Next Article in Journal
The Association of Acute Phase Proteins in Stress and Inflammation-Induced T2D
Next Article in Special Issue
The Power of Gene Technologies: 1001 Ways to Create a Cell Model
Previous Article in Journal
The Functional Role and Regulatory Mechanism of Bromodomain-Containing Protein 9 in Human Uterine Leiomyosarcoma
Previous Article in Special Issue
A Novel Cre/lox71-Based System for Inducible Expression of Recombinant Proteins and Genome Editing
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 11
Issue 14
10.3390/cells11142161
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Masculinizer and Doublesex as Key Factors Regulate Sexual Dimorphism in Ostrinia furnacalis

by
Honglun Bi
1,
Xiaowei Li
2,
Xia Xu
2,
Yaohui Wang
2,
Shutang Zhou
1,* and
Yongping Huang
2,*
1
State Key Laboratory of Cotton Biology, School of Life Sciences, College of Agriculture, Henan University, Kaifeng 475004, China
2
Key Laboratory of Insect Developmental and Evolutionary Biology, Center for Excellence in Molecular Plant Sciences, Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, Shanghai 200032, China
*
Authors to whom correspondence should be addressed.
Cells 2022, 11(14), 2161; https://doi.org/10.3390/cells11142161
Submission received: 29 June 2022 / Revised: 6 July 2022 / Accepted: 7 July 2022 / Published: 11 July 2022
(This article belongs to the Special Issue CRISPR Genome Editing: Principle, Method, Tool and Application)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

In animals, sexually dimorphic traits are ubiquitous and play vital roles in reproduction, courtship, and environmental adaptation, especially in insects. In this study, we used the CRISPR/Cas9 genome editing system to generate somatic mutations of the Masculinizer (Masc) and doublesex (dsx) genes in the sex determination pathway of Ostrinia furnacalis. The OfMasc and Ofdsx genes are structural orthologs of the key sex regulation factors in Bombyx mori. Mutation of the OfMasc and Ofdsx genes induced abnormal external genitalia, adult sterility, and sex reversal of sexually dimorphic traits including wing pigmentation, gene expression patterns, and dsx sex-specific splicing. These results demonstrate that the Masc and dsx genes are conserved factors in sexually dimorphic traits, and therefore represent potential target genes in the effort to control O. furnacalis and other lepidopteran pests.

Abstract

Sex determination is an important and traditional biological process. In Lepidoptera, Masculinizer (Masc) and doublesex (dsx) are the essential genes for sex determination and play critical roles in sexual differentiation and development. The functions of Masc and dsx have been characterized in several model insect species. However, the molecular mechanism and sex determination functions of Masc and dsx in Ostrinia furnacalis, an agricultural pest, are still unknown. Here, we successfully used the CRISPR/Cas9 genome editing system to knock out OfMasc and Ofdsx. Mutation of OfMasc induced male external genital defects and sterility. Disruptions of the Ofdsx common region caused sex-specific defects in the external genitals and adult sterility. In addition, we found that OfMasc and Ofdsx can regulate the pigmentation genes that control wing pigmentation patterns. These results demonstrate that OfMasc and Ofdsx play key roles in the sex determination of O. furnacalis, and suggest novel genetic control approaches for the management of pests, including O. furnacalis.

1. Introduction

Sexually dimorphic traits are ubiquitous in plants and animals. Most animal species consist of two distinct sexes, and the differences between male and female animals are numerous and pronounced at the morphological, physiological, and behavioral levels [1]. However, sexual dimorphism presents a question: how can a genome largely shared between the sexes give rise to such different forms [2]? A compelling answer to this question is provided by the sex-specific expression of shared genes [3]. Sex determination is an essential and hierarchically regulated biological process with high diversity in different organisms, including insects [4,5,6]. Sexually dimorphic traits, including body size, pigmentation, external genitals, sex-specific behavior and physiology are prevalent across the animal kingdom and especially in insect species [7]. Sexual dimorphism typically manifests in differences in body and wing color [1].
In animals, the doublesex (dsx) gene, the mab-3 gene and the Dsx- and mab-3-related transcription factor 1 (Dmrt1) are three homological factors that, through female and male specific expression and splicing, play an important role in the regulation of sexually dimorphic traits in Drosophila melanogaster, Caenorhabditis elegans, and mammalian species [8,9,10]. In insect species, sex determination plays a key part in biological development and reproduction [5,11]. In D. melanogaster, the Sex lethal (Sxl) gene is initially regulated by the X:A ratio [12]. Then, the dsx gene, which is a conserved downstream gene involved in sex determination, regulates sexual differentiation [13,14].
In Drosophila, the HOX protein Abdominal-B (ABD-B) and the sex-specific isoforms of DSX directly regulate the bab cis-regulatory element (CRE) to induce sexually differentiated pigmentation on abdominal segments [15]. In dragonflies, there is sexually dimorphic coloration; for instance, in Ischnura senegalensis, females are orange and males are blue. However, the molecular mechanism that regulates this difference is unclear [16]. In locusts, such as the gregarious Schistocerca gregaria, the body color of males and females does not differ in the nymphal stage; when male locusts reach sexual maturity, however, their male abdomen and legs turn yellow [17]. However, despite the fact that sexually dimorphic coloration is widespread in insects, the molecular mechanisms that regulate it are not well understood, and it is also unclear how the sex determination pathway regulates pigmentation.
In Lepidoptera, studies of sex determination have mainly focused on the silkworm Bombyx mori, which is an important lepidopteran model insect [18,19,20]. A previous study showed that the Masculinizer (Masc) gene is repressed by Fem piRNA in female silkworm [21]. Moreover, the Masc gene controls Bmdsx gene splicing in B. mori [22,23]. Mutation in Masc induces the appearance of female characteristics, including female-specific ventral chitin plates and genital papillae in male individuals [24]. Furthermore, disruption of the Bmdsx gene induces abnormal gonads and external genitalia, and sex-specific sterility [24,25]. In the Asiatic corn Borer, Ostrinia furnacalis (Lepidoptera: Pyralidae), which is one of the most destructive pests of corn, especially in China and northeast Asia [26,27], the Masc gene and the dsx gene have been described in previous studies [28,29,30,31]. The OfMasc gene is regulated by the endosymbiotic bacterium Wolbachia; a failure dosage compensation induces male lethality [28,30]. However, the genetic and functional relationships between these genes in O. furnacalis sex determination and differentiation are still unclear.
In our study, we used the CRISPR/Cas9 genome editing system to generate somatic mutations in the Masc and dsx genes in the sex determination pathway of O. furnacalis. The OfMasc and Ofdsx genes are structural orthologs of the key sex regulation factors in B. mori. Mutation of the Ofdsx gene induced abnormal external genitalia, adult sterility, and sex reversal of sexually dimorphic traits, including wing pigmentation, gene expression patterns, and dsx sex-specific splicing. These results demonstrate that the Masc and dsx genes are the conserved factors in sexually dimorphic traits, and therefore represent potential target genes for research into the control of O. furnacalis and other lepidopteran pests.

2. Materials and Methods

2.1. Insect Strains and Rearing

A laboratory strain of O. furnacalis was reared on an artificial diet (Table 1) under standard conditions in an incubator, at a temperature of 25 °C and with a 16:8 h light:dark cycle [32]. O. furnacalis pupae were sexed, and the emerging adults were mixed in transparent air-filled plastic bags to mate with each other and lay eggs [26].
Preparation method: Boil 900 mL of water mixed with agar, add other ingredients, mix well, and store in the refrigerator after cooling.

2.2. Phylogenetic Analysis

Phylogenetic relationships were determined based on sequence alignment (DNAMAN 8.0 software) and phylogenetic analysis using Mega 5 [33,34]. All ambiguous positions were removed for each sequence pair. The neighbor-joining method was used to create a tree from 9 available MASC protein sequences, and the reliability of the tree was tested by bootstrap analysis with 1000 replications. The GenBank accession numbers and references of the protein sequences are as follows: B. mori (BAO79517.1), Trilocha varians (BAS02075.1), Helicoverpa armigera (QCD63870.1), Agrotis ipsilon [35], Plutella xylostella [36], O. furnacalis (BAS02074.1), Ephestia kuehniella (QXE45293.1), Artemia franciscana (ARB66312.1), Artemia parthenogenetica (ARB66313.1).

2.3. Quantitative Real-Time PCR (qRT-PCR)

For qRT-PCR analyses, total RNA was extracted from O. furnacalis larvae and adults using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and treated with RNase-free DNase I (Ambion, Austin, TX, USA), according to the manufacturer’s instructions. cDNAs were synthesized using the Omniscript Reverse Transcriptase kit (Qiagen, Hilden, Germany) in a 20 μL reaction mixture containing 1 μg total RNA. qRT-PCR analysis for OfMasc and Ofdsx mutants was performed using a SYBR Green Real-Time PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) on an Eppendorf Real-Time PCR System. The PCR conditions were as follows: initial incubation at 95 °C for 5 min, 40 cycles at 95 °C for 15 s and 60 °C for 1 min. O. furnacalis actin was used as an internal control [32]. The gene-specific primers used for qRT-PCR are listed in Table 2.

2.4. In Vitro Transcription of Cas9 mRNA and sgRNA

We selected two 23-bp sgRNAs targeting OfMasc and one sgRNA targeting Ofdsx. The sgRNAs were sub-cloned into the 500-bp linearized CloneJet PJET1.2-T vector (Thermo Fisher Scientific) upstream of the protospacer adjacent motif (PAM) sequence, to allow sgRNA expression under the control of the T7 promoter. The sgRNAs were synthesized in vitro using a MEGAScript T7 kit (Ambion), according to the manufacturer’s instructions. Cas9 mRNA was synthesized in vitro using the mMESSAGE T7 Kit (Ambion) and a PTD1-T7-Cas9 vector as the template [35], according to the manufacturer’s instructions.

2.5. Microinjection of Embryos

Mated female O. furnacalis moths were allowed to lay eggs on transparent plastic bags. A previously reported microinjection method was employed [37]. Within 1 h of oviposition, the eggs were injected on the lateral side with a mixture containing 300 ng/μL of Cas9 mRNA and 150 ng/μL sgRNA. After injection, the eggs were incubated in a humidified chamber at 25 °C for 4 days until hatching.

2.6. Genomic DNA Extraction and Identification of Mutagenesis

The genomic DNA was extracted from the newly hatched larvae, incubated with proteinase K, and purified via a standard phenol:chloroform extraction and isopropanol precipitation extraction, followed by RNase A treatment. A PCR was carried out to identify OfMasc and Ofdsx mutant alleles using primers F1 and R1 (Table 2) spanning the target site in OfMasc and Ofdsx. The PCR conditions were as follows: 98 °C for 2 min, followed by 35 cycles of 94 °C for 10 s, 55 °C for 30 s, and 72 °C for 1 min, followed by a final extension period of 72 °C for 10 min. The PCR products were sub-cloned into the CloneJet PJET1.2-T vectors (Thermo Fisher Scientific) and sequenced. The PCR products were also used for the T7 endonuclease I (T7EI) assay as previously described [38]. The mutants were photographed with a digital stereoscope (Nikon AZ100, Tokyo, Japan).

2.7. Hatchability Assay

In order to evaluate the hatchability of Masc and dsx mutants, the males and females with OfMasc and Ofdsx mutations were crossed with mutant moths and virgin wild type male and female moths. Five pairs of moths were collected for one group. Hatchability assays of each group were repeated 3 times. After female moths laid eggs for two days, the eggs of each pair were collected and incubated in a humidified chamber at 25 °C for 4 days until hatching. The hatching rates were analyzed.

2.8. Statistical Analysis of Data

The data were analyzed using GraphPad Prism (version 5.01) with one-way analysis of variance, the Dunnett post hoc test and Bonferroni analysis. Error bars stand for the means ± SEM, and three asterisks stand for p < 0.001.

3. Results

3.1. Phylogenetic Analysis of MASC and DSX Proteins in O. furnacalis

The phylogenetic tree was constructed using sequences of OfMASC and MASC protein sequences from six different lepidopteran insects, namely H. armigera, B. mori, T. varians, A. ipsilon, P. xylostella, and E. kuehniella, and two other species, namely A. franciscana and A. parthenogenetica (Figure S1B). The phylogenetic tree showed that OfMASC was closest to P. xylostella and E. kuehniella MASC, suggesting a conserved function. Subsequently, the amino acid sequence of the OfMASC protein was compared with the other lepidopteran MASC proteins. The analyzed multiple alignment results show that the OfMASC protein has two tandem CCCH-type zinc finger (ZF) domains, a bipartite nuclear localization signal (bNLS), and a masculinization domain (MD) (Figure S1A). Then, we used the NCBI BLAST program to find the amino acid sequences of DSX proteins in the NCBI database and constructed the phylogenetic tree of DSX (Figure S2). The analyzed results showed that the OfDSX protein was closest to Galleria mellonella, a moth of the same superfamily Pyraloidea as O. furnacalis, and clustered with the DSX proteins of other lepidopteran moth insects, suggesting a conserved function.

3.2. CRISPR/Cas9-Mediated Mutagenesis of OfMasc and Ofdsx

In order to investigate the function of these two sex determination genes, the high-efficiency genome editing system CRISPR/Cas9 was used to disrupt the OfMasc and Ofdsx genes. Following the GGN19GG rule for sgRNA design [35], we designed two sgRNAs targeting the OfMasc and one sgRNA targeting the Ofdsx gene. Two targeted sgRNAs were at the exon 1 of the OfMasc gene locus (Figure 1A), and one targeted sgRNA was at the exon 2 of the common region of Ofdsx female and male transcript isoforms (Figure 1B). The fresh eggs, which were not more than 1 h older, were collected for microinjection. The Cas9 mRNA mixed with OfMasc or Ofdsx sgRNAs transcripted by a T7 promoter, was prepared according to previous reports [39]. To identify the mutated alleles of the OfMasc and Ofdsx genes, genomic DNA was extracted as phenotypic expression involved in mutagenesis was shown. The results of the genome sequences indicated that the successful deletion of sequences had taken place between the two target sites in the OfMasc gene and deletion in the Ofdsx gene (Figure 1).

3.3. Disruption of OfMasc and Ofdsx Genes Induced Abnormal External Genitalia and Pigmentation

The mutants displayed some abnormal phenotypes of external genitalia in the pupal stage. In the wild type, females and males have distinct gonopore characteristics in pupa morphology, which are key to distinguishing between females and males. Female pupae have an X-shaped line and a small crevice in the eighth abdominal segment, whereas male pupae develop two prominent points at the abdomen end of the ninth abdominal segment (Figure 2). Because of the key role of sex determination genes in regulating sexual dimorphic traits, the mutant sex determination genes result in abnormal female and male morphological characteristics and sex reversal [40]. For OfMasc mutant pupae, we found that there were some abnormal phenotypes, such as deformed gonopores, but only in the male mutants (Figure 2). Moreover, in mutant 2 (M2) and M3, there were some female specific characteristics similar to the X-shaped line. The gender of these male mutants was identified after eclosion. In the Ofdsx mutant pupae, we found there were three types of abnormal phenotypes. The Ofdsx female mutant had an abnormal X-shaped line, similar to M4, M5, and M6 (Figure 2), and the Ofdsx male mutant had defective gonopores, such as in M10, M11 and M12 (Figure 2). Some Ofdsx mutant pupae, such as M7, M8 and M9, also had two gonopore characteristics that differed between females and males. We named this mutant type DSX-FM (Table S1).
When the mutant pupae entered the adult stage, we found that there were some instances of abnormal external genitals. In the wild type, adult male external genitalia mainly consist of a harpago, some uncuses and an aedeagus. Female external genitalia mainly consist of a genital papilla and a ventral plate. In OfMasc mutants, the external genitals were normal in the females and abnormal in the males, which presented with a shorter aedeagus and an abnormal harpago (Figure 3M6). In the female Ofdsx mutants, there were some defective genital papillae and aedeagi (Figure 3M1,M2); abnormal harpago and female-specific genital papillae appeared in male Ofdsx mutants (Figure 3M4,M5).
We also found some other sexual dimorphism trait changes in the adult stage. In the wild type, the wing color of males is deeper than that of females. In the OfMasc mutants, however, the wing color of males was weaker than that of wild-type males and similar to that of wild-type females (Figure 4). In the Ofdsx mutants, we found the DSX-FM mutants showed more pronounced wing color and stripes than those of wild-type females, but weaker than those of wild-type males (Figure 4). The results suggest that the dsx gene regulates pigmentation in O. furnacalis.

3.4. OfMasc and Ofdsx Mutations Induce Sterility in O. furnacalis

We then analyzed the fertility data of mutants. We found that deletion of the OfMasc gene induced male lethality at the embryonic stage. We collected data concerning sex ratios in the adult stage three times. The percentages of sex ratios of female adults in the total population were about 78%, 85%, and 92% (Figure S4A). In order to analyze the physiological changes in OfMasc and Ofdsx mutants, we investigated the reproductive ability and hatching rate of the embryos produced when the mutants mated with each other. Because of the defects in the OfMasc male mutants’ external genitals, these males could not mate with wild-type females or with OfMasc female adults, and no eggs were hatched (Figure S4B). In the Ofdsx mutants, both the △DSX-F and △DSX-M individuals all had abnormal external genitals; as such, the Ofdsx mutants had no reproductive ability and no next-generation eggs were hatched (Figure S4C).

3.5. Detection of Sex-Specific Gene Expression in OfMasc and Ofdsx Mutants

In order to explain these mutant phenotypes, we used the RT-PCR to determine the Ofdsx gene expression. In the wild type, the Ofdsx female-specific isoform was longer than the male-specific isoform; the specific bands present the female or male Ofdsx expression. In the mutants, however, we found that the OfMasc male mutants had two bands in one lane, and the Ofdsx mutants also had non-single bands in corresponding lanes (Figure S3). These results demonstrate that the mutation of the OfMasc gene induces the appearance of female-specific Ofdsx isoforms in males.
To investigate whether the disruption of sex-specific OfMasc and Ofdsx transcripts influences the expression of known sex-biased genes in O. furnacalis, we examined the female-biased Vitellogenin (OfVg) and the Olfactory Receptor 53 (OfOR53) genes, which encode a protein essential for oogenesis and the reception of outside information; we also examined two male biased genes, Pheromone Binding Protein 2 (OfPBP2) and Pheromone Binding Protein 3 (OfPBP3) [32]. Compared with the wild-type males, the relative mRNA expression levels of OfVg and OfOR53 were significantly up-regulated in OfMasc and Ofdsx male mutants (Figure 5A,B,E,F); in Ofdsx mutant females, meanwhile, the levels of OfVg and OfOR53 were significantly decreased (Figure 5E,F). The relative mRNA expression levels of OfPBP2 and OfPBP3 were significantly down-regulated in OfMasc and Ofdsx male mutants (Figure 5C,D,G,H), but were significantly increased in Ofdsx female mutants (Figure 5G,H). These results demonstrate that OfVg, OfOR53, OfPBP2, and OfPBP3 are direct or indirect targets of dsx in O. furnacalis, which is consistent with previous reports [24,41,42].
To answer the question of how wing pigmentation is regulated by the mutagenesis of OfMasc and Ofdsx, we analyzed the relative transcription levels of genes in the melanin synthesis pathway, as well as some other pigmentation-related genes in adult OfMasc and Ofdsx mutants. In the wild type, the wing pigmentation of males is deeper than that of females, meaning that some pigmentation genes have different expression patterns for females and males. Through the qRT-PCR analysis, we found there were some highly expressed genes in males, including optix, 20661, apterous A (AP-A), Ddc, and Tan. High expression caused a deepening of pigmentation in males. In the OfMasc male mutants, however, we found that these genes, including optix, 20661, AP-A and Ddc, were down-regulated compared to wild-type males (Figure 6A). Moreover, in the Ofdsx mutants, the expressed pattern was similar to that of OfMasc male mutants (Figure 6B). These results demonstrate that disruption of OfMasc and Ofdsx induces a sex reversal of pigmentation phenotypes, and also that the expression of some genes was up- or down-regulated by the Ofdsx gene, either through direct or non-direct effects.

4. Discussion

In this study, we focused on the sex determination genes OfMasc and Ofdsx. The phylogenetic analyses of the OfMasc and Ofdsx genes showed high homology with other insect species (Figures S1 and S2). Using the CRISPR/Cas9 genome editing system, we successfully knocked out these two genes, which are crucial elements of the sex determination pathway (Figure 1). In OfMasc mutants, this induced abnormal external genitals in pupal and adult males (Figure 2 and Figure 3), which led to the sterility of these males and an imbalance in the sex ratio (Figure S4). Disruption of the Ofdsx common region induced the malformation of female and male external genitals (Figure 2 and Figure 3), which led to the sterility of male and female adults (Figure S4). Regarding sexual dimorphism, mutated OfMasc and Ofdsx caused a weakening of pigmentation and down-regulation of the pigmentation genes both for the OfMasc males and the Ofdsx males, while the Ofdsx female mutants showed enhanced pigmentation and up-regulation of pigmentation genes (Figure 4 and Figure 6). RT-PCR results showed the expression of female and male specific Ofdsx isoforms in the OfMasc-M mutants, and in the Ofdsx-F and Ofdsx-M mutants (Figure S3). The qRT-PCR results demonstrated disruption of OfMasc and Ofdsx influenced the expression of sex-biased genes (Figure 5). Our study provides direct evidence that OfMasc regulates the expression of the Ofdsx gene, and that the Ofdsx gene regulates the sexual dimorphism of O. furnacalis, including characteristics such as pigmentation, external genitals, sex-biased genes, and fertility. As such, OfMasc and Ofdsx constitute potential target genes in research aimed at controlling O. furnacalis and other lepidopteran pests (Figure S4).
The key masculinization factor played an important role and appears to have a conserved function in lepidopteran insects [21,22,23,24,30,36,43,44]. In B. mori, the Masc gene has two CCCH zinc finger domains and is regulated by Fem piRNA in order to control the male-specific dsx isoform expression, which is consistent with our results (Figures S1 and S3) [21,22,24]. In A. ipsilon and P. xylostella, the Masc gene was identified and shown to control masculinization through regulating the expression of dsx [36,44]. In previous studies, the OfMasc gene was cloned and shown to be regulated by Wolbachia to induce female-specific strains [30,31]. In our research, we used the CRISPR/Cas9 genome editing system to knock out the OfMasc gene, and then demonstrated that the OfMasc gene controls sexual dimorphism by regulating the expression of the dsx gene in O. furnacalis (Figure 1 and Figure 4).
Insect dsx genes are the downstream genes of the sex determination pathway; these genes are very conservative, and exhibit sex-specific splicing to generate male- (dsxM) and female-specific (dsxF) isoforms that control separate but corresponding sex-specific dimorphic traits [4,9,15,29,45]. In our study, we used the CRISPR/Cas9 genome editing system to disrupt the Ofdsx common region, which induced the inversion of sexual dimorphism in areas including pigmentation, the external genitals, and sex-biased genes (Figure 1, Figure 2, Figure 3, Figure 4, Figure 5 and Figure 6). In B. mori, dsx is an important transcription factor that regulates sexually dimorphic differentiation. Mutation of Bmdsx induced abnormal external genitals and led to female and male sterility; as such, it could act as a targeted gene for sterile insect technologies (SIT) [24,25,46]. In other lepidopteran pests, including O. scapulalis [47], A. ipsilon [48], P. xylostella [41] and Hyphantria cunea [42], dsx gene function is conservative and regulates sexual dimorphism. These previous reports have shown that, in lepidopteran insects, the dsx gene has high homology and controls sexual dimorphism through the sex determination pathway.
Dsx is a mimicry supergene [49,50]. In O. furnacalis, wing pigmentation shows sexual dimorphism: pigmentation is deeper in males than it is in females. In our study, we knocked out the OfMasc and Ofdsx genes, which caused abnormalities in the sexually dimorphic traits; moreover, there was a reversal in sex-specific wing pigmentation patterns. qRT-PCR showed some pigmentation genes were down-regulated in male mutants and up-regulated in female mutants (Figure 4 and Figure 6). These results demonstrate that the dsx gene can affect the expression of the genes that control sexual dimorphism in wing pigmentation patterns. In butterflies, a previous study found that females showed female-limited Batesian mimicry and displayed wing pattern polymorphism [51]. In Papilio polytes, this polymorphism is controlled by a single autosomal locus, dominant locus H, which consists of a series of genes that affect color patterns [52]. Moreover, a recent study of P. polytes has shown that the mimetic phenotype is controlled by the dsx gene [49,50]. SiRNA-mediated down-regulation of the dsx gene induced the severe repression of red spots and white pigmentation in female wing patterns [50]. In O. scapulalis, Wolbachia-infected females showed sexual mosaics, which were composed of male (darker) and female (lighter) sectors; both male and female dsx isoforms were also expressed in these individuals [47]. These results demonstrate that the Osdsx gene can control the sexual dimorphism of wing pigmentation patterns in O. scapulalis.
In summary, we used the CRISPR/Cas9 genome editing system to disrupt the functions of the sex determination genes Masc and dsx. The results of our study demonstrate that OfMasc can regulate the expression of male dsx isoforms and induce male sexual phenotypes. Dsx performs essential functions in sexual dimorphism, and is involved in determining the morphology of external genitals and wing pigmentation patterns in O. furnacalis. The disruption of Masc induced a sex ratio imbalance and male sterility. Knocking out the dsx common region induced female and male sterility. These results demonstrate that Masc and dsx are potential target genes for efforts to control O. furnacalis and some other lepidopteran pests.

5. Conclusions

In this study, we investigated the function of OfMasc and Ofdsx in the lepidopteran agricultural pest O. furnacalis. We used the CRISPR/Cas9 genome editing system to successfully knock out OfMasc and Ofdsx. Mutation of OfMasc induced defects in the male external genitals, a sex ratio imbalance and male sterility. Disruptions of the Ofdsx common region caused sex-specific defects in the external genitals and adult sterility. In addition, we found that OfMasc and Ofdsx can regulate pigmentation genes to control wing pigmentation patterns. These results demonstrate that OfMasc and Ofdsx play key roles in sex determination and in the regulation of sexually dimorphic trails in O. furnacalis, and have the potential to be used in the genetic control of pests such as O. furnacalis.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cells11142161/s1, Figure S1: Phylogenetic analysis of the OfMasc gene. Figure S2: Phylogenetic relationship of insect dsx genes, generated using NCBI BLAST program. Figure S3: The splicing patterns of Ofdsx were examined by RT-PCR in wild-type and mutant insects. Figure S4: The sex ratio difference in OfMasc mutants and the fertility of OfMasc and Ofdsx mutants. Table S1: Mutagenesis of OfMasc and Ofdsx induced by Cas9/sgRNA.

Author Contributions

Conceptualization, Y.H. and S.Z.; methodology, H.B.; software, H.B.; validation, H.B., X.L. and X.X.; formal analysis, H.B.; investigation, H.B.; data curation, H.B. and Y.W.; writing—original draft preparation, H.B.; writing—review and editing, Y.H. and S.Z.; visualization, H.B.; supervision, Y.H.; project administration, H.B. and Y.H.; funding acquisition, H.B. and Y.H. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by grants from the Key Scientific and technological project of Henan Province (222102110108) to H.B., and the National Natural Science Foundation of China (31530072 and 31420103918) to Y.H.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All the data and resources generated for this study are included in the article and the Supplemental Materials.

Acknowledgments

We appreciate the experimentalist, Shi Aiqin, who was responsible for insect feeding and material collection.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Hopkins, B.R.; Kopp, A. Evolution of sexual development and sexual dimorphism in insects. Curr. Opin. Genet. Dev. 2021, 69, 129–139. [Google Scholar] [CrossRef] [PubMed]
  2. Parker, G.A. The sexual cascade and the rise of pre-ejaculatory (Darwinian) sexual selection, sex roles, and sexual conflict. Cold Spring Harb. Perspect. Biol. 2014, 6, a017509. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Mank, J.E. The transcriptional architecture of phenotypic dimorphism. Nat. Ecol. Evol. 2017, 1, 6. [Google Scholar] [CrossRef]
  4. Salz, H.K. Sex determination in insects: A binary decision based on alternative splicing. Curr. Opin. Genet. Dev. 2011, 21, 395–400. [Google Scholar] [CrossRef] [Green Version]
  5. Gempe, T.; Beye, M. Function and evolution of sex determination mechanisms, genes and pathways in insects. Bioessays 2011, 33, 52–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Bachtrog, D.; Mank, J.E.; Peichel, C.L.; Kirkpatrick, M.; Otto, S.P.; Ashman, T.L.; Hahn, M.W.; Kitano, J.; Mayrose, I.; Ming, R.; et al. Sex determination: Why so many ways of doing it? PLoS Biol. 2014, 12, e1001899. [Google Scholar] [CrossRef] [Green Version]
  7. Prakash, A.; Monteiro, A. Molecular mechanisms of secondary sexual trait development in insects. Curr. Opin. Insect Sci. 2016, 17, 40–48. [Google Scholar] [CrossRef]
  8. Coschigano, K.T.; Wensink, P.C. Sex-specific transcriptional regulation by the male and female doublesex proteins of Drosophila. Genes Dev. 1993, 7, 42–54. [Google Scholar] [CrossRef] [Green Version]
  9. Raymond, C.S.; Shamu, C.E.; Shen, M.M.; Seifert, K.J.; Hirsch, B.; Hodgkin, J.; Zarkower, D. Evidence for evolutionary conservation of sex-determining genes. Nature 1998, 391, 691–695. [Google Scholar] [CrossRef]
  10. Raymond, C.S.; Murphy, M.W.; O’Sullivan, M.G.; Bardwell, V.J.; Zarkower, D. Dmrt1, a gene related to worm and fly sexual regulators, is required for mammalian testis differentiation. Genes Dev. 2000, 14, 2587–2595. [Google Scholar] [CrossRef] [Green Version]
  11. Kaiser, V.B.; Bachtrog, D. Evolution of sex chromosomes in insects. Annu. Rev. Genet. 2010, 44, 91–112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Murray, S.M.; Yang, S.Y.; Van Doren, M. Germ cell sex determination: A collaboration between soma and germline. Curr. Opin. Cell Biol. 2010, 22, 722–729. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Burtis, K.C.; Baker, B.S. Drosophila doublesex gene controls somatic sexual differentiation by producing alternatively spliced mRNAs encoding related sex-specific polypeptides. Cell 1989, 56, 997–1010. [Google Scholar] [CrossRef]
  14. Matson, C.K.; Zarkower, D. Sex and the singular DM domain: Insights into sexual regulation, evolution and plasticity. Nat. Rev. Genet. 2012, 13, 163–174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Williams, T.M.; Selegue, J.E.; Werner, T.; Gompel, N.; Kopp, A.; Carroll, S.B. The regulation and evolution of a genetic switch controlling sexually dimorphic traits in Drosophila. Cell 2008, 134, 610–623. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Futahashi, R. Color vision and color formation in dragonflies. Curr. Opin. Insect Sci. 2016, 17, 32–39. [Google Scholar] [CrossRef] [Green Version]
  17. Tanaka, S.; Harano, K.I.; Nishide, Y.; Sugahara, R. The mechanism controlling phenotypic plasticity of body color in the desert locust: Some recent progress. Curr. Opin. Insect Sci. 2016, 17, 10–15. [Google Scholar] [CrossRef]
  18. Traut, W.; Sahara, K.; Marec, F. Sex chromosomes and sex determination in Lepidoptera. Sex. Dev. 2007, 1, 332–346. [Google Scholar] [CrossRef]
  19. Fujii, T.; Shimada, T. Sex determination in the silkworm, Bombyx mori: A female determinant on the W chromosome and the sex-determining gene cascade. Semin. Cell Dev. Biol. 2007, 18, 379–388. [Google Scholar] [CrossRef]
  20. Nagaraju, J.; Gopinath, G.; Sharma, V.; Shukla, J.N. Lepidopteran sex determination: A cascade of surprises. Sex. Dev. 2014, 8, 104–112. [Google Scholar] [CrossRef]
  21. Kiuchi, T.; Koga, H.; Kawamoto, M.; Shoji, K.; Sakai, H.; Arai, Y.; Ishihara, G.; Kawaoka, S.; Sugano, S.; Shimada, T.; et al. A single female-specific piRNA is the primary determiner of sex in the silkworm. Nature 2014, 509, 633–636. [Google Scholar] [CrossRef] [PubMed]
  22. Katsuma, S.; Sugano, Y.; Kiuchi, T.; Shimada, T. Two conserved cysteine residues are required for the masculinizing activity of the silkworm Masc protein. J. Biol. Chem. 2015, 290, 26114–26124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Kiuchi, T.; Sugano, Y.; Shimada, T.; Katsuma, S. Two CCCH-type zinc finger domains in the Masc protein are dispensable for masculinization and dosage compensation in Bombyx mori. Insect Biochem. Mol. Biol. 2019, 104, 30–38. [Google Scholar] [CrossRef] [PubMed]
  24. Xu, J.; Chen, S.; Zeng, B.; James, A.A.; Tan, A.; Huang, Y. Bombyx mori P-element Somatic Inhibitor (BmPSI) is a key auxiliary factor for silkworm male sex determination. PLoS Genet. 2017, 13, e1006576. [Google Scholar] [CrossRef] [Green Version]
  25. Xu, J.; Wang, Y.; Li, Z.; Ling, L.; Zeng, B.; James, A.A.; Tan, A.; Huang, Y. Transcription activator-like effector nuclease (TALEN)-mediated female-specific sterility in the silkworm, Bombyx mori. Insect Mol. Biol. 2014, 23, 800–807. [Google Scholar] [CrossRef] [Green Version]
  26. Liu, D.; Yan, S.; Huang, Y.; Tan, A.; Stanley, D.W.; Song, Q. Genetic transformation mediated by piggyBac in the Asian corn borer, Ostrinia furnacalis (Lepidoptera: Crambidae). Arch. Insect Biochem. Physiol. 2012, 80, 140–150. [Google Scholar] [CrossRef]
  27. Liu, Q.; Hallerman, E.; Peng, Y.; Li, Y. Development of Bt rice and Bt maize in China and their efficacy in target pest control. Int. J. Mol. Sci. 2016, 17, 1561. [Google Scholar] [CrossRef] [Green Version]
  28. Kageyama, D.; Nishimura, G.; Hoshizaki, S.; Ishikawa, Y. Feminizing Wolbachia in an insect, Ostrinia furnacalis (Lepidoptera: Crambidae). Heredity 2002, 88, 444–449. [Google Scholar] [CrossRef] [Green Version]
  29. Wang, X.Y.; Zheng, Z.Z.; Song, H.S.; Xu, Y.Z. Conserved RNA cis-elements regulate alternative splicing of Lepidopteran doublesex. Insect Biochem. Mol. Biol. 2014, 44, 1–11. [Google Scholar] [CrossRef]
  30. Fukui, T.; Kawamoto, M.; Shoji, K.; Kiuchi, T.; Sugano, S.; Shimada, T.; Suzuki, Y.; Katsuma, S. The endosymbiotic bacterium Wolbachia selectively kills male hosts by targeting the Masculinizing gene. PLoS Pathog. 2015, 11, e1005048. [Google Scholar] [CrossRef]
  31. Fukui, T.; Kiuchi, T.; Shoji, K.; Kawamoto, M.; Shimada, T.; Katsuma, S. In vivo masculinizing function of the Ostrinia furnacalis Masculinizer gene. Biochem. Biophys. Res. Commun. 2018, 503, 1768–1772. [Google Scholar] [CrossRef] [PubMed]
  32. Yang, B.; Ozaki, K.; Ishikawa, Y.; Matsuo, T. Identification of candidate odorant receptors in Asian corn borer Ostrinia furnacalis. PLoS ONE 2015, 10, e0121261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Wang, Y.; Li, Z.; Xu, J.; Zeng, B.; Ling, L.; You, L.; Chen, Y.; Huang, Y.; Tan, A. The CRISPR/Cas system mediates efficient genome engineering in Bombyx mori. Cell Res. 2013, 23, 1414–1416. [Google Scholar] [CrossRef] [Green Version]
  36. Harvey-Samuel, T.; Norman, V.C.; Carter, R.; Lovett, E.; Alphey, L. Identification and characterisation of a Masculinizer homolog in the diamondback moth Plutella xylostella. Insect Mol. Biol. 2019, 29, 231–240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. You, L.; Bi, H.L.; Wang, Y.H.; Li, X.W.; Chen, X.E.; Li, Z.Q. CRISPR/Cas9-based mutation reveals Argonaute 1 is essential for pigmentation in Ostrinia furnacalis. Insect Sci. 2019, 26, 1020–1028. [Google Scholar] [CrossRef]
  38. Kondo, S.; Ueda, R. Highly improved gene targeting by germline-specific Cas9 expression in Drosophila. Genetics 2013, 195, 715–721. [Google Scholar] [CrossRef] [Green Version]
  39. Bi, H.L.; Xu, J.; Tan, A.J.; Huang, Y.P. CRISPR/Cas9-mediated targeted gene mutagenesis in Spodoptera litura. Insect Sci. 2016, 23, 469–477. [Google Scholar] [CrossRef]
  40. Xu, J.; Zhan, S.; Chen, S.; Zeng, B.; Li, Z.; James, A.A.; Tan, A.; Huang, Y. Sexually dimorphic traits in the silkworm, Bombyx mori, are regulated by doublesex. Insect Biochem. Mol. Biol. 2017, 80, 42–51. [Google Scholar] [CrossRef] [Green Version]
  41. Wang, Y.; Chen, X.; Liu, Z.; Xu, J.; Li, X.; Bi, H.; Andongma, A.A.; Niu, C.; Huang, Y. Mutation of doublesex induces sex-specific sterility of the diamondback moth Plutella xylostella. Insect Biochem. Mol. Biol. 2019, 112, 103180. [Google Scholar] [CrossRef] [PubMed]
  42. Li, X.; Liu, Q.; Liu, H.; Bi, H.; Wang, Y.; Chen, X.; Wu, N.; Xu, J.; Zhang, Z.; Huang, Y.; et al. Mutation of doublesex in Hyphantria cunea results in sex-specific sterility. Pest Manag. Sci. 2019, 76, 1673–1682. [Google Scholar] [CrossRef] [PubMed]
  43. Lee, J.; Kiuchi, T.; Kawamoto, M.; Shimada, T.; Katsuma, S. Identification and functional analysis of a Masculinizer orthologue in Trilocha varians (Lepidoptera: Bombycidae). Insect Mol. Biol. 2015, 24, 561–569. [Google Scholar] [CrossRef]
  44. Wang, Y.H.; Chen, X.E.; Yang, Y.; Xu, J.; Fang, G.Q.; Niu, C.Y.; Huang, Y.P.; Zhan, S. The Masc gene product controls masculinization in the black cutworm, Agrotis ipsilon. Insect Sci. 2019, 26, 1037–1044. [Google Scholar] [CrossRef] [PubMed]
  45. Williams, T.M.; Carroll, S.B. Genetic and molecular insights into the development and evolution of sexual dimorphism. Nat. Rev. Genet. 2009, 10, 797–804. [Google Scholar] [CrossRef]
  46. Tan, A.; Fu, G.; Jin, L.; Guo, Q.; Li, Z.; Niu, B.; Meng, Z.; Morrison, N.I.; Alphey, L.; Huang, Y. Transgene-based, female-specific lethality system for genetic sexing of the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. USA 2013, 110, 6766–6770. [Google Scholar] [CrossRef] [Green Version]
  47. Sugimoto, T.N.; Fujii, T.; Kayukawa, T.; Sakamoto, H.; Ishikawa, Y. Expression of a doublesex homologue is altered in sexual mosaics of Ostrinia scapulalis moths infected with Wolbachia. Insect Biochem. Mol. Biol. 2010, 40, 847–854. [Google Scholar] [CrossRef]
  48. Chen, X.; Cao, Y.; Zhan, S.; Tan, A.; Palli, S.R.; Huang, Y. Disruption of sex-specific doublesex exons results in male- and female-specific defects in the black cutworm, Agrotis ipsilon. Pest Manag. Sci. 2019, 75, 1697–1706. [Google Scholar] [CrossRef]
  49. Kunte, K.; Zhang, W.; Tenger-Trolander, A.; Palmer, D.H.; Martin, A.; Reed, R.D.; Mullen, S.P.; Kronforst, M.R. doublesex is a mimicry supergene. Nature 2014, 507, 229–232. [Google Scholar] [CrossRef]
  50. Nishikawa, H.; Iijima, T.; Kajitani, R.; Yamaguchi, J.; Ando, T.; Suzuki, Y.; Sugano, S.; Fujiyama, A.; Kosugi, S.; Hirakawa, H.; et al. A genetic mechanism for female-limited Batesian mimicry in Papilio butterfly. Nat. Genet. 2015, 47, 405–409. [Google Scholar] [CrossRef]
  51. Clarke, C.A.; Sheppard, P.M. Super-genes and mimicry. Heredity 1960, 14, 175–185. [Google Scholar] [CrossRef]
  52. Loehlin, D.W.; Carroll, S.B. Evolutionary biology: Sex, lies and butterflies. Nature 2014, 507, 172–173. [Google Scholar] [CrossRef] [PubMed]
Cells 11 02161 g001 550
Figure 1. CRISPR/Cas9-mediated mutations in the OfMasc and Ofdsx target sites. (A) The two target sites of the OfMasc genome locus focused on the first exon. (B) The target site of the Ofdsx genome locus focused on the second exon of the common region in the female and male spliced variants. (C) T7 endonuclease I treatment of extracts of wild type (WT) and mutant (M) pupae of OfMasc and genomic sequencing demonstrate alterations at the target site. Arrows indicate the two bands observed in mutants. The red wedge indicates the position of cleavage by the CRISPR/Cas9 genome editing system. (D) Sequencing chromatogram of the Ofdsx mutants. The red wedge indicates the position of cleavage by the CRISPR/Cas9 genome editing system. (E) OfMasc mutations detected by sequencing. The PAM sequence is in red. The black line represents the target sites. (F) Ofdsx mutations detected by sequencing. The PAM sequence is in red. The black line represents the target site.
Figure 1. CRISPR/Cas9-mediated mutations in the OfMasc and Ofdsx target sites. (A) The two target sites of the OfMasc genome locus focused on the first exon. (B) The target site of the Ofdsx genome locus focused on the second exon of the common region in the female and male spliced variants. (C) T7 endonuclease I treatment of extracts of wild type (WT) and mutant (M) pupae of OfMasc and genomic sequencing demonstrate alterations at the target site. Arrows indicate the two bands observed in mutants. The red wedge indicates the position of cleavage by the CRISPR/Cas9 genome editing system. (D) Sequencing chromatogram of the Ofdsx mutants. The red wedge indicates the position of cleavage by the CRISPR/Cas9 genome editing system. (E) OfMasc mutations detected by sequencing. The PAM sequence is in red. The black line represents the target sites. (F) Ofdsx mutations detected by sequencing. The PAM sequence is in red. The black line represents the target site.
Cells 11 02161 g001
Cells 11 02161 g002 550
Figure 2. The morphologies of wild type compared with OfMasc and Ofdsx mutant pupae. In the wild type, the females and males have different gonopore characteristics in pupa morphology; these variations are key to differentiating males from females. Female pupae have an X-shaped line and small crevice in the eighth abdominal segment, whereas male pupae develop two prominent points at the abdomen end in the ninth abdominal segment. The OfMasc and Ofdsx mutants showed abnormal or defected morphologies. M1–M3 are the male mutants of Masc in O. furnacalis. In the dsx mutants, M4–M6 are the female mutants; M7–M9 are the intersex mutants; M10–M12 are the male mutants. Scale bar: 1 mm.
Figure 2. The morphologies of wild type compared with OfMasc and Ofdsx mutant pupae. In the wild type, the females and males have different gonopore characteristics in pupa morphology; these variations are key to differentiating males from females. Female pupae have an X-shaped line and small crevice in the eighth abdominal segment, whereas male pupae develop two prominent points at the abdomen end in the ninth abdominal segment. The OfMasc and Ofdsx mutants showed abnormal or defected morphologies. M1–M3 are the male mutants of Masc in O. furnacalis. In the dsx mutants, M4–M6 are the female mutants; M7–M9 are the intersex mutants; M10–M12 are the male mutants. Scale bar: 1 mm.
Cells 11 02161 g002
Cells 11 02161 g003 550
Figure 3. The external genital morphology of the wild type compared with OfMasc and Ofdsx mutants. In the wild type, adult male external genitalia mainly consist of a harpago, some uncuses and an aedeagus. Female external genitalia mainly consist of a genital papilla and a ventral plate. The male-specific external genitalia in OfMasc and Ofdsx mutant males exhibited severe structural defects, and the genital papilla and ventral plate were not present and ectopic in Ofdsx mutant females. Scale bar: 0.5 mm.
Figure 3. The external genital morphology of the wild type compared with OfMasc and Ofdsx mutants. In the wild type, adult male external genitalia mainly consist of a harpago, some uncuses and an aedeagus. Female external genitalia mainly consist of a genital papilla and a ventral plate. The male-specific external genitalia in OfMasc and Ofdsx mutant males exhibited severe structural defects, and the genital papilla and ventral plate were not present and ectopic in Ofdsx mutant females. Scale bar: 0.5 mm.
Cells 11 02161 g003
Cells 11 02161 g004 550
Figure 4. The pigmentation of the wild-type individuals compared with the OfMasc and Ofdsx mutants. In the wild type, the wing color of males is deeper than that of females. In the OfMasc mutant males, the wing color was weaker than in wild-type males. In the Ofdsx mutants, the wing color had a level of pigmentation between that of the wild-type males and females. Scale bar: 2 mm.
Figure 4. The pigmentation of the wild-type individuals compared with the OfMasc and Ofdsx mutants. In the wild type, the wing color of males is deeper than that of females. In the OfMasc mutant males, the wing color was weaker than in wild-type males. In the Ofdsx mutants, the wing color had a level of pigmentation between that of the wild-type males and females. Scale bar: 2 mm.
Cells 11 02161 g004
Cells 11 02161 g005 550
Figure 5. qRT-PCR analysis of the putative downstream genes of Ofdsx in the OfMasc and Ofdsx mutants. (A–D) Relative mRNA expression levels of OfVg, OfOR53, OfPBP2, and OfPBP3 in OfMasc mutants. (E–H) Relative mRNA expression levels of OfVg, OfOR53, OfPBP2, and OfPBP3 in Ofdsx mutants. Three individual biological replicates were performed using qRT-PCR. Error bar: SD; *, ** and *** represent significant differences at the 0.05, 0.01 and 0.001 levels (t-test) compared with the control.
Figure 5. qRT-PCR analysis of the putative downstream genes of Ofdsx in the OfMasc and Ofdsx mutants. (A–D) Relative mRNA expression levels of OfVg, OfOR53, OfPBP2, and OfPBP3 in OfMasc mutants. (E–H) Relative mRNA expression levels of OfVg, OfOR53, OfPBP2, and OfPBP3 in Ofdsx mutants. Three individual biological replicates were performed using qRT-PCR. Error bar: SD; *, ** and *** represent significant differences at the 0.05, 0.01 and 0.001 levels (t-test) compared with the control.
Cells 11 02161 g005
Cells 11 02161 g006 550
Figure 6. The relative expression of pigmentation genes in OfMasc male mutants (A) and Ofdsx FM mutants (B). Three individual biological replicates were performed using qRT-PCR. Error bar: SD; n.s., *, ** and *** represent significant differences at the 0.05, 0.01 and 0.001 levels (t-test) compared with the control.
Figure 6. The relative expression of pigmentation genes in OfMasc male mutants (A) and Ofdsx FM mutants (B). Three individual biological replicates were performed using qRT-PCR. Error bar: SD; n.s., *, ** and *** represent significant differences at the 0.05, 0.01 and 0.001 levels (t-test) compared with the control.
Cells 11 02161 g006
Table
Table 1. The components of the artificial diet given to the laboratory strain of Ostrinia furnacalis.
Table 1. The components of the artificial diet given to the laboratory strain of Ostrinia furnacalis.
ComponentsWeight (g) or Volume (mL)
Wheat germ powder150
Yeast extract powder40
Agar strip14
Sucrose5
Vitamin C4
Sorbic acid4
Methyl p-hydroxybenzoate4
Linoleic acid0.5
purified water900
Table
Table 2. Primers used in PCR amplification and mutant detection.
Table 2. Primers used in PCR amplification and mutant detection.
Primer NamePrimer Sequence (5′-3′)Primer Purpose
Masc-sgF1TAATACGACTCACTATAGGGTTTGTAGGGATTACGTTGTTTTAGAGCTAGAAATAGCAAPreparation of sgRNA templates
Masc-sgF2TAATACGACTCACTATAGGCGACATGAAGCTCACGGAGTTTTAGAGCTAGAAATAGCAA
Dsx-sgF1TAATACGACTCACTATAGGTGTCCCTAGAAACCCTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
sgRNA-RAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
Masc-F1ACATAGTGAACAAAATGGCCGCCACIdentification of somatic mutations
Masc-R1TTGAGGTGGTGGTGCTGAAACAGAA
Dsx-DC-F1AAACGCTTTTATTTAGAGGTTAAGAGGG
Dsx-DC-R1GCTGAAATGATGATGATGATCCAAA
Dsx-RTPCR-FAAGTTCCACTATTCCTGGGAGqRT-PCR for genes
Dsx-RTPCR-RAGCACATCGAGTACGAGGAG
Actin-qFCCGTCCTCCTGACCGAGGCTC
Actin-qRGGTGTGGGAGACACCATCTCCG
Vg-qFTCTTACAAATCGCGCAATGG
Vg-qRGACTTGGAGACGTTCTTGAC
OR53-qFGGAGCTATTACCTACGTGAAGC
OR53-qRTTAAGCGCAGGCTGCGTTCATG
PBP2-qFATGTGCTCGATGAGCGTTGT
PBP2-qRCTTGGATGAAAGGCAGAGGAT
PBP3-qFAAGACGCTTGTGGTGATGGCA
PBP3-qRGATCAGTTGTAATCCTGTGGC
Optix-qFGCCCATTATCAGGAAGCAGA
Optix-qRCAGCTCCCTCTTCTTTGTCG
206617-qFATGGATACGAGGCACAAAGC
206617-qRGAGGATCAGTGTGCAAAGCA
APA-qFTATGGCGGTACGACACTTTG
APA-qRGGAAGGCAGTCCGTCTTGTA
Ddc-qFTTGGTTCGTCTTGAGGCTTT
Ddc-qRCCATTAATGCGCTTCAACAA
Tan-qFTCATCGCGACGTATGCTAAC
Tan-qRATGGTTCCAATGAGGTCGTC
Ebony-qFCGTCTGCCCTATTCAGCAAT
Ebony-qRCACCAGCTTCTGAGGGTCTC
Yellow-qFTGTTGGAATTCCGCTCTTTC
Yellow-qRACGGGACCGTGTAAATTCTG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Bi, H.; Li, X.; Xu, X.; Wang, Y.; Zhou, S.; Huang, Y. Masculinizer and Doublesex as Key Factors Regulate Sexual Dimorphism in Ostrinia furnacalis. Cells 2022, 11, 2161. https://doi.org/10.3390/cells11142161

AMA Style

Bi H, Li X, Xu X, Wang Y, Zhou S, Huang Y. Masculinizer and Doublesex as Key Factors Regulate Sexual Dimorphism in Ostrinia furnacalis. Cells. 2022; 11(14):2161. https://doi.org/10.3390/cells11142161

Chicago/Turabian Style

Bi, Honglun, Xiaowei Li, Xia Xu, Yaohui Wang, Shutang Zhou, and Yongping Huang. 2022. "Masculinizer and Doublesex as Key Factors Regulate Sexual Dimorphism in Ostrinia furnacalis" Cells 11, no. 14: 2161. https://doi.org/10.3390/cells11142161

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop