholme, D.R. The ribosomal RNA genes of Drosophila mitochondrial DNA. Nucleic Acids Res. 1985, 13, 4029–4045. [Google Scholar] [CrossRef] [Green Version]
  46. Ojala, D.; Montoya, J.; Attardi, G. tRNA punctuation model of RNA processing in human mitochondria. Nature 1981, 290, 470–474. [Google Scholar] [CrossRef] [PubMed]
  47. Guo, Q.; Liu, L.; Huang, W.; Sang, W.; Chen, X.; Wang, X. Characterization of the complete mitogenome of Trachylophus sinensis (Coleoptera: Cerambycidae: Cerambycinae), the type species of Trachylophus and its phylogenetic implications. J. Asia-Pac. Entomol. 2022, 25, 101977. [Google Scholar] [CrossRef]
  48. Garey, J.R.; Wolstenholme, D.R. Platyhelminth mitochondrial DNA: Evidence for early evolutionary origin of a tRNAserAGN that contains a dihydrouridine arm replacement loop, and of serine-specifying AGA and AGG codons. J. Mol. Evol. 1989, 28, 374–387. [Google Scholar] [CrossRef] [PubMed]
  49. Zhang, D.X.; Hewitt, G.M. Insect mitochondrial control region: A review of its structure, evolution and usefulness in evolutionary studies. Biochem. Syst. Ecol. 1997, 25, 99–120. [Google Scholar] [CrossRef]
  50. Linsley, E.G.; Chemsak, J.A. The Cerambycidae of North America, part VI, no. 1. Taxonomy and classification of the subfamily Lepturinae. Univ. Calif. Publ. Entomol. 1972, 69, 1–138. [Google Scholar]
  51. Crowson, R.A. The Biology of the Coleoptera; Academic Press: London, UK, 1981. [Google Scholar]
  52. Gómez-Zurita, J.; Hunt, T.; Kopliku, F.; Vogler, A.P. Recalibrated tree of leaf beetles (Chrysomelidae) indicates independent diversification of angiosperms and their insect herbivores. PLoS ONE 2007, 2, e360. [Google Scholar] [CrossRef]
  53. Hunt, T.; Bergsten, J.; Levkanicova, Z.; Papadopoulou, A.; John, O.S.; Wild, R.; Hammond, P.M.; Ahrens, D.; Balke, M.; Caterino, M.S.; et al. A comprehensive phylogeny of beetles reveals the evolutionary origins of a superradiation. Science 2007, 318, 1913–1916. [Google Scholar] [CrossRef]
  54. Lawrence, J.F.; Ślipiski, A.; Seago, A.E.; Thayer, M.K.; Newton, A.F.; Marvaldi, A.E. Phylogeny of the Coleoptera based on morphological characters of adults and larvae. Ann. Zool. 2011, 61, 1–217. [Google Scholar] [CrossRef]
  55. Mckenna, D.D.; Wild, A.L.; Kanda, K.; Bellamy, C.L.; Beutel, R.G.; Caterino, M.S.; Farnum, C.W.; Hawks, D.C.; Ivie, M.A.; Jameson, M.L.; et al. The beetle tree of life reveals Coleoptera survived end Permian mass extinction to diversify during the cretaceous terrestrial revolution. Syst. Entomol. 2015, 40, 835–880. [Google Scholar] [CrossRef] [Green Version]
  56. Wang, B.; Ma, J.Y.; McKenna, D.D.; Yan, E.V.; Zhang, H.C.; Jarzembowski, E.A. The earliest known longhorn beetle (Cerambycidae: Prioninae) and implications for the early evolution of Chrysomeloidea. J. Syst. Palaeontol. 2014, 12, 565–574. [Google Scholar] [CrossRef]
  57. Wei, Z.H.; Yin, X.M.; An, S.H.; Su, L.J.; Li, J.; Zhang, H.F. Molecular phylogenetic study of the higher taxa of the superfamily Cerambycoidea (Insecta: Coleoptera) based on the combined analysis of ribosomal DNA sequences. Acta Entomol. Sin. 2014, 57, 710–720. [Google Scholar]
  58. Danilevsky, M.L. Morpho-Adaptive Ways of Evolution of the Larvae of Longhorn Beetles (Coleoptera, Cerambycidae) and Phylogenetic Relations of the Basic Groups of the Family. Insects Decomposing Wood and their Entomophages; Nauka: Moscow, Russia, 1979. [Google Scholar]
  59. Napp, D.S. Phylogenetic relationships among the subfamilies of Cerambycidae (Coleoptera, Chrysomeloidea). Rev. Bras. Entomol. 1994, 28, 265–419. [Google Scholar]
  60. Reid, C.A.M. A cladistic analysis of subfamilial relationships in the Chrysomelidae sensu lato (Chrysomeloidea). In Biology, Phylogeny and Classification of Coleoptera: Papers Celebrating the 80th Birthday of Roy A. Crowson; Pakaluk, J., Slipinski, S.A., Eds.; Muzeum i Instytut Zoologii Polska Akademia Nauk: Warsaw, Poland, 1995; pp. 559–632. [Google Scholar]
  61. Bocak, L.; Barton, C.; Crampton-Platt, A.; Chesters, D.; Ahrens, D.; Vogler, A.P. Building the Coleoptera tree-of-life for >8000 species: Composition of public DNA data and fit with Linnaean classification. Syst. Entomol. 2014, 39, 97–110. [Google Scholar] [CrossRef]
Genes 13 01881 g001 550
Figure 1. Mitochondrial genome maps of A. glabripennis (A) and D. pseudonotabilis (B). Genes outside the map are transcribed clockwise, whereas those inside the map are transcribed counterclockwise. The inside circles show the GC content and the GC skew. GC content and GC skew are plotted as the deviation from the average value of the entire sequence.
Figure 1. Mitochondrial genome maps of A. glabripennis (A) and D. pseudonotabilis (B). Genes outside the map are transcribed clockwise, whereas those inside the map are transcribed counterclockwise. The inside circles show the GC content and the GC skew. GC content and GC skew are plotted as the deviation from the average value of the entire sequence.
Genes 13 01881 g001
Genes 13 01881 g002 550
Figure 2. Relative synonymous codon usage (RSCU) of PCGs in A. glabripennis (A) and D. pseudonotabilis (B).
Figure 2. Relative synonymous codon usage (RSCU) of PCGs in A. glabripennis (A) and D. pseudonotabilis (B).
Genes 13 01881 g002
Genes 13 01881 g003 550
Figure 3. Nonsynonymous/synonymous substitution ratios (A) and codon sites diversity (B) of mitochondrial PCGs of A. glabripennis and D. pseudonotabilis.
Figure 3. Nonsynonymous/synonymous substitution ratios (A) and codon sites diversity (B) of mitochondrial PCGs of A. glabripennis and D. pseudonotabilis.
Genes 13 01881 g003
Genes 13 01881 g004 550
Figure 4. Secondary structures of tRNA genes in the mitogenomes of A. glabripennis and D. pseudonotabilis. The identity of each tRNA gene is represented by the abbreviation of the related amino acid.
Figure 4. Secondary structures of tRNA genes in the mitogenomes of A. glabripennis and D. pseudonotabilis. The identity of each tRNA gene is represented by the abbreviation of the related amino acid.
Genes 13 01881 g004
Genes 13 01881 g005 550
Figure 5. Maximum-likelihood phylogeny of Cerambycidae s.l. inferred from mitogenomic data. Numbers at the nodes are bootstrap values.
Figure 5. Maximum-likelihood phylogeny of Cerambycidae s.l. inferred from mitogenomic data. Numbers at the nodes are bootstrap values.
Genes 13 01881 g005
Table
Table 1. Species used in this study.
Table 1. Species used in this study.
FamilySubfamilySpeciesGenome Size (bp)GenBank No.
Cerambycidae s.s.CerambycinaeAllotraeus orientalis15,966NC_061181
Anoplistes halodendri15,697NC_053350
Aromia bungii15,652MW617355
A. bungii15,760NC_053714
A. bungii15,759OK393714
Chloridolum lameeri15,731MN420467
Chlorophorus annularis15,487NC_061058
Chlorophorus diadema15,398MN473096
Chlorophorus simillimus13,675KY796055
Clytobius davidis15,571MN473101
D. pseudonotabilis15,527OP096419
Epipedocera atra15,662NC_051944
Gnatholea eburifera15,281MN420473
Jebusaea hammerschmidtii15,619MZ054170
Massicus raddei15,858NC_023937
Megacyllene sp. KM-201715,832MG193470
Molorchus minor15,685MN442323
Nadezhdiella cantori16,049NC_061180
Neoplocaederus obesus15,683NC_048951
Nortia carinicollis15,602NC_044698
Obrium cantharinum15,632MN420489
Obrium sp. NS-201515,680KT945156
Polyzonus fasciatus15,804MN442321
Purpuricenus lituratus15,744MN473112
Purpuricenus temminckii15,689MN527358
Pyrrhidium sanguineum16,203KX087339
P. sanguineum15,748MN442320
Rhytidodera bowringii15,278MN420472
Semanotus bifasciatus13,837KY765550
S. bifasciatus16,051MN095416
Stenodryas sp. N12715,333MN473097
Trichoferus campestris13,696KY773688
T. campestris15,737MN473098
Turanoclytus namaganensis15,565NC_060874
Xoanodera maculata15,767NC_061182
Xylotrechus grayii15,540NC_030782
Xylotrechus magnicollis13,692KY773690
Xystrocera globosa15,707NC_045097
Zoodes fulguratus15,885MW858149
DorcasominaeApatophysis sieversi15,278MN420474
Dorcasomus pinheyi16,040MN447435
Tsivoka simplicicollis16,700MN420488
LamiinaeAcanthocinus griseus15,600MN473099
Agapanthia amurensis15,512MW617354
Agapanthia daurica14,282KY773692
A. daurica17,153MN473114
Agelasta perplexa15,552NC_053905
Anaesthetis testacea15,169MN420492
Annamanum lunulatum15,610NC_046851
Anoplophora chinensis15,871MN882586
A. chinensis15,805NC_029230
A. glabripennis15,774NC_008221
Anoplophora horsfieldi15,796MN248534
A. horsfieldi15,837NC_059864
A. glabripennis15,622OP096420
Apomecyna saltator14,949NC_056277
Apriona germarii14,858NC_056838
Apriona swainsoni15,412NC_033872
Aristobia reticulator15,838NC_042151
Aulaconotus atronotatus14,491MW858150
Batocera davidis15,554MN420468
Batocera lineolata15,420MF521888
B. lineolata16,158MW629558
B. lineolata15,420MZ073344
B. lineolata15,418NC_022671
Batocera rubus16,158NC_062817
Blepephaeus succinctor15,554NC_044697
Cobelura sp. KM-201715,912MG193463
Epiglenea comes15,213MN473116
Eutetrapha metallescens15,072KY796053
Glenea cantor15,514NC_043883
Glenea licenti15,435MN473117
Glenea paraornata15,510MN420483
Glenea relicta15,486MN420484
Heteroglenea nigromaculata15,502MN420485
Jamesia sp. KM-201717,430MG193322
Lamiinae sp. 1 ACP-201315,737MH789723
Lamiinae sp. 2 ACP-201315,440MH789720
Lamiinae sp. 4 ACP-201315,504MH789721
Lamiinae sp. 4 ACP-201315,554MH836614
Menesia sulphurata15,551MN473119
Moechotypa diphysis15,493MW617356
Monochamus alternatus14,649JX987292
M. alternatus14,189MW858152
M. alternatus15,874NC_024652
M. alternatus15,880NC_050066
Monochamus sartor urussovii14,359KY773691
Monochamus sparsutus16,029NC_053906
Monochamus sutor14,350KY773689
Niphona lateraliplagiata15,902MN473100
Oberea diversipes15,499NC_053945
Oberea formosana15,675MN473118
Oberea yaoshana15,529MK863509
Olenecamptus bilobus15,262NC_051945
Olenecamptus subobliteratus13,854KY796054
Paraglenea fortunei15,401MN442322
P. fortunei15,496NC_056837
Parmena novaki15,668MN420491
Psacothea hilaris15,856NC_013070
Pseudoechthistatus chiangshunani16,419OP006455
Pseudoechthistatus hei16,103NC_065262
Pterolophia sp. ZJY-201916,063NC_044699
Saperda tetrastigma15,563MZ955033
Serixia sedata14,714MN420487
Thermistis croceocincta15,503NC_044700
Thyestilla gebleri15,503MN420486
T. gebleri15,505NC_034752
LepturinaeAnastrangalia sequensi16,269NC_038090
Brachyta interrogationis18,165KX087246
Cortodera humeralis15,928KX087264
Gaurotes virginea15,775MN473081
Grammoptera ruficornis16,458MN473080
Leptura aethiops15,690MN420475
Leptura annularis16,530MN420469
Leptura arcuata14,382KY796051
Oxymirus cursor15,797MN473085
Pachyta bicuneata13,894KY765551
Peithona prionoides13,636MN473095
Pidonia lurida15,668MN473083
Rhagium fortecostatum16,274MN473103
Rhamnusium bicolor15,527MN473084
Rutpela maculata17,437OW386295
Sachalinobia koltzei15,809MN473113
Stenurella nigra16,504KX087348
Stictoleptura succedanea14,381KY796052
Teledapalpus zolotichini16,651MN473111
Stenocorus meridianus16,227MN473082
Xylosteus spinolae15,708MN473086
NecydalinaeNecydalis major15,598MN473087
Ulochaetes vacca15,593MN473110
ParandrinaePapuandra araucariae15,475MN420477
PrioninaeAegolipton marginale16,759MN420471
Aegosoma pallidum15,668MN473115
Aegosoma sinicum15,658KY773686
A. sinicum15,658NC_038089
Aesa media15,714MK614538
Agrianome spinicollis15,633MK614550
Analophus parallelus15,722MK614551
Archetypus frenchi16,156MK614554
Bifidoprionus rufus15,590MK614537
Brephilydia jejuna15,659MK614541
Cacodacnus planicollis15,671MK614543
Callipogon relictus15,742NC_037698
Cnemoplites australis15,675MK614536
Cnemoplites edulis13,161MK614556
Dorysthenes buquetii15,778MN420481
Dorysthenes granulosus15,858MN829437
Dorysthenes paradoxus15,922NC_037927
Eboraphyllus middletoni15,776MK614546
Enneaphyllus aeneipennis16,505MK614545
Eurynassa australis15,612MK614547
Geoffmonteithia queenslanda15,628MK614544
Hermerius prionoides13,696MK614542
Howea angulata15,626MK614532
Megopis sinica15,689NC_045407
Nepiodes costipennis multicarinatus15,935MN420482
Olethrius laevipennis15,690MK614533
Papunya picta15,737MK614539
Paulhutchinsonia pilosicollis15,846NC_048496
Phaolus metallicus15,997MK614535
Phlyctenosis sp. N13515,000MN473102
Priotyrannus closteroides15,854NC_062855
Pseudoplites inexpectatus15,651MK614549
Rhipidocerus australasiae15,721MK614540
Sarmydus sp. N11715,720MN473091
Sceleocantha sp. 4 MJ-201915,804MK614555
Teispes insularis15,632MK614553
Toxeutes arcuatus15,859MK614548
Toxeutes macleayi13,579MK614559
Tragosoma depsarium15,712MN473090
Utra nitida14,976MK614534
Xixuthrus sp. ANIC_25-06709615,523MK614552
SpondylidinaeArhopalus rusticus15,860MN473105
Arhopalus unicolor15,760NC_053904
Cephalallus oberthueri15,763NC_062854
Saphanus piceus15,832MN473088
Spondylis buprestoides16,070MN420476
S. buprestoides15,837NC_052914
DisteniidaeDisteniinaeClytomelegena kabakovi15,816MN473109
Distenia gracilis15,704MN473106
Disteniinae sp. BMNH 89983715,598KX035158
Typodryas sp. N14315,647MN473107
OxypeltidaeOxypeltinaeOxypeltus quadrispinosus16,140MN420465
O. quadrispinosus17,001MN420466
VesperidaeAnoplodermatinaeMigdolus sp. N5114,931MN420478
VesperinaeVesperus sanzi16,125MN473093
Chrysomelidae A. nigripes17,306ON553912
Table
Table 2. Mitochondrial genome organization of A. glabripennis.
Table 2. Mitochondrial genome organization of A. glabripennis.
GenePosition (bp)Size (bp)DirectionIntergenic NucleotidesAnti− or Start/Stop CodonsA + T%
trnIle (I)1–6767Forward0GAT61.2
trnGln (Q)69–13769Reverse1TTG78.3
trnMet (M)137–20569Forward−1CAT72.5
ND2206–12161011Forward0ATT/TAA77.6
trnTrp (W)1215–128268Forward−2TCA76.5
trnCys (C)1275–133662Reverse−8GCA74.2
trnTyr (Y)1338–140265Reverse1GTA69.2
COX11403–28191417Forward0ATC/T68.1
trnLeu2 (L2)2820–288465Forward0TAA73.8
COX22885–3572688Forward0ATC/T72.1
trnLys (K)3573–364169Forward0CTT68.1
trnAsp (D)3642–370766Forward0GTC86.4
ATP83708–3863156Forward0ATT/TAG86.5
ATP63860–4531672Forward−4ATA/TAA75.1
COX34531–5319789Forward−1ATG/TAA70.6
trnGly (G)5322–538564Forward2TCC85.9
ND35383–5739357Forward−3ATA/TAG79.0
trnAla (A)5738–580265Forward−2TGC81.5
trnArg (R)5803–586462Forward0TCG74.2
trnAsn (N)5864–592764Forward−1GTT75.0
trnSer1 (S1)5928–599467Forward0GCT76.1
trnGlu (E)5995–605763Forward0TTC87.3
trnPhe (F)6060–612364Reverse2GAA82.8
ND56124–78401717Reverse0ATT/T78.3
trnHis (H)7841–790363Reverse0GTG84.1
ND47904–92361333Reverse0ATG/T79.3
ND4L9230–9517288Reverse−7ATG/TAA83.0
trnThr (T)9520–958364Forward2TGT82.8
trnPro (P)9584–964764Reverse0TGG78.1
ND69650–10,153504Forward2ATT/TAA85.1
CYTB10,159–11,2921134Forward5ATA/TAA72.2
trnSer2 (S2)11,296–11,36469Forward3TGA81.2
ND111,382–12,332951Reverse17TTG/TAG76.3
trnLeu1 (L1)12,334–12,39865Reverse1TAG78.5
rrnL12,399–13,6701272Reverse0 80.1
trnVal (V)13,671–13,73969Reverse0TAC75.4
rrnS13,740–14,518779Reverse0 78.6
Control Region14,519–15,6221104Forward0 79.3
Table
Table 3. Mitochondrial genome organization of D. pseudonotabilis.
Table 3. Mitochondrial genome organization of D. pseudonotabilis.
GenePosition (bp)Size (bp)DirectionIntergenic NucleotidesAnti− or Start/Stop CodonsA + T%
trnIle (I)1–6666Forward0GAT72.7
trnGln (Q)64–13269Reverse−3TTG81.2
trnMet (M)132–20069Forward−1CAT65.2
ND2201–12111011Forward0ATA/TAA76.2
trnTrp (W)1210–127465Forward−2TCA73.8
trnCys (C)1274–133966Reverse−1GCA72.7
trnTyr (Y)1341–140565Reverse1GTA66.2
COX11440–29401501Forward34ATT/T67.0
trnLeu2 (L2)2941–300565Forward0TAA72.3
COX23006–3692687Forward0ATA/TAT70.7
trnLys (K)3694–376471Forward1CTT70.4
trnAsp (D)3768–383770Forward3GTC82.9
ATP83847–3993147Forward9ATA/TAG85.0
ATP63990–4661672Forward−4ATA/TAA74.3
COX34661–5447787Forward−1ATG/T69.5
trnGly (G)5448–551063Forward0TCC84.1
ND35511–5862352Forward0ATT/T76.1
trnAla (A)5863–592563Forward0TGC77.8
trnArg (R)5925–598965Forward−1TCG73.8
trnAsn (N)5989–605365Forward−1GTT73.8
trnSer1 (S1)6054–612067Forward0GCT74.6
trnGlu (E)6121–618666Forward0TTC86.4
trnPhe (F)6190–625667Reverse3GAA79.1
ND56257–79731717Reverse0ATT/T77.4
trnHis (H)7974–803764Reverse0GTG84.4
ND48037–93681332Reverse−1ATA/TAA76.4
ND4L9365–9643279Reverse−4ATG/TAA79.9
trnThr (T)9646–970964Forward2TGT84.4
trnPro (P)9709–977466Reverse−1TGG75.8
ND69776–10,273498Forward1ATA/TAA81.7
CYTB10,273–11,4091137Forward−1ATG/TAA68.1
trnSer2 (S2)11,411–11,47969Forward1TGA78.3
ND111,497–12,447951Reverse17TTG/TAG75.8
trnLeu1 (L1)12,449–12,51264Reverse1TAG75.0
rrnL12,513–13,7781266Reverse0 78.8
trnVal (V)13,779–13,84668Reverse0TAC77.9
rrnS13,847–14,620774Reverse0 76.5
Control Region14,621–15,527907Forward0 82.1
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Pu, D.-Q.; Liu, H.-L.; Wu, X.-L.; Chen, Z.-T. Complete Mitochondrial Genomes and Phylogenetic Positions of Two Longicorn Beetles, Anoplophora glabripennis and Demonax pseudonotabilis (Coleoptera: Cerambycidae). Genes 2022, 13, 1881. https://doi.org/10.3390/genes13101881

AMA Style

Pu D-Q, Liu H-L, Wu X-L, Chen Z-T. Complete Mitochondrial Genomes and Phylogenetic Positions of Two Longicorn Beetles, Anoplophora glabripennis and Demonax pseudonotabilis (Coleoptera: Cerambycidae). Genes. 2022; 13(10):1881. https://doi.org/10.3390/genes13101881

Chicago/Turabian Style

Pu, De-Qiang, Hong-Ling Liu, Xing-Long Wu, and Zhi-Teng Chen. 2022. "Complete Mitochondrial Genomes and Phylogenetic Positions of Two Longicorn Beetles, Anoplophora glabripennis and Demonax pseudonotabilis (Coleoptera: Cerambycidae)" Genes 13, no. 10: 1881. https://doi.org/10.3390/genes13101881

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop