High Glucose Levels Promote Switch to Synthetic Vascular Smooth Muscle Cells via Lactate/GPR81
Abstract
:1. Introduction
2. Materials and Methods
2.1. Maintenance and Differentiation of Human Induced Pluripotent Stem Cells
2.2. Human Tissue
2.3. Flow Cytometry Analysis
2.4. Glucose Uptake Assay
2.5. Glucose Consumption and Lactate Turnover Assay
2.6. ATP Concentration Measurement and Lactate Concentration Measurement
2.7. ELISA, Proliferation, and Apoptosis
2.8. Migration Assay
2.9. GLUT1, LDHa, and GPR81 Knockdown
2.10. Real-Time Reverse Transcription PCR
2.11. Western Blot Analysis
2.12. Immunocytochemistry
2.13. Mouse TallyHo Model of High-Lipid, High-Glucose Diet
2.14. Metabolomics Analysis
2.15. Proteomics Analysis
2.16. Ingenuity Pathway Analysis
2.17. Statistical Analysis
3. Results
3.1. Contractile vSMCs and Synthetic vSMCs Respond to High Glucose Concentrations Differently in Cell Culture
3.2. Contractile vSMCs and Synthetic vSMCs Have Different Metabolism in High-Glucose-Concentration Culture
3.3. High Glucose Concentration Promotes vSMC Phenotype Switch
3.4. High Glucose Concentration Promotes vSMC Synthetic Phenotype via Lactate-GPR81
3.5. GPR81 Regulates vSMC via PGC1a, MCTs, and CD147
3.6. GPR81 Expression in vSMCs in Human Tissue and the Diabetic Mouse Model
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Paneni, F.; Beckman, J.A.; Creager, M.A.; Cosentino, F. Diabetes and vascular disease: Pathophysiology, clinical consequences, and medical therapy: Part I. Eur. Heart J. 2013, 34, 2436–2443. [Google Scholar] [CrossRef]
- Casella, S.; Bielli, A.; Mauriello, A.; Orlandi, A. Molecular Pathways Regulating Macrovascular Pathology and Vascular Smooth Muscle Cells Phenotype in Type 2 Diabetes. Int. J. Mol. Sci. 2015, 16, 24353–24368. [Google Scholar] [CrossRef]
- Beckman, J.A.; Paneni, F.; Cosentino, F.; Creager, M.A. Diabetes and vascular disease: Pathophysiology, clinical consequences, and medical therapy: Part II. Eur. Heart J. 2013, 34, 2444–2452. [Google Scholar] [CrossRef]
- Li, Y.; Liu, Y.; Liu, S.; Gao, M.; Wang, W.; Chen, K.; Huang, L.; Liu, Y. Diabetic vascular diseases: Molecular mechanisms and therapeutic strategies. Signal Transduct. Target. Ther. 2023, 8, 152. [Google Scholar] [CrossRef]
- Luscher, T.F.; Creager, M.A.; Beckman, J.A.; Cosentino, F. Diabetes and vascular disease: Pathophysiology, clinical consequences, and medical therapy: Part II. Circulation 2003, 108, 1655–1661. [Google Scholar] [CrossRef]
- Owens, G.K.; Kumar, M.S.; Wamhoff, B.R. Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol. Rev. 2004, 84, 767–801. [Google Scholar] [CrossRef]
- Yang, L.; Geng, Z.; Nickel, T.; Johnson, C.; Gao, L.; Dutton, J.; Hou, C.; Zhang, J. Differentiation of Human Induced-Pluripotent Stem Cells into Smooth-Muscle Cells: Two Novel Protocols. PLoS ONE 2016, 11, e0147155. [Google Scholar] [CrossRef]
- Bennett, M.R.; Sinha, S.; Owens, G.K. Vascular Smooth Muscle Cells in Atherosclerosis. Circ. Res. 2016, 118, 692–702. [Google Scholar] [CrossRef] [PubMed]
- Porter, K.E.; Riches, K. The vascular smooth muscle cell: A therapeutic target in Type 2 diabetes? Clin. Sci. 2013, 125, 167–182. [Google Scholar] [CrossRef] [PubMed]
- Koval, O.M.; Nguyen, E.K.; Mittauer, D.J.; Ait-Aissa, K.; Chinchankar, W.C.; Grumbach, I.M. Regulation of Smooth Muscle Cell Proliferation by Mitochondrial Ca2+ in Type 2 Diabetes. Int. J. Mol. Sci. 2023, 24, 12897. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, L.A.; Poot, M.; Gerrity, R.G.; Bornfeldt, K.E. Diabetes accelerates smooth muscle accumulation in lesions of atherosclerosis: Lack of direct growth-promoting effects of high glucose levels. Diabetes 2001, 50, 851–860. [Google Scholar] [CrossRef]
- Wu, Y.; Dong, Y.; Atefi, M.; Liu, Y.; Elshimali, Y.; Vadgama, J.V. Lactate, a Neglected Factor for Diabetes and Cancer Interaction. Mediators Inflamm. 2016, 2016, 6456018. [Google Scholar] [CrossRef]
- Kim, J.H.; Bae, K.H.; Byun, J.K.; Lee, S.; Kim, J.G.; Lee, I.K.; Jung, G.S.; Lee, Y.M.; Park, K.G. Lactate dehydrogenase-A is indispensable for vascular smooth muscle cell proliferation and migration. Biochem. Biophys. Res. Commun. 2017, 492, 41–47. [Google Scholar] [CrossRef] [PubMed]
- Freire Jorge, P.; Wieringa, N.; de Felice, E.; van der Horst, I.C.C.; Oude Lansink, A.; Nijsten, M.W. The association of early combined lactate and glucose levels with subsequent renal and liver dysfunction and hospital mortality in critically ill patients. Crit. Care 2017, 21, 218. [Google Scholar] [CrossRef] [PubMed]
- Brouwers, M.C.; Ham, J.C.; Wisse, E.; Misra, S.; Landewe, S.; Rosenthal, M.; Patel, D.; Oliver, N.; Bilo, H.J.; Murphy, E. Elevated lactate levels in patients with poorly regulated type 1 diabetes and glycogenic hepatopathy: A new feature of Mauriac syndrome. Diabetes Care 2015, 38, e11–e12. [Google Scholar] [CrossRef] [PubMed]
- Ishitobi, M.; Hosaka, T.; Morita, N.; Kondo, K.; Murashima, T.; Kitahara, A.; Takahashi, K.; Sumitani, Y.; Tanaka, T.; Yokoyama, T.; et al. Serum lactate levels are associated with serum alanine aminotransferase and total bilirubin levels in patients with type 2 diabetes mellitus: A cross-sectional study. Diabetes Res. Clin. Pract. 2019, 149, 1–8. [Google Scholar] [CrossRef]
- Fischer, K.; Hoffmann, P.; Voelkl, S.; Meidenbauer, N.; Ammer, J.; Edinger, M.; Gottfried, E.; Schwarz, S.; Rothe, G.; Hoves, S.; et al. Inhibitory effect of tumor cell-derived lactic acid on human T cells. Blood 2007, 109, 3812–3819. [Google Scholar] [CrossRef]
- Vegran, F.; Boidot, R.; Michiels, C.; Sonveaux, P.; Feron, O. Lactate influx through the endothelial cell monocarboxylate transporter MCT1 supports an NF-kappaB/IL-8 pathway that drives tumor angiogenesis. Cancer Res. 2011, 71, 2550–2560. [Google Scholar] [CrossRef] [PubMed]
- Leite, T.C.; Coelho, R.G.; Da Silva, D.; Coelho, W.S.; Marinho-Carvalho, M.M.; Sola-Penna, M. Lactate downregulates the glycolytic enzymes hexokinase and phosphofructokinase in diverse tissues from mice. FEBS Lett. 2011, 585, 92–98. [Google Scholar] [CrossRef]
- Hashimoto, T.; Hussien, R.; Oommen, S.; Gohil, K.; Brooks, G.A. Lactate sensitive transcription factor network in L6 cells: Activation of MCT1 and mitochondrial biogenesis. FASEB J. 2007, 21, 2602–2612. [Google Scholar] [CrossRef]
- Haas, R.; Smith, J.; Rocher-Ros, V.; Nadkarni, S.; Montero-Melendez, T.; D’Acquisto, F.; Bland, E.J.; Bombardieri, M.; Pitzalis, C.; Perretti, M.; et al. Lactate Regulates Metabolic and Pro-inflammatory Circuits in Control of T Cell Migration and Effector Functions. PLoS Biol. 2015, 13, e1002202. [Google Scholar] [CrossRef]
- Hsu, P.P.; Sabatini, D.M. Cancer cell metabolism: Warburg and beyond. Cell 2008, 134, 703–707. [Google Scholar] [CrossRef]
- Colegio, O.R.; Chu, N.Q.; Szabo, A.L.; Chu, T.; Rhebergen, A.M.; Jairam, V.; Cyrus, N.; Brokowski, C.E.; Eisenbarth, S.C.; Phillips, G.M.; et al. Functional polarization of tumour-associated macrophages by tumour-derived lactic acid. Nature 2014, 513, 559–563. [Google Scholar] [CrossRef]
- Hirschhaeuser, F.; Sattler, U.G.; Mueller-Klieser, W. Lactate: A metabolic key player in cancer. Cancer Res. 2011, 71, 6921–6925. [Google Scholar] [CrossRef]
- Dhup, S.; Dadhich, R.K.; Porporato, P.E.; Sonveaux, P. Multiple biological activities of lactic acid in cancer: Influences on tumor growth, angiogenesis and metastasis. Curr. Pharm. Des. 2012, 18, 1319–1330. [Google Scholar] [CrossRef]
- Roland, C.L.; Arumugam, T.; Deng, D.; Liu, S.H.; Philip, B.; Gomez, S.; Burns, W.R.; Ramachandran, V.; Wang, H.; Cruz-Monserrate, Z.; et al. Cell surface lactate receptor GPR81 is crucial for cancer cell survival. Cancer Res. 2014, 74, 5301–5310. [Google Scholar] [CrossRef]
- Barron, J.T.; Parrillo, J.E. Production of lactic acid and energy metabolism in vascular smooth muscle: Effect of dichloroacetate. Am. J. Physiol. 1995, 268, H713–H719. [Google Scholar] [CrossRef] [PubMed]
- Andersen, L.W.; Mackenhauer, J.; Roberts, J.C.; Berg, K.M.; Cocchi, M.N.; Donnino, M.W. Etiology and therapeutic approach to elevated lactate levels. Mayo Clin. Proc. 2013, 88, 1127–1140. [Google Scholar] [CrossRef] [PubMed]
- Mauro, C.; Marelli-Berg, F.M. T cell immunity and cardiovascular metabolic disorders: Does metabolism fuel inflammation? Front. Immunol. 2012, 3, 173. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Gao, L.; Nickel, T.; Yang, J.; Zhou, J.; Gilbertsen, A.; Geng, Z.; Johnson, C.; Young, B.; Henke, C.; et al. Lactate Promotes Synthetic Phenotype in Vascular Smooth Muscle Cells. Circ. Res. 2017, 121, 1251–1262. [Google Scholar] [CrossRef] [PubMed]
- Della Vedova, M.C.; Munoz, M.D.; Santillan, L.D.; Plateo-Pignatari, M.G.; Germano, M.J.; Rinaldi Tosi, M.E.; Garcia, S.; Gomez, N.N.; Fornes, M.W.; Gomez Mejiba, S.E.; et al. A Mouse Model of Diet-Induced Obesity Resembling Most Features of Human Metabolic Syndrome. Nutr. Metab. Insights 2016, 9, 93–102. [Google Scholar] [CrossRef]
- Wang, L.; Urriola, P.E.; Luo, Z.H.; Rambo, Z.J.; Wilson, M.E.; Torrison, J.L.; Shurson, G.C.; Chen, C. Metabolomics revealed diurnal heat stress and zinc supplementation-induced changes in amino acid, lipid, and microbial metabolism. Physiol. Rep. 2016, 4, 12676. [Google Scholar] [CrossRef]
- Frismantiene, A.; Philippova, M.; Erne, P.; Resink, T.J. Smooth muscle cell-driven vascular diseases and molecular mechanisms of VSMC plasticity. Cell Signal 2018, 52, 48–64. [Google Scholar] [CrossRef]
- Dorn, G.W., 2nd; Vega, R.B.; Kelly, D.P. Mitochondrial biogenesis and dynamics in the developing and diseased heart. Genes Dev. 2015, 29, 1981–1991. [Google Scholar] [CrossRef]
- Li, X.; Yu, X.; Dai, D.; Song, X.; Xu, W. The altered glucose metabolism in tumor and a tumor acidic microenvironment associated with extracellular matrix metalloproteinase inducer and monocarboxylate transporters. Oncotarget 2016, 7, 23141–23155. [Google Scholar] [CrossRef] [PubMed]
- Basatemur, G.L.; Jorgensen, H.F.; Clarke, M.C.H.; Bennett, M.R.; Mallat, Z. Vascular smooth muscle cells in atherosclerosis. Nat. Rev. Cardiol. 2019, 16, 727–744. [Google Scholar] [CrossRef] [PubMed]
- Giugliano, D.; Ceriello, A.; Esposito, K. Glucose metabolism and hyperglycemia. Am. J. Clin. Nutr. 2008, 87, 217S–222S. [Google Scholar] [CrossRef] [PubMed]
- Ormazabal, V.; Nair, S.; Elfeky, O.; Aguayo, C.; Salomon, C.; Zuniga, F.A. Association between insulin resistance and the development of cardiovascular disease. Cardiovasc. Diabetol. 2018, 17, 122. [Google Scholar] [CrossRef] [PubMed]
- Vander Heiden, M.G.; Cantley, L.C.; Thompson, C.B. Understanding the Warburg effect: The metabolic requirements of cell proliferation. Science 2009, 324, 1029–1033. [Google Scholar] [CrossRef]
- Hertz, L.; Dienel, G.A. Lactate transport and transporters: General principles and functional roles in brain cells. J. Neurosci. Res. 2005, 79, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Morland, C.; Lauritzen, K.H.; Puchades, M.; Holm-Hansen, S.; Andersson, K.; Gjedde, A.; Attramadal, H.; Storm-Mathisen, J.; Bergersen, L.H. The lactate receptor, G-protein-coupled receptor 81/hydroxycarboxylic acid receptor 1: Expression and action in brain. J. Neurosci. Res. 2015, 93, 1045–1055. [Google Scholar] [CrossRef]
- Wagner, W.; Kania, K.D.; Blauz, A.; Ciszewski, W.M. The lactate receptor (HCAR1/GPR81) contributes to doxorubicin chemoresistance via ABCB1 transporter up-regulation in human cervical cancer HeLa cells. J. Physiol. Pharmacol. 2017, 68, 555–564. [Google Scholar]
- Wallenius, K.; Thalen, P.; Bjorkman, J.A.; Johannesson, P.; Wiseman, J.; Bottcher, G.; Fjellstrom, O.; Oakes, N.D. Involvement of the metabolic sensor GPR81 in cardiovascular control. JCI Insight 2017, 2, e92564. [Google Scholar] [CrossRef] [PubMed]
- Khatib-Massalha, E.; Bhattacharya, S.; Massalha, H.; Biram, A.; Golan, K.; Kollet, O.; Kumari, A.; Avemaria, F.; Petrovich-Kopitman, E.; Gur-Cohen, S.; et al. Lactate released by inflammatory bone marrow neutrophils induces their mobilization via endothelial GPR81 signaling. Nat. Commun. 2020, 11, 3547. [Google Scholar] [CrossRef] [PubMed]
- Peng, F.; Li, H.; Ning, Z.; Yang, Z.; Wang, Y.; Chen, F.; Wu, Y. CD147 and Prostate Cancer: A Systematic Review and Meta-Analysis. PLoS ONE 2016, 11, e0163678. [Google Scholar] [CrossRef] [PubMed]
- Xin, X.; Zeng, X.; Gu, H.; Li, M.; Tan, H.; Jin, Z.; Hua, T.; Shi, R.; Wang, H. CD147/EMMPRIN overexpression and prognosis in cancer: A systematic review and meta-analysis. Sci. Rep. 2016, 6, 32804. [Google Scholar] [CrossRef]
- Javaeed, A.; Ghauri, S.K. MCT4 has a potential to be used as a prognostic biomarker—A systematic review and meta-analysis. Oncol. Rev. 2019, 13, 403. [Google Scholar] [CrossRef]
- Besse-Patin, A.; Jeromson, S.; Levesque-Damphousse, P.; Secco, B.; Laplante, M.; Estall, J.L. PGC1A regulates the IRS1:IRS2 ratio during fasting to influence hepatic metabolism downstream of insulin. Proc. Natl. Acad. Sci. USA 2019, 116, 4285–4290. [Google Scholar] [CrossRef]
- Petrie, M.A.; Sharma, A.; Taylor, E.B.; Suneja, M.; Shields, R.K. Impact of short- and long-term electrically induced muscle exercise on gene signaling pathways, gene expression, and PGC1a methylation in men with spinal cord injury. Physiol. Genom. 2020, 52, 71–80. [Google Scholar] [CrossRef] [PubMed]
- Saleme, B.; Das, S.K.; Zhang, Y.; Boukouris, A.E.; Lorenzana Carrillo, M.A.; Jovel, J.; Wagg, C.S.; Lopaschuk, G.D.; Michelakis, E.D.; Sutendra, G. p53-Mediated Repression of the PGC1A (PPARG Coactivator 1alpha) and APLNR (Apelin Receptor) Signaling Pathways Limits Fatty Acid Oxidation Energetics: Implications for Cardio-oncology. J. Am. Heart Assoc. 2020, 9, e017247. [Google Scholar] [CrossRef]
- Cade, W.T. Diabetes-related microvascular and macrovascular diseases in the physical therapy setting. Phys. Ther. 2008, 88, 1322–1335. [Google Scholar] [CrossRef]
- Creager, M.A.; Luscher, T.F.; Cosentino, F.; Beckman, J.A. Diabetes and vascular disease: Pathophysiology, clinical consequences, and medical therapy: Part I. Circulation 2003, 108, 1527–1532. [Google Scholar] [CrossRef] [PubMed]
- Leiter, E.H.; Strobel, M.; O’Neill, A.; Schultz, D.; Schile, A.; Reifsnyder, P.C. Comparison of Two New Mouse Models of Polygenic Type 2 Diabetes at the Jackson Laboratory, NONcNZO10Lt/J and TALLYHO/JngJ. J. Diabetes Res. 2013, 2013, 165327. [Google Scholar] [CrossRef]
- Ramasubramanian, B.; Reddy, P.H. Are TallyHo Mice A True Mouse Model for Type 2 Diabetes and Alzheimer’s Disease? J. Alzheimers Dis. 2019, 72, S81–S93. [Google Scholar] [CrossRef] [PubMed]
- Mohammad Nezhady, M.A.; Chemtob, S. 3-OBA Is Not an Antagonist of GPR81. Front. Pharmacol. 2021, 12, 803907. [Google Scholar] [CrossRef] [PubMed]
Name | Forward | Reverse | Gene No. |
---|---|---|---|
GPR81 | GCCTGCCTTTTCGGACAGACTA | ACCACCGTAAGGAACACGATGC | ENSG00000196917 |
Glut1 | TGTGCAACCCATGAGCTAA | CCTGGTCTCATCTGGATTCT | ENSG00000117394 |
MCT1 | CTCTGGGCGCCGCGAGATAC | CAACTACCACCGCCCAGCCC | ENSG00000155380 |
MCT4 | CCAGGCCCACGGCAGGTTTC | GCCACCGTAGTC ACTGGCCG | ENSG00000168679 |
TAGLN | GAAGAAAGCCCAGGAGCATAA | CCAGGATGAGAGGAACAGTAGA | ENSG00000149591 |
MYH11 | AGGCGAACCTAGACAAGAATAAG | CTGGATGTTGAGAGTGGAGATG | ENSG00000133392 |
LDHa | AGCCCGATTCCGTTACCT | CACCAGCAACATTCATTCCA | ENSG00000134333 |
Vimentin | TCGTTTCGAGGTTTTCGCGTTAGAGAC | GACTAAAACTCGACCGACTCGCGA | ENSG0000026025 |
PGC1a | AGCCTCTTTGCCCAGATCTT | GGCAATCCGTCTTCATCCAC | ENSG00000109819 |
CD147 | ACCTGCTCTCGGAGCCGTTCA | CGTCTCTGCACAGATTGCAT | ENSG00000172270 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, J.; Gourley, G.R.; Gilbertsen, A.; Chen, C.; Wang, L.; Smith, K.; Namenwirth, M.; Yang, L. High Glucose Levels Promote Switch to Synthetic Vascular Smooth Muscle Cells via Lactate/GPR81. Cells 2024, 13, 236. https://doi.org/10.3390/cells13030236
Yang J, Gourley GR, Gilbertsen A, Chen C, Wang L, Smith K, Namenwirth M, Yang L. High Glucose Levels Promote Switch to Synthetic Vascular Smooth Muscle Cells via Lactate/GPR81. Cells. 2024; 13(3):236. https://doi.org/10.3390/cells13030236
Chicago/Turabian StyleYang, Jing, Glenn R. Gourley, Adam Gilbertsen, Chi Chen, Lei Wang, Karen Smith, Marion Namenwirth, and Libang Yang. 2024. "High Glucose Levels Promote Switch to Synthetic Vascular Smooth Muscle Cells via Lactate/GPR81" Cells 13, no. 3: 236. https://doi.org/10.3390/cells13030236