Next Article in Journal
Personalizing Care for Critically Ill Adults Using Omics: A Concise Review of Potential Clinical Applications
Previous Article in Journal
Transition from Animal-Based to Human Induced Pluripotent Stem Cells (iPSCs)-Based Models of Neurodevelopmental Disorders: Opportunities and Challenges
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 12
Issue 4
10.3390/cells12040539
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bovine HOXA11 Gene Identified from RNA-Seq: mRNA Profile Analysis and Genetic Variation Detection Using ME Method and Their Associations with Carcass Traits

by
Yangming Huang
1,†,
Kejing Zhang
1,†,
Yafang Li
1,
Sihuan Zhang
1,2,
Zhanerke Akhatayeva
1,
Fugui Jiang
3,
Enliang Song
3,* and
Xianyong Lan
1,*
1
College of Animal Science and Technology, Northwest A&F University, Yangling, Xianyang 712100, China
2
College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China
3
Institute of Animal Science and Veterinary, Shandong Academy of Agriculture Science, Jinan 250100, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Cells 2023, 12(4), 539; https://doi.org/10.3390/cells12040539
Submission received: 30 October 2022 / Revised: 21 January 2023 / Accepted: 2 February 2023 / Published: 8 February 2023
(This article belongs to the Section Cell and Gene Therapy)
Browse Figures
Versions Notes

Abstract

:
The Homeobox A11 (HOXA11) gene regulates limb skeletal development and muscle growth, thus, it was selected as a candidate gene for bovine carcass traits. In this study, we analyzed the mRNA expression level of HOXA11 in various tissues and cells, and determined the genetic variations in the HOXA11 gene, which might be used as molecular markers for cattle breeding. The mRNA expression profiles of HOXA11 in bovine different tissues showed that HOXA11 was highly expressed in both fat and muscle. The gene expression trend of HOXA11 in myoblasts and adipocytes indicated that HOXA11 might be involved in the differentiation of bovine myoblasts and adipocytes. The data in the Ensembl database showed that there are two putative insertion/deletion (InDel) polymorphisms in the bovine HOXA11 gene. The insertion site (rs515880802) was located in the upstream region (NC_037331.1: g. 68853364-68853365) and named as P1-Ins-4-bp, and the deletion site (rs517582703) was located in the intronic region (NC_037331.1: g. 68859510-68859517) and named as P2-Del-8-bp. These polymorphisms within the HOXA11 gene were identified and genotyped by PCR amplification, agarose gel electrophoresis and DNA sequencing in the 640 Shandong Black Cattle Genetic Resource (SDBCGR) population. Moreover, the mutation frequency was very low after detection, so the mathematical expectation (ME) method was used for detection. Statistical analysis demonstrated that P1-Ins-4-bp was significantly correlated with the beef shoulder (p = 0.012) and tongue root (p = 0.004). Meanwhile, P2-Del-8-bp displayed a significant correlation with the back tendon (p = 0.008), money tendon (p = 2.84 × 10-4), thick flank (p = 0.034), beef shin (p = 9.09 × 10-7), triangle thick flank (p = 0.04), triangle flank (p = 1.00 × 10-6), rump (p = 0.018) and small tenderloin (p = 0.043) in the female SDBCGR population. In summary, these outcomes may provide a new perspective for accelerating the molecular breeding of cattle through marker-assisted selection (MAS) strategies.

1. Introduction

With the continuous improvement in human material living standards, the requirements for beef quality, especially for various beef parts, are becoming higher. Therefore, improving carcass traits is a major concern of breeders for profitable beef production [1]. However, although many carcass traits, such as intramuscular fat and the rib-eye area, are moderately or highly hereditary [2], traditional direct selection methods are still inefficient in animal husbandry. Therefore, marker-assisted selection (MAS) strategies [3,4], genome-wide association studies (GWAS), and genome-wide sequencing are increasingly used to study genetic polymorphisms closely related to production traits [5,6].
Associations between insertion/deletion (InDel) mutations in promoter and intron regions and carcass traits in cattle have been previously reported. For instance, a 67-bp insertion in the upstream region of Adiponectin has been demonstrated to be significantly related to marbling score (MAR) in Hanwoo beef cattle [7]. Similarly, an 18-bp deletion in the eighth intron of Adenosine monophosphate deaminase 1 has been shown to significantly affect the carcass weight and slaughter weight in Qinchuan cattle [8]. However, research on more precise carcass traits has not been reported so far.
In vertebrates, the homeotic or HOX genes, which can be divided into four different HOX clusters (HOXA, HOXB, HOXC, and HOXD), are distributed on four different chromosomes, encoding 39 HOX genes [9,10]. It plays a vital role in regulating almost all basic cellular processes, homeotic transformations and the assignment of morphological traits on each body part along the anterior-posterior (AP) axis [11,12]. The HOXA cluster comprises homeobox A1, homeobox A2, homeobox A3, homeobox A4, homeobox A5, homeobox A6, homeobox A7, homeobox A9, homeobox A10, homeobox A11 (HOXA11) and homeobox A13 [13,14]. HOXA cluster genes may be related to the regulation of muscle growth. For instance, HOXA9 regulates the regenerative ability of satellite cells, providing myonuclei for the growth, hypertrophy, repair and regeneration of postnatal muscle in limbs of aged mice [15,16]. In addition, the lack of HOXA10 in the satellite cells can lead to genomic instability and cause abnormal chromosome distribution during division, which further leads to the impaired regeneration of hind limb muscles in mice [17]. Furthermore, mutations in the HOXA cluster gene also affect muscle growth [18].
Further, many studies have indicated that HOXA11, as one of the major genes of the HOXA cluster, is associated with limb development, especially in the zeugopod region (radius/ulna and tibia/fibula) in vertebrates [19,20,21]. Early studies have reported that when mice were completely deficient in HOXA11 and HOXD11, the entire bone and muscle loss in the zeugopod region were completely lost [22]. Swinehart et al. (2013) revealed that the absence of HOXA11 is accompanied by fusion of the extensor digitorum communis and lateralis, the extensor carpi radialis brevis and longus, and the absence of muscle groups, importantly, which is a direct result of the loss of HOXA11 function rather than the defect of the skeletal model [23]. In addition, the development of limb muscles has derived from satellite cell differentiation, and HOXA11 seems to regulate the muscle fate of satellite cells during myogenesis through differential expression [24]. Overall, HOXA11 plays a vital role in modulating muscle development. Muscle characteristics affect many carcass traits. Therefore, we regard it as a candidate gene affecting carcass traits.
The SDBCGR population is a new cattle breed in China [25], a hybrid of Bohai black cattle, Luxi cattle and Japanese black cattle, with high meat quality [26]. Therefore, this study focused on the SDBCGR population and explored the effects of the genetic variations of HOXA11 on carcass traits.

2. Materials and Methods

2.1. Animals’ Welfare

All animal procedures and experiments were permitted by the Animal Policy and Welfare Committee of the Northwest A&F University (protocol No. NWAFAC1008).

2.2. Cell Culture

Primary bovine myoblasts were isolated from the longissimus muscle of fetuses (3 to 4 months of development, n = 3) [27] and bovine primary adipocytes were isolated from the inguinal fat of fetuses (about 4 to 6 months old, n = 3) [28], respectively, according to previous studies in our laboratory [27,28]. Both cells were cultured in a growth medium containing 80% Dulbecco’s modified Eagle’s medium (DMEM, Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 20% fetal bovine serum (FBS; GIBCO, Rockville, MD, USA) and 1% penicillin-streptomycin (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) in a 5% carbon dioxide incubator at 37 °C. When cells begin to fuse, the growth medium is replaced by the differentiation medium. Myoblasts and adipocytes were cultured in DMEM differentiation medium containing 2% horse serum, 1% penicillin-streptomycin and containing 10% FBS, 10 g/mL insulin (Sigma, I6634, Shanghai, China), 0.5 mmol/L 3-isobutyl-1-methylxanthine (IBMX) (Sigma, I5879, Shanghai, China), 1 mol/L dexamethasone (Sigma, D4902, Shanghai, China) and 1% penicillin-streptomycin, respectively.

2.3. Total RNA Isolation, cDNA Synthesis and Quantitative Real-Time PCR (qRT-PCR)

The spleen, lungs, kidneys, longissimus muscles, visceral fat (perirenal fat) and brain tissues (two males and two females) of four calves were collected from Kingbull Livestock Co., Ltd., (Yangling, Shaanxi, China). Total RNA was isolated from tissue samples and different differentiation stages of myoblasts and adipocytes by Trizol reagent (TaKaRa, Dalian, China), and the RNA was prepared into cDNA (the cDNA was stored at −20 °C) by Prime ScriptTM RT reagent kit (Takara, Dalian, China) for gene expression profile analysis. Primer pairs for quantitative real-time polymerase chain reaction (qRT-PCR) were designed (Table 1). The 10 µL reaction system contained 5 µL 2 × ChamQ SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China), 0.5 µL cDNA, 0.5 µL of each primer, and 3.5 µL of ddH2O. The reaction procedure is as follows: pre-denaturation at 95 °C for 30 s; 42 cycles of denaturation at 95 °C for 10 s, annealing and elongation at 60 °C for 30 s. A total of 3 technical replicates were set up for the detection of gene expression levels by qRT-PCR. The relative expression level of genes in tissues was normalized using GAPDH and was calculated by the 2−ΔΔCt method [29].

2.4. Samples and Data Collection

A total of 640 (172 males, 466 females and 2 missing sexes) approximately 30-month-old healthy individuals of the SDBCGR population were randomly selected from two similar farms (Shandong Yangxin Yiliyuan Muslim meat Co., Ltd. and Shandong Kaiyuan animal husbandry Co., Ltd.) (Binzhou and Zhaoyuan, China), then neck muscle tissue samples of each individual were collected. All the healthy individuals had the similar physique and feeding conditions (including feed allocation, environment, and disease control) and were divided into male or female groups. Various carcass traits such as gross weight, left limb weight, etc. (Figure 1) are provided by these companies.

2.5. Genomic DNA Isolation, PCR Amplification and Genotyping by ME Method

The phenol–chloroform method was utilized to extract cattle genomic DNA from neck muscle tissues. The specific steps are described clearly in Li’s article [26].
The variant table information of HOXA11 was obtained from the Ensembl database, and two genetic variations were retrieved. Then, based on the reference sequence of bovine HOXA11 (GenBank accession no. NC_037331.1), two pairs of primers (P1-P2) were designed using NCBI primer blast. (Table 1). A total of 48 individuals were randomly selected for PCR amplification; the PCR reaction volume and amplification steps were the same as described by Huang et al., 2022 [30]. Next, PCR products were detected by 3.5% agarose gel electrophoresis, and the mutation frequencies of both InDel loci were found to be less than 5%, therefore, the genotype of all individual samples was detected by mathematical expectation (ME) method, which is fast and accurate for screening low frequency mutations in large samples [31,32,33]. Moreover, the formula of the ME method has been described in detail in the paper by Yang et al., 2016. The PCR products of each genotype were sequenced by Sangon Biological Technology (Xi’an, China).

2.6. Statistical Analysis of Population Genetics

Genotypic frequencies and allelic frequencies, Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium (LD) analyses of the HOXA11 InDel loci were calculated using the SHEsis platform [34]. Population genetic parameters such as heterozygosity (He), homozygosity (Ho), and the polymorphism information content (PIC) were calculated using the Pop gene (Table 2) [35]. Using SPSS (Version 25.0, IBM, Armonk, NY, USA), the correlation between different genotypes in the cattle HOXA11 gene and carcass traits was determined by an independent samples t-test, and the correlation between different diplotypes of these two loci and carcass traits was determined by one-way ANOVA. p < 0.05 was considered significant. A generalized linear model was constructed using the following formula: Yij = µ + Gi + Sj + eij, where Yij is the phenotypic value of carcass traits, µ is the overall population mean, Gi is the fixed effect of genotype or combined genotype, Sj is the fixed effect of gender, and eij is the random error [36].

3. Results

3.1. Expression Profiles of HOXA11 in Bovine Tissues, Myoblasts and Adipocytes

The HOXA11 gene with high expression in subcutaneous and visceral fat was found in the previous study [37]. According to the previous transcriptome data [37], we found that HOXA11 is also expressed in other tissues (Figure 2). Due to the important roles of fat and muscle in bovine development and beef quality, in order to reveal the function of HOXA11, we studied the expression profiles of HOXA11 in different tissues of cattle (Figure 3). We found low expression levels of HOXA11 in the spleen, brain and lung, and high expression levels in the fat and kidney, consistent with transcriptome data [37], but high expression levels of HOXA11 in skeletal muscle, which contradict transcriptome data (Figure 3). At the cellular aspect, we measured the expression level of HOXA11, C/EBPα, PPARγ and FABP4 genes at different stages (0, 2, 4, 6, 8 and 10 days; n = 3) of adipocyte differentiation (Figure 4), and the expression levels of HOXA11, DES, MyHC and MyoG at different stages (−1, 0, 1, 2, 3, 4 and 5 days; n = 3) of myoblast differentiation (Figure 5), which were important in the regulation of adipocytes and myoblast, respectively. The expression characteristic of HOXA11 showed a significant positive correlation with the expression of C/EBPα (Pearson’s r = 0.828, p = 0.042) (Table 3), DES (Pearson’s r = 0.840, p = 0.018), MyHC (Pearson’s r = 0.863, p = 0.012), and MyoG (Pearson’s r = 0.913, p = 0.004) (Table 4). These results suggested that HOXA11 might be involved in the development of bovine myoblasts and adipocytes.

3.2. Identification of InDels by the ME Method and Sequencing Validation

After testing 48 random DNA samples, the electrophoresis pattern and sequencing map showed that both mutation sites within the HOXA11 gene are polymorphic, which were detected at 3953-bp upstream (NC_037331.1: g. 68853364-68853365), named as P1-Ins-4-bp, and intron 1 (NC_037331.1: g. 68859510-68859517), named as P2-Del-8-bp (Table 1). Both mutations were only present in the homozygous reference or heterozygous states for the sample tested. The P1-Ins-4-bp locus had the homozygous deletion (DD) and heterozygous genotype (ID), while the P2-Del-8-bp locus had the homozygous insertion (II) and heterozygous genotype (ID) (Figure 6). Statistical analysis showed that the mutation frequency was less than 5%, so we decided to use the ME method for subsequent experiments.
According to the estimated mutation frequency and the equation obtained by the ME method, the optimal number of individuals in one mixed group (NGn) was 8 (P1-Ins-4-bp) and 11 (P2-Del-8-bp) (Figure 7, Table 5). The predicted reaction times of P1-Ins-4-bp and P2-Del-8-bp by formula were 176 and 126, respectively. It has been shown that the actual reaction times (RT) depend on the presence of a single band in a mixed group consisting of different cattle. However, when detecting the P1-Ins-4-bp locus with the ME method, we found false positive phenomena with two bands in all mixed groups, but when we tested with a single sample, there were no false-positive phenomena; this may be caused by some problems with the primer itself or contamination. Therefore, the P1-Ins-4-bp locus was detected with a single sample, the P2-Del-8-bp locus was detected via the ME method. The reaction times of P2-Del-8-bp were counted as 221. Compared with the traditional detection method, the PCR times of P2-Del-8-bp were decreased by 65.47% using the ME method.

3.3. Genotypic Frequencies and Population Indices

The frequency of the DD genotype (0.897) was higher than the ID genotype (0.103) within the P1-Ins-4-bp locus. Similarly, for the P2-Del-8-bp locus, the frequency of II genotype was higher (0.981). In addition, both mutation sites identified in HOXA11 conformed to the HWE (p > 0.05). Moreover, the PIC value showed that the two detected HOXA11 mutations in the SDBCGR population were characterized as low polymorphic (0 < PIC ≤ 0.25) (Table 2).

3.4. Linkage Disequilibrium (LD) and Haplotype Analyses

To further explore whether there is a linkage between these two InDel loci of HOXA11, we performed LD analysis using the SHEsis online platform. The results showed that the values for D’ and r2 were 1.00 and 0.13, respectively, indicating that there was not strong linkage between P1-Ins-4-bp and P2-Del-8-bp (Figure 8). The haplotype analysis results for HOXA11 revealed four haplotypes, and DP1-Ins-4-bp-IP2-Del-8-bp had the highest frequency (Figure 9).

3.5. Association Analysis between HOXA11 InDels/Diplotypes and Carcass Traits

The association analysis between two InDel loci in the HOXA11 gene and more than 50 carcass traits has been studied in different genders (172 males and 466 females) of the SDBCGR population. Significant associations were observed between the P1-Ins-4-bp locus in the HOXA11 gene and beef shoulder (p = 0.012) and tongue root (p = 0.004) in the female SDBCGR population (Table 6), whereas no significant associations were observed for males. For females, individuals with the heterozygous genotype had a better beef shoulder phenotype than individuals with the homozygous genotype; however, the opposite was true for the tongue root phenotype. (p < 0.05; Table 6, Figure 10). Therefore, which genotype is more favorable depends on the specific breeding situation. In addition, the P2-Del-8-bp locus in the HOXA11 gene was significantly associated with back tendon (p = 0.008), money tendon (p = 2.84 × 10−4), thick flank (p = 0.034), beef shin (p = 9.09 × 10−7), triangle thick flank (p = 0.04), triangle flank (p = 1.00 × 10−6), rump (p = 0.018) and small tenderloin (p = 0.043) in the female SDBCGR population. Importantly, individuals with the homozygous genotype had a superior phenotype than individuals with the heterozygous genotype. Furthermore, for males, the brisket fat of individuals with the heterozygous genotype was the dominant genotype (p < 0.05; Table 7, Figure 11 and Figure 12). Additionally, in the diplotype analysis, individuals with ID-II diplotypes had a better beef shoulder phenotype than individuals with DD-II diplotypes in females (p < 0.05) (Table 8, Figure 13). However, for the carcass traits of the male SDBCGR population, no significant difference was found between diplotypes.

4. Discussion

In this study, polymorphisms at the upstream P1-Ins-4-bp locus and the intron P2-Del-8-bp locus of the HOXA11 gene were detected in association with SDBCGR bovine carcass traits (beef shoulder, tongue root, back tendon, money tendon, thick flank, beef shin, triangle thick flank, triangle flank, rump, etc.). Moreover, for the P2-Del-8-bp locus, we adopted the ME method for detection. Compared with the traditional method for single detection of a large number of samples, it not only saves time and money, but is easy to operate. In our laboratory, we have previously used this method to detect polymorphism in large samples of cattle and sheep [31,32,33]. In this study, compared with traditional methods, the number of responses required for the accuracy of the ME strategy was reduced to 221 times (SDBCGR, n = 640), making the ME strategy simpler and more effective. Furthermore, our results revealed that the P1-Ins-4-bp locus and P2-Del-8-bp locus of the cattle HOXA11 gene were present in HWE in SDBCGR (p > 0.05).
More interestingly, in our study, almost all significant carcass traits were derived from females. Previous studies showed that HOXA11 itself can determine the transcription of Prolactin (PRL) gene in endometrial stromal cells, and there is an interaction between HOXA11 and FOXO1. When HOXA11 binds to FOXO1, it can also regulate the up-regulation of IGFBP-1 [38,39]. Therefore, we speculated that HOXA11 can affect body growth by regulating hormone secretion in animals.
Previous studies have shown that HOXA11 is essential for the regulation of limb skeletal development, especially of the zeugopod region [19,40]. Interestingly, the carcass traits of the limbs involved in our study were the back tendon and money tendon. On the one hand, during embryonic limb development, HOXA11 may regulate the migration and aggregation as well as precursor cell differentiation through expression in limb muscle precursor and mesenchymal cells, respectively, thereby affecting limb muscle shape and arrangement. It has been reported that the HOXA11 protein is expressed in the muscle precursor cells from the dermomyotomal compartment invading the wing bud at stage 19, and this expression is caused by the induced interaction of the limb mesenchyme [41]. Subsequently, as the muscle precursor cells migrate to the wing buds and aggregate into dorsal and ventral muscle masses, the level of HOXA11 protein in the muscle mass gradually decreases until it is no longer detectable in the muscle mass at stage 26 [42]. This indicates that during the early limb bud formation, the HOXA11 gene in muscle precursor cells activated by mesenchymal cells might directly affect the migration and accumulation of muscle precursor cells in limb buds, but it no longer directly affects muscle precursor cells after the formation of muscle mass. In addition, when muscle precursor cells assemble and migrate to form dorsal and ventral muscle masses, different muscle precursor population tissues will differentiate to form different muscle bundles; HOXA11 expressed in mesenchyme may change the microenvironment of muscle precursor cells by regulating the expression patterns of extracellular matrix around muscle precursors, thereby indirectly affecting the migration, proliferation and differentiation of muscle precursors. Studies have shown that HOXA11 is expressed in muscle connective tissues and tendons in the zeugopod region of the mouse forelimb, but not in muscles, and that HOXA11/HOXD11 double mutant mice are accompanied by fusion between muscles, and the absence or disorganization of muscle groups and tendons. More importantly, this is not a secondary effect due to defects in skeletal patterning, but a direct result of the loss of the HOXA11 function [23]. Moreover, HOXA11 knockdown in the uterosacral ligaments increases the degradation of the extracellular matrix [43]. Since connective tissues and ligaments are derived from embryonic mesenchymal cells, one possible mechanism is that during embryonic limb development, the mutation of HOXA11 may directly regulate the migration and aggregation of precursor cells by regulating its expression in limb muscle precursor cells, as well as indirectly regulate the migration, proliferation and differentiation of precursor cells by regulating its expression in mesenchymal cells, thus, affecting the shape and assemble of limb muscles and resulting in changes in muscle weight in different parts of the limb.
On the other hand, after birth, HOXA11 may affect the proliferation of muscle satellite cells in the limbs, which in turn affects postnatal muscle growth and maintains its hypertrophy, thereby affecting the shape of postnatal adult muscles. Both the HOXA10 gene and HOXA11 are highly expressed in mouse limb muscle satellite cells and the lack of the HOXA10 gene in muscle satellite cells can result in genomic instability caused by abnormal chromosome distribution during the division of muscle stem cells, leading to stagnation of muscle satellite cell proliferation and hind limb muscle regeneration disorders [17]. The rapid hypertrophy of muscle fibers in the initial phase of muscle growth is due to the provision of muscle nuclei with satellite cells between birth and three weeks after birth [44]. In addition, after three weeks of birth, the addition of muscle nuclei from satellite cells is indispensable for adult muscle hypertrophy [45]. Therefore, another potential mechanism is that after embryo birth, HOXA11 may regulate the proliferation and regeneration capacity of muscle satellite cells by regulating their expression, thereby affecting the growth and hypertrophy of muscle after the birth of an embryo, and further influencing the shape and assembling of limb muscles to change the muscle weight in different parts of the limb. Therefore, we believe that the HOXA11 gene can promote muscle growth. However, specific investigations on how the HOXA11 gene mutation regulates the muscle weight in different parts of the bovine body require further study.

5. Conclusions

In conclusion, in this study, we found that the HOXA11 gene was highly expressed in muscle and fat tissues, indicating that it might be involved in the regulation of muscle and fat development. Then, we found that two InDel variations of the HOXA11 gene were significantly correlated with the carcass traits of SDBCGR population. Our results can be used in future cattle breeding strategies based on MAS to improve the economic efficiency of the cattle industry.

Author Contributions

E.S. and X.L. designed the experiment. S.Z., Z.A., F.J., E.S. and X.L. provided experimental ideas. Y.H., K.Z., Y.L., S.Z. and Z.A. performed all the experiments. F.J. and E.S. provided resources. Y.H., K.Z. and Y.L. prepared all the figures and tables and drafted the manuscript. Y.H., K.Z., S.Z., Z.A., F.J., E.S. and X.L. contributed to the revision of the manuscript. Y.H., K.Z., S.Z., Z.A., F.J., E.S. and X.L. assisted in revising the final version of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Agricultural Improved Seed Project of Shandong Province (No. 2020LZGC014) and the National Sci-Tech Innovation Project for Undergraduate of Northwest A&F University (No. 202210712103).

Institutional Review Board Statement

All experiments in this study were approved by the North- west A&F University (IACUCNWAFU; protocol number NWAFAC1008). In addition, the permission of the ethics committee was obtained to use the experimental animals in the study.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are available upon request from corresponding author.

Acknowledgments

We would like to thank Enliang Song and his team at Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Jinan, Shandong, China for the collection of Shandong Black Cattle Genetic Resource population samples.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Silva-Vignato, B.; Coutinho, L.L.; Poleti, M.D.; Cesar, A.S.; Moncau, C.T.; Regitano, L.C.; Balieiro, J.C. Gene co-expression networks associated with carcass traits reveal new pathways for muscle and fat deposition in Nelore cattle. BMC Genom. 2019, 20, 32. [Google Scholar] [CrossRef]
  2. Hay, E.H.; Roberts, A. Genome-wide association study for carcass traits in a composite beef cattle breed. Livest. Sci. 2018, 213, 35–43. [Google Scholar] [CrossRef]
  3. Jin, Y.; Yang, Q.; Zhang, M.; Zhang, S.; Cai, H.; Dang, R.; Lei, C.; Chen, H.; Lan, X. Identification of a Novel Polymorphism in Bovine lncRNA ADNCR Gene and Its Association with Growth Traits. Anim. Biotechnol. 2019, 30, 159–165. [Google Scholar] [CrossRef]
  4. Li, H.; Xu, H.; Akhatayeva, Z.; Liu, H.; Lin, C.; Han, X.; Lu, X.; Lan, X.; Zhang, Q.; Pan, C. Novel indel variations of the sheep FecB gene and their effects on litter size. Gene 2021, 767, 145176. [Google Scholar] [CrossRef]
  5. Niu, Q.; Zhang, T.; Xu, L.; Wang, T.; Wang, Z.; Zhu, B.; Zhang, L.; Gao, H.; Song, J.; Li, J.; et al. Integration of selection signatures and multi-trait GWAS reveals polygenic genetic architecture of carcass traits in beef cattle. Genomics 2021, 113, 3325–3336. [Google Scholar] [CrossRef]
  6. Chang, T.; Xia, J.; Xu, L.; Wang, X.; Zhu, B.; Zhang, L.; Gao, X.; Chen, Y.; Li, J.; Gao, H. A genome-wide association study suggests several novel candidate genes for carcass traits in Chinese Simmental beef cattle. Anim. Genet. 2018, 49, 312–316. [Google Scholar] [CrossRef]
  7. Choi, Y.; Davis, M.E.; Chung, H. Effects of genetic variants in the promoter region of the bovine adiponectin (ADIPOQ) gene on marbling of Hanwoo beef cattle. Meat Sci. 2015, 105, 57–62. [Google Scholar] [CrossRef]
  8. He, H.; Liu, X.; Gu, Y.; Liu, Y. A novel 18-bp deletion mutation of the AMPD1 gene affects carcass traits in Qinchuan cattle. Mol. Biol. Rep. 2010, 37, 3945–3949. [Google Scholar] [CrossRef]
  9. Rinn, J.L.; Kertesz, M.; Wang, J.K.; Squazzo, S.L.; Xu, X.; Brugmann, S.A.; Goodnough, L.H.; Helms, J.A.; Farnham, P.J.; Segal, E.; et al. Functional Demarcation of Active and Silent Chromatin Domains in Human HOX Loci by Noncoding RNAs. Cell 2007, 129, 1311–1323. [Google Scholar] [CrossRef]
  10. Amores, A.; Force, A.; Yan, Y.-L.; Joly, L.; Amemiya, C.; Fritz, A.; Ho, R.K.; Langeland, J.; Prince, V.; Wang, Y.-L.; et al. Zebrafish hox Clusters and Vertebrate Genome Evolution. Science 1998, 282, 1711–1714. [Google Scholar] [CrossRef]
  11. Hombría, J.C.; Lovegrove, B. Beyond homeosis—HOX function in morphogenesis and organogenesis. Differentiation 2003, 71, 461–476. [Google Scholar] [CrossRef] [PubMed]
  12. Poliacikova, G.; Maurel-Zaffran, C.; Graba, Y.; Saurin, A.J. Hox Proteins in the Regulation of Muscle Development. Front. Cell Dev. Biol. 2021, 9, 731996. [Google Scholar] [CrossRef] [PubMed]
  13. Krumlauf, R. Hox genes in vertebrate development. Cell 1994, 78, 191–201. [Google Scholar] [CrossRef] [PubMed]
  14. Duboule, D.; Morata, G. Colinearity and functional hierarchy among genes of the homeotic complexes. Trends Genet. 1994, 10, 358–364. [Google Scholar] [CrossRef]
  15. Schwörer, S.; Becker, F.; Feller, C.; Baig, A.H.; Köber, U.; Henze, H.; Kraus, J.M.; Xin, B.; Lechel, A.; Lipka, D.B.; et al. Epigenetic stress responses induce muscle stem-cell ageing by Hoxa9 developmental signals. Nature 2016, 540, 428–432. [Google Scholar] [CrossRef]
  16. Yin, H.; Price, F.; Rudnicki, M.A. Satellite Cells and the Muscle Stem Cell Niche. Physiol. Rev. 2013, 93, 23–67. [Google Scholar] [CrossRef]
  17. Yoshioka, K.; Nagahisa, H.; Miura, F.; Araki, H.; Kamei, Y.; Kitajima, Y.; Seko, D.; Nogami, J.; Tsuchiya, Y.; Okazaki, N.; et al. Hoxa10 mediates positional memory to govern stem cell function in adult skeletal muscle. Sci. Adv. 2021, 7, eabd7924. [Google Scholar] [CrossRef]
  18. Pineault, K.M.; Wellik, D.M. Hox Genes and Limb Musculoskeletal Development. Curr. Osteoporos. Rep. 2014, 12, 420–427. [Google Scholar] [CrossRef]
  19. Zakany, J.; Duboule, D. The role of Hox genes during vertebrate limb development. Curr. Opin. Genet. Dev. 2007, 17, 359–366. [Google Scholar] [CrossRef]
  20. Wang, K.C.; Helms, J.A.; Chang, H.Y. Regeneration, repair and remembering identity: The three Rs of Hox gene expression. Trends Cell Biol. 2009, 19, 268–275. [Google Scholar] [CrossRef] [Green Version]
  21. Pineault, K.M.; Song, J.Y.; Kozloff, K.M.; Lucas, D.; Wellik, D.M. Hox11 expressing regional skeletal stem cells are progenitors for osteoblasts, chondrocytes and adipocytes throughout life. Nat. Commun. 2019, 10, 3168. [Google Scholar] [CrossRef]
  22. Davis, A.P.; Witte, D.P.; Hsieh-Li, H.M.; Potter, S.S.; Capecchi, M.R. Absence of radius and ulna in mice lacking hoxa-11 and hoxd-11. Nature 1995, 375, 791–795. [Google Scholar] [CrossRef]
  23. Swinehart, I.T.; Schlientz, A.J.; Quintanilla, C.A.; Mortlock, D.P.; Wellik, D.M. Hox11 genes are required for regional patterning and integration of muscle, tendon and bone. Development 2013, 140, 4574–4582. [Google Scholar] [CrossRef]
  24. De Las Heras-Saldana, S.; Chung, K.Y.; Lee, S.H.; Gondro, C. Gene expression of Hanwoo satellite cell differentiation in longissimus dorsi and semimembranosus. BMC Genom. 2019, 20, 156. [Google Scholar] [CrossRef]
  25. Liu, R.; Liu, X.; Bai, X.; Xiao, C.; Dong, Y. Different expression of lipid metabolism-related genes in Shandong black cattle and Luxi cattle based on transcriptome analysis. Sci. Rep. 2020, 10, 21915. [Google Scholar] [CrossRef]
  26. Li, X.; Jiang, E.; Zhang, K.; Zhang, S.; Jiang, F.; Song, E.; Chen, H.; Guo, P.; Lan, X. Genetic Variations within the Bovine CRY2 Gene Are Significantly Associated with Carcass Traits. Animals 2022, 12, 1616. [Google Scholar] [CrossRef]
  27. Zhang, X.; Yang, S.; Kang, Z.; Ru, W.; Shen, X.; Li, M.; Lan, X.; Chen, H. circMEF2D Negatively Regulated by HNRNPA1 Inhibits Proliferation and Differentiation of Myoblasts via miR-486-PI3K/AKT Axis. J. Agric. Food Chem. 2022, 70, 8145–8163. [Google Scholar] [CrossRef]
  28. Zhang, S.; Jiang, E.; Kang, Z.; Bi, Y.; Liu, H.; Xu, H.; Wang, Z.; Lei, C.; Chen, H.; Lan, X. CircRNA profiling reveals an abundant circBDP1 that regulates bovine fat development by sponging miR-181b/miR-204 targeting Sirt1/TRARG1. J. Agric. Food Chem. 2022, 70, 14312–14328. [Google Scholar] [CrossRef]
  29. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  30. Huang, Y.; Su, P.; Akhatayeva, Z.; Pan, C.; Zhang, Q.; Lan, X. Novel InDel variations of the Cry2 gene are associated with litter size in Australian White sheep. Theriogenology 2022, 179, 155–161. [Google Scholar] [CrossRef]
  31. Yang, Q.; Zhang, S.; Liu, L.; Cao, X.; Lei, C.; Qi, X.; Lin, F.; Qu, W.; Qi, X.; Liu, J.; et al. Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene. Prion 2016, 10, 409–419. [Google Scholar] [CrossRef] [PubMed]
  32. Li, J.; Zhu, X.; Ma, L.; Xu, H.; Cao, X.; Luo, R.; Chen, H.; Sun, X.; Cai, Y.; Lan, X. Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method. Prion 2017, 11, 143–150. [Google Scholar] [CrossRef] [PubMed]
  33. Li, H.; Wang, X.; Chen, H.; Qu, L.; Lan, X. A 17-bp InDel (rs668420586) within goat CHCHD7 gene located in growth-related QTL affecting body measurement traits. 3 Biotech 2020, 10, 441. [Google Scholar] [CrossRef] [PubMed]
  34. Shi, T.; Peng, W.; Yan, J.; Cai, H.; Lan, X.; Lei, C.; Bai, Y.; Chen, H. A novel 17 bp indel in the SMAD3 gene alters transcription level, contributing to phenotypic traits in Chinese cattle. Arch. Anim. Breed. 2016, 59, 151–157. [Google Scholar] [CrossRef]
  35. Chen, F.; Shi, J.; Luo, Y.-Q.; Sun, S.-Y.; Pu, M. Genetic Characterization of the Gypsy Moth from China (Lepidoptera, Lymantriidae) Using Inter Simple Sequence Repeats Markers. PLoS ONE 2013, 8, e73017. [Google Scholar] [CrossRef]
  36. Wei, Z.; Wang, K.; Wu, H.; Wang, Z.; Pan, C.; Chen, H.; Lan, X. Detection of 15-bp Deletion Mutation within PLAG1 Gene and Its Effects on Growth Traits in Goats. Animals 2021, 11, 2064. [Google Scholar] [CrossRef]
  37. Zhang, S.; Xu, H.; Jiang, E.; Akhatayeva, Z.; Jiang, F.; Song, E.; Pan, C.; Chen, H.; Lan, X. Screening of Bovine Tissue-Specific Expressed Genes and Identification of Genetic Variation within an Adipose Tissue-Specific lncRNA Gene. Front. Vet. Sci. 2022, 9, 887520. [Google Scholar] [CrossRef]
  38. Lynch, V.J.; Brayer, K.; Gellersen, B.; Wagner, G.P. HoxA-11 and FOXO1A Cooperate to Regulate Decidual Prolactin Expression: Towards Inferring the Core Transcriptional Regulators of Decidual Genes. PLoS ONE 2009, 4, e6845. [Google Scholar] [CrossRef]
  39. Nnamani, M.C.; Ganguly, S.; Erkenbrack, E.M.; Lynch, V.J.; Mizoue, L.S.; Tong, Y.; Darling, H.L.; Fuxreiter, M.; Meiler, J.; Wagner, G.P. A Derived Allosteric Switch Underlies the Evolution of Conditional Cooperativity between HOXA11 and FOXO1. Cell Rep. 2016, 15, 2097–2108. [Google Scholar] [CrossRef]
  40. Raines, A.M.; Magella, B.; Adam, M.; Potter, S.S. Key pathways regulated by HoxA9,10,11/HoxD9,10,11 during limb development. BMC Dev. Biol. 2015, 15, 28. [Google Scholar] [CrossRef] [Green Version]
  41. Hayashi, K.; Ozawa, E. Myogenic cell migration from somites is induced by tissue contact with medial region of the presumptive limb mesoderm in chick embryos. Development 1995, 121, 661–669. [Google Scholar] [CrossRef]
  42. Yamamoto, M.; Gotoh, Y.; Tamura, K.; Tanaka, M.; Kawakami, A.; Ide, H.; Kuroiwa, A. Coordinated expression of Hoxa-11 and Hoxa-13 during limb muscle patterning. Development 1998, 125, 1325–1335. [Google Scholar] [CrossRef]
  43. Ma, Y.; Guess, M.; Datar, A.; Hennessey, A.; Cardenas, I.; Johnson, J.; Connell, K.A. Knockdown of Hoxa11 In Vivo in the Uterosacral Ligament and Uterus of Mice Results in Altered Collagen and Matrix Metalloproteinase Activity. Biol. Reprod. 2012, 86, 100. [Google Scholar] [CrossRef]
  44. White, R.B.; Biérinx, A.-S.; Gnocchi, V.F.; Zammit, P.S. Dynamics of muscle fibre growth during postnatal mouse development. BMC Dev. Biol. 2010, 10, 21. [Google Scholar] [CrossRef]
  45. Randolph, M.E.; Pavlath, G.K. A muscle stem cell for every muscle: Variability of satellite cell biology among different muscle groups. Front. Aging Neurosci. 2015, 7, 190. [Google Scholar] [CrossRef] [Green Version]
Cells 12 00539 g001 550
Figure 1. The distribution map of cattle carcass traits involved in this study.
Figure 1. The distribution map of cattle carcass traits involved in this study.
Cells 12 00539 g001
Cells 12 00539 g002 550
Figure 2. The expression level of HOXA11 at different tissues of cattle by transcriptome sequencing. Bars represent mean, error bars represent standard error of mean (SEM).
Figure 2. The expression level of HOXA11 at different tissues of cattle by transcriptome sequencing. Bars represent mean, error bars represent standard error of mean (SEM).
Cells 12 00539 g002
Cells 12 00539 g003 550
Figure 3. The relative expression level of HOXA11 at different tissues of calves detected by qRT-PCR. Bars represent mean, error bars represent standard error of mean (SEM).
Figure 3. The relative expression level of HOXA11 at different tissues of calves detected by qRT-PCR. Bars represent mean, error bars represent standard error of mean (SEM).
Cells 12 00539 g003
Cells 12 00539 g004 550
Figure 4. Expression characteristics of HOXA11 and fat-development-associated genes in bovine adipocytes. Expression trend of HOXA11 (A), C/EBPα (B), PPARγ (C) and FABP4 (D) in bovine adipocytes in differentiation medium (0, 2, 4, 6, 8 and 10 days; n = 3), and the expression trend line chart of these genes (E). The columns with different superscripts (A,B) within each figure differ significantly at p < 0.01 level. Bars represent mean, error bars represent standard error of mean (SEM).
Figure 4. Expression characteristics of HOXA11 and fat-development-associated genes in bovine adipocytes. Expression trend of HOXA11 (A), C/EBPα (B), PPARγ (C) and FABP4 (D) in bovine adipocytes in differentiation medium (0, 2, 4, 6, 8 and 10 days; n = 3), and the expression trend line chart of these genes (E). The columns with different superscripts (A,B) within each figure differ significantly at p < 0.01 level. Bars represent mean, error bars represent standard error of mean (SEM).
Cells 12 00539 g004
Cells 12 00539 g005 550
Figure 5. Expression characteristics of HOXA11 and muscle-development-associated genes in bovine myoblasts. Expression trend of HOXA11 (A), MyHC (B), MyoG (C) and DES (D) in bovine myoblasts cultured in proliferation medium (−1 day) and differentiation medium (0, 1, 2, 3, 4 and 5 days; n = 3), and the expression trend line chart of these genes (E). The columns with different superscripts (A–D) within each figure differ significantly at p < 0.01 level. Bars represent mean, error bars represent standard error of mean (SEM).
Figure 5. Expression characteristics of HOXA11 and muscle-development-associated genes in bovine myoblasts. Expression trend of HOXA11 (A), MyHC (B), MyoG (C) and DES (D) in bovine myoblasts cultured in proliferation medium (−1 day) and differentiation medium (0, 1, 2, 3, 4 and 5 days; n = 3), and the expression trend line chart of these genes (E). The columns with different superscripts (A–D) within each figure differ significantly at p < 0.01 level. Bars represent mean, error bars represent standard error of mean (SEM).
Cells 12 00539 g005
Cells 12 00539 g006 550
Figure 6. Agarose electrophoresis and sequencing chromas of InDels in the cattle HOXA11 gene. Agarose electrophoresis and sequencing chromas for cattle HOXA11 P1-Ins-4-bp InDel. Agarose electrophoresis and sequencing chromas for cattle HOXA11 P2-Del-8-bp InDel. Sequencing chromas showed homozygous insertion type (II), heterozygous genotype (ID) and homozygous deletion type (DD). The A represents the non-target fragment, which is heteroduplex.
Figure 6. Agarose electrophoresis and sequencing chromas of InDels in the cattle HOXA11 gene. Agarose electrophoresis and sequencing chromas for cattle HOXA11 P1-Ins-4-bp InDel. Agarose electrophoresis and sequencing chromas for cattle HOXA11 P2-Del-8-bp InDel. Sequencing chromas showed homozygous insertion type (II), heterozygous genotype (ID) and homozygous deletion type (DD). The A represents the non-target fragment, which is heteroduplex.
Cells 12 00539 g006
Cells 12 00539 g007 550
Figure 7. The reaction times of different sizes of one mixed group. The least reaction time will be obtained when the estimated mutation frequencies are 1% and 2%, and the sample sizes in one group are 11 and 8, respectively.
Figure 7. The reaction times of different sizes of one mixed group. The least reaction time will be obtained when the estimated mutation frequencies are 1% and 2%, and the sample sizes in one group are 11 and 8, respectively.
Cells 12 00539 g007
Cells 12 00539 g008 550
Figure 8. Linkage equilibrium analysis of P1-Ins-4-bp and P2-Del-8-bp in the SDBCGR population.
Figure 8. Linkage equilibrium analysis of P1-Ins-4-bp and P2-Del-8-bp in the SDBCGR population.
Cells 12 00539 g008
Cells 12 00539 g009 550
Figure 9. Haplotype frequencies of the HOXA11 gene in the SDBCGR population.
Figure 9. Haplotype frequencies of the HOXA11 gene in the SDBCGR population.
Cells 12 00539 g009
Cells 12 00539 g010 550
Figure 10. Association of the P1-Ins-4-bp InDel with carcass traits in the female SDBCGR population.
Figure 10. Association of the P1-Ins-4-bp InDel with carcass traits in the female SDBCGR population.
Cells 12 00539 g010
Cells 12 00539 g011 550
Figure 11. Association of the P2-Del-8-bp InDel with carcass traits in the female SDBCGR population.
Figure 11. Association of the P2-Del-8-bp InDel with carcass traits in the female SDBCGR population.
Cells 12 00539 g011
Cells 12 00539 g012 550
Figure 12. Association of the P2-Del-8-bp InDel with carcass traits in the male SDBCGR population.
Figure 12. Association of the P2-Del-8-bp InDel with carcass traits in the male SDBCGR population.
Cells 12 00539 g012
Cells 12 00539 g013 550
Figure 13. Association of diplotypes with carcass traits in the female SDBCGR population.
Figure 13. Association of diplotypes with carcass traits in the female SDBCGR population.
Cells 12 00539 g013
Table
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Primer NamesPrimer Pairs (5′-3′)Sizes (bp)LocationNote
P1-Ins-4-bpF:ACTGACCATGCCAAGGCTAC148/144Upstreamrs515880802
R:TTGAGCTCTGCACTCCACTC
P2-Del-8-bpF:TAGTCGGGGGACCTTGCTTG159/151Intron 1rs517582703
R:GCTTCTTTCGGGTTCGTTGG
MyoGF:CCAGTGAATGCAGCTCCCATA88Exon 2–3qRT-PCR
R:AGCAGATGATCCCCTGGGTTG
MyHCF:TGCTCATCTCACCAAGTTCC150Exon 41–42qRT-PCR
R:CACTCTTCACTCTCATGGACC
DESF:AACAATTTGGCTGCCTTCCG97Exon 2–3qRT-PCR
R:ACGCGATTTCCTCGTTGAGA
C/EBPαF:TGGACAAGAACAGCAACGAG130Exon 1qRT-PCR
R:TTGTCACTGGTCAGCTCCAG
PPARγF:AGGATGGGGTCCTCATATCC121Exon 6qRT-PCR
R:GCGTTGAACTTCACAGCAAA
FABP4F:AAGTCAAGAGCATCGTAA111Exon 2–3qRT-PCR
R:CCAGCACCATCTTATCAT
HOXA11F:GGCCACACTGAGGACAAG144Exon 1–2qRT-PCR
R:TAGTTGCAGGCGTTTCTCTT
GAPDHF:ACCACTTTGGCATCGTGGAG76Exon 7–8qRT-PCR
R:GGGCCATCCACAGTCTTCTG
Table
Table 2. Genetic parameters of InDels within the HOXA11 gene in SDBCGR population.
Table 2. Genetic parameters of InDels within the HOXA11 gene in SDBCGR population.
LociSizesGenotypic
Frequencies		Allelic
Frequencies		HWEPopulation
Parameters
NIIIDDDIDp-ValueHoHeNePIC
P1-Ins-4-bp41600.1030.8970.0520.948p > 0.050.9020.0981.1090.093
P2-Del-8-bp6400.9810.01900.9910.009p > 0.050.9810.0191.0190.018
Note: HWE, Hardy–Weinberg equilibrium; Ho, homozygosity; He, heterozygosity; Ne, effective allele numbers; PIC, Polymorphism information content.
Table
Table 3. Pearson correlation analyses between the expression of HOXA11 and fat-development-associated genes in differentiation of adipocytes.
Table 3. Pearson correlation analyses between the expression of HOXA11 and fat-development-associated genes in differentiation of adipocytes.
GenePearson’s rSig. (2-Tailed)
C/EBPα0.828 *0.042
PPARγ0.4750.341
FABP40.2880.580
Note: * p < 0.05.
Table
Table 4. Pearson correlation analyses between the expression of HOXA11 and muscle-development-associated genes in differentiation of muscle cells.
Table 4. Pearson correlation analyses between the expression of HOXA11 and muscle-development-associated genes in differentiation of muscle cells.
GenePearson’s rSig. (2-Tailed)
DES0.840 *0.018
MyHC0.863 *0.012
MyoG0.913 **0.004
Note: * p < 0.05; ** p < 0.01.
Table
Table 5. The reaction times of different loci in the SDBCGR population.
Table 5. The reaction times of different loci in the SDBCGR population.
TypesP1-Ins-4-bpP2-Del-8-bp
Sample sizes640640
Estimated mutation frequency0.020.01
NR1 (number of individuals in one reaction time)11
RT1 (reaction times)640640
NGn (the optimal number of individuals in one mixed group)811
pRTn (predicted reaction times by the formulate)176126
pRR (predicted reduction rate)72.50%80.31%
RTn (reaction times)-221
RR (reduction rate)-65.47%
Table
Table 6. Associations of the P1-Ins-4-bp InDel with carcass traits in the female SDBCGR population.
Table 6. Associations of the P1-Ins-4-bp InDel with carcass traits in the female SDBCGR population.
Carcass TraitsObserved Genotypes (Mean ± SE)p Values
IDII
Beef shoulder (kg)1.30 a ± 0.1 (n = 29)1.02 b ± 0.02 (n = 163)0.012
Tongue root (kg)1.53 B ± 0.14 (n = 4)2.02 A ± 0.05 (n = 29)0.004
Note: Numbers with different letters (a, b) means p < 0.05, (A, B) means p < 0.01.
Table
Table 7. Associations of the P2-Del-8-bp InDel with carcass traits in different genders of the SDBCGR population.
Table 7. Associations of the P2-Del-8-bp InDel with carcass traits in different genders of the SDBCGR population.
Carcass TraitsObserved Genotypes (Mean ± SE)p Values
IDII
Female
Back tendon (kg)0.55 B ± 0.06 (n = 6)0.71 A ± 0.01 (n = 363)0.008
Money tendon (kg)1.06 B ± 0.02 (n = 6)1.21 A ± 0.01 (n = 366)2.84 × 10−4
Thick flank (kg)9.47 b ± 0.53 (n = 6)11.37 a ± 0.11 (n = 363)0.034
Beef shin (kg)14.17 B ± 0.17 (n = 6)15.92 A ± 0.28 (n = 323)9.09 × 10−7
Triangle thick flank (kg)2.09 b ± 0.1 (n = 6)2.53 a ± 0.03 (n = 367)0.040
Triangle flank (kg)3.79 B ± 0.08 (n = 6)4.78 A ± 0.05 (n = 367)1.00 × 10−6
Rump (kg)3.90 b ± 0.15 (n = 6)4.73 a ± 0.04 (n = 365)0.018
Small tenderloin (kg)2.00 b ± 0.18 (n = 6)2.43 a ± 0.03 (n = 358)0.043
Male
Brisket fat (kg)4.48 a ± 0.96 (n = 4)3.36 b ± 0.11 (n = 82)0.045
Note: Numbers with different letters (a, b) means p < 0.05, (A, B) means p < 0.01.
Table
Table 8. Associations of different diplotypes of the P1-Ins-4-bp and P2-Del-8-bp InDels with carcass traits in the female SDBCGR population.
Table 8. Associations of different diplotypes of the P1-Ins-4-bp and P2-Del-8-bp InDels with carcass traits in the female SDBCGR population.
Carcass TraitsObserved Diplotypes (Mean ± SE)p Values
DD-IIDD-IDID-IIID-ID
Beef shoulder (kg)1.02 b ± 0.02
(n = 163)		-1.3 a ± 0.11
(n = 27)		(n = 2)0.042
Note: Numbers with different letters (a, b) means p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Huang, Y.; Zhang, K.; Li, Y.; Zhang, S.; Akhatayeva, Z.; Jiang, F.; Song, E.; Lan, X. Bovine HOXA11 Gene Identified from RNA-Seq: mRNA Profile Analysis and Genetic Variation Detection Using ME Method and Their Associations with Carcass Traits. Cells 2023, 12, 539. https://doi.org/10.3390/cells12040539

AMA Style

Huang Y, Zhang K, Li Y, Zhang S, Akhatayeva Z, Jiang F, Song E, Lan X. Bovine HOXA11 Gene Identified from RNA-Seq: mRNA Profile Analysis and Genetic Variation Detection Using ME Method and Their Associations with Carcass Traits. Cells. 2023; 12(4):539. https://doi.org/10.3390/cells12040539

Chicago/Turabian Style

Huang, Yangming, Kejing Zhang, Yafang Li, Sihuan Zhang, Zhanerke Akhatayeva, Fugui Jiang, Enliang Song, and Xianyong Lan. 2023. "Bovine HOXA11 Gene Identified from RNA-Seq: mRNA Profile Analysis and Genetic Variation Detection Using ME Method and Their Associations with Carcass Traits" Cells 12, no. 4: 539. https://doi.org/10.3390/cells12040539

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop