Sex-Dependent Effects of Intestinal Microbiome Manipulation in a Mouse Model of Alzheimer’s Disease
Abstract
:Highlights
- Probiotic feeding reduced Aβ plaque load and improved memory in AppNL-G-F female mice.
- Probiotics decreased microgliosis and TNF-α levels in AppNL-G-F female mice with no effects in male mice.
- Oral antibiotic treatment reduced Aβ plaque load in AppNL-G-F male mice with no effects in female mice.
- Probiotic feeding stimulated innate immune response changes in AppNL-G-F female spleens.
- Antibiotic treatment stimulated acquired immune response changes in AppNL-G-F male spleens.
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Animals and Treatment
2.3. Antibodies and Reagents
2.4. Fecal Sample Collection and Microbiome Analysis
2.5. Passive Avoidance Test for Learning and Memory Assessment
2.6. Immunohistochemistry
2.7. Enzyme-Linked Immunosorbent Assay (ELISA) for Cytokines
2.8. Antibody Array Detection of Cytokine Levels Using a Mouse Th1/Th2/Th17 Array
2.9. Spleen Immune Cell Phenotyping by Flow Cytometry
2.10. Correlational Analysis
2.11. Statistical Analyses
3. Results
3.1. Antibiotics and Probiotic Treatment Had Sex-Dependent Effects on Learning and Memory in Wild Type and AppNL-G-F Mice
3.2. Antibiotics and Probiotic Treatments Had Sex-Dependent Effects on Aβ Plaque Load in AppNL-G-F Mice
3.3. Antibiotics and Probiotic Treatment Had Sex- and Strain-Dependent Effects on Gliosis in Wild Type and AppNL-G-F Mice
3.4. Antibiotics and Probiotic Treatment Had Sex-Dependent Effects on Brain Cytokines in Wild Type and AppNL-G-F Mice
3.5. Antibiotics and Probiotic Treatment Had Sex-Dependent Effects on the Intestinal Microbiome of Wild Type and AppNL-G-F Mice
3.6. Specific Gut Bacterial Compositions Were Associated with Brain Changes in C57BL/6J and AppNL-G-F Mice
3.7. Gut Microbiota Alteration Had Sex-Specific Effects on Intestinal Permeability and Colon Cytokine Levels
3.8. Antibiotics and Probiotic Treatments Altered Peripheral Immune Cell Phenotype in a Sex-and Genotype-Dependent Fashion
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
AD | Alzheimer’s disease |
CNS | Central nervous system |
ENS | Enteric nervous system |
Veh | Vehicle |
WT | Wild type |
ABX | Antibiotics |
Syn | Synbiotic (Antibiotics plus probiotics) |
CFU | colony forming units |
Iba1 | Ionized calcium binding adaptor molecule 1 |
GFAP | Glial fibrillary acidic protein |
Aβ | Amyloid beta |
PBS | Phosphate buffered saline |
ELISA | Enzyme-linked immunosorbent assay |
BCA | Bicinchoninic acid |
SEM | standard error of the mean |
ANOVA | analysis of variance |
VSL#3 | commercially available probiotic containing eight type of bacteria |
APP | amyloid precursor protein |
LPS | Lipopolysaccharide |
References
- Clayton, T.A.; Baker, D.; Lindon, J.C.; Everett, J.R.; Nicholson, J.K. Pharmacometabonomic identification of a significant host-microbiome metabolic interaction affecting human drug metabolism. Proc. Natl. Acad. Sci. USA 2009, 106, 14728–14733. [Google Scholar] [CrossRef] [Green Version]
- Saha, J.R.; Butler, V.P., Jr.; Neu, H.C.; Lindenbaum, J. Digoxin-inactivating bacteria: Identification in human gut flora. Science 1983, 220, 325–327. [Google Scholar] [CrossRef]
- Dalile, B.; Van Oudenhove, L.; Vervliet, B.; Verbeke, K. The role of short-chain fatty acids in microbiota-gut-brain communication. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 461–478. [Google Scholar] [CrossRef] [PubMed]
- Silva, Y.P.; Bernardi, A.; Frozza, R.L. The Role of Short-Chain Fatty Acids From Gut Microbiota in Gut-Brain Communication. Front. Endocrinol. 2020, 11, 25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Antonini, M.; Lo Conte, M.; Sorini, C.; Falcone, M. How the Interplay Between the Commensal Microbiota, Gut Barrier Integrity, and Mucosal Immunity Regulates Brain Autoimmunity. Front. Endocrinol. 2019, 10, 1937. [Google Scholar] [CrossRef] [PubMed]
- Ahern, P.P.; Maloy, K.J. Understanding immune-microbiota interactions in the intestine. Immunology 2020, 159, 4–14. [Google Scholar] [CrossRef] [Green Version]
- Cheng, H.Y.; Ning, M.X.; Chen, D.K.; Ma, W.T. Interactions Between the Gut Microbiota and the Host Innate Immune Response Against Pathogens. Front. Endocrinol. 2019, 10, 607. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jandhyala, S.M.; Talukdar, R.; Subramanyam, C.; Vuyyuru, H.; Sasikala, M.; Nageshwar Reddy, D. Role of the normal gut microbiota. World J. Gastroenterol. 2015, 21, 8787–8803. [Google Scholar] [CrossRef]
- Brennan, C.A.; Garrett, W.S. Gut Microbiota, Inflammation, and Colorectal Cancer. Annu. Rev. Microbiol. 2016, 70, 395–411. [Google Scholar] [CrossRef] [Green Version]
- Lavelle, A.; Sokol, H. Gut microbiota-derived metabolites as key actors in inflammatory bowel disease. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 223–237. [Google Scholar] [CrossRef]
- Zhu, S.; Jiang, Y.; Xu, K.; Cui, M.; Ye, W.; Zhao, G.; Jin, L.; Chen, X. The progress of gut microbiome research related to brain disorders. J. Neuroinflamm. 2020, 17, 25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carding, S.; Verbeke, K.; Vipond, D.T.; Corfe, B.M.; Owen, L.J. Dysbiosis of the gut microbiota in disease. Microb. Ecol. Health Dis. 2015, 26, 26191. [Google Scholar] [CrossRef] [PubMed]
- Mulle, J.G.; Sharp, W.G.; Cubells, J.F. The gut microbiome: A new frontier in autism research. Curr. Psychiatry Rep. 2013, 15, 337. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kowalski, K.; Mulak, A. Brain-Gut-Microbiota Axis in Alzheimer’s Disease. J. Neurogastroenterol. Motil. 2019, 25, 48–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sochocka, M.; Donskow-Lysoniewska, K.; Diniz, B.S.; Kurpas, D.; Brzozowska, E.; Leszek, J. The Gut Microbiome Alterations and Inflammation-Driven Pathogenesis of Alzheimer’s Disease-a Critical Review. Mol. Neurobiol. 2019, 56, 1841–1851. [Google Scholar] [CrossRef] [Green Version]
- Vogt, N.M.; Kerby, R.L.; Dill-McFarland, K.A.; Harding, S.J.; Merluzzi, A.P.; Johnson, S.C.; Carlsson, C.M.; Asthana, S.; Zetterberg, H.; Blennow, K.; et al. Gut microbiome alterations in Alzheimer’s disease. Sci. Rep. 2017, 7, 13537. [Google Scholar] [CrossRef]
- Heneka, M.T.; Carson, M.J.; El Khoury, J.; Landreth, G.E.; Brosseron, F.; Feinstein, D.L.; Jacobs, A.H.; Wyss-Coray, T.; Vitorica, J.; Ransohoff, R.M.; et al. Neuroinflammation in Alzheimer’s disease. Lancet Neurol. 2015, 14, 388–405. [Google Scholar] [CrossRef] [Green Version]
- Cerovic, M.; Forloni, G.; Balducci, C. Neuroinflammation and the Gut Microbiota: Possible Alternative Therapeutic Targets to Counteract Alzheimer’s Disease? Front. Aging Neurosci. 2019, 11, 284. [Google Scholar] [CrossRef] [Green Version]
- McCoy, K.D.; Burkhard, R.; Geuking, M.B. The microbiome and immune memory formation. Immunol. Cell Biol. 2019, 97, 625–635. [Google Scholar] [CrossRef]
- Wu, H.J.; Ivanov, I.I.; Darce, J.; Hattori, K.; Shima, T.; Umesaki, Y.; Littman, D.R.; Benoist, C.; Mathis, D. Gut-residing segmented filamentous bacteria drive autoimmune arthritis via T helper 17 cells. Immunity 2010, 32, 815–827. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.K.; Menezes, J.S.; Umesaki, Y.; Mazmanian, S.K. Proinflammatory T-cell responses to gut microbiota promote experimental autoimmune encephalomyelitis. Proc. Natl. Acad. Sci. USA 2011, 108 (Suppl. 1), 4615–4622. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Atarashi, K.; Tanoue, T.; Shima, T.; Imaoka, A.; Kuwahara, T.; Momose, Y.; Cheng, G.; Yamasaki, S.; Saito, T.; Ohba, Y.; et al. Induction of colonic regulatory T cells by indigenous Clostridium species. Science 2011, 331, 337–341. [Google Scholar] [CrossRef] [Green Version]
- Fung, T.C.; Olson, C.A.; Hsiao, E.Y. Interactions between the microbiota, immune and nervous systems in health and disease. Nat. Neurosci. 2017, 20, 145–155. [Google Scholar] [CrossRef] [PubMed]
- Ericsson, A.C.; Franklin, C.L. Manipulating the Gut Microbiota: Methods and Challenges. ILAR J. 2015, 56, 205–217. [Google Scholar] [CrossRef] [Green Version]
- Kaur, H.; Golovko, S.; Golovko, M.Y.; Singh, S.; Darland, D.C.; Combs, C.K. Effects of Probiotic Supplementation on Short Chain Fatty Acids in the AppNL-G-F Mouse Model of Alzheimer’s Disease. J. Alzheimer’s Dis. JAD 2020, 76, 1083–1102. [Google Scholar] [CrossRef]
- Kaur, H.; Nagamoto-Combs, K.; Golovko, S.; Golovko, M.Y.; Klug, M.G.; Combs, C.K. Probiotics ameliorate intestinal pathophysiology in a mouse model of Alzheimer’s disease. Neurobiol. Aging 2020, 92, 114–134. [Google Scholar] [CrossRef]
- Vanderpool, C.; Yan, F.; Polk, D.B. Mechanisms of probiotic action: Implications for therapeutic applications in inflammatory bowel diseases. Inflamm. Bowel Dis. 2008, 14, 1585–1596. [Google Scholar] [CrossRef]
- Yan, F.; Polk, D.B. Probiotics and immune health. Curr. Opin. Gastroenterol. 2011, 27, 496–501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saito, T.; Matsuba, Y.; Mihira, N.; Takano, J.; Nilsson, P.; Itohara, S.; Iwata, N.; Saido, T.C. Single App knock-in mouse models of Alzheimer’s disease. Nat. Neurosci. 2014, 17, 661–663. [Google Scholar] [CrossRef] [PubMed]
- Chan, Y.K.; El-Nezami, H.; Chen, Y.; Kinnunen, K.; Kirjavainen, P.V. Probiotic mixture VSL#3 reduce high fat diet induced vascular inflammation and atherosclerosis in ApoE(-/-) mice. AMB Express 2016, 6, 61. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose translation from animal to human studies revisited. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2008, 22, 659–661. [Google Scholar] [CrossRef] [Green Version]
- Zmora, N.; Zilberman-Schapira, G.; Suez, J.; Mor, U.; Dori-Bachash, M.; Bashiardes, S.; Kotler, E.; Zur, M.; Regev-Lehavi, D.; Brik, R.B.; et al. Personalized Gut Mucosal Colonization Resistance to Empiric Probiotics Is Associated with Unique Host and Microbiome Features. Cell 2018, 174, 1388–1405.e1321. [Google Scholar] [CrossRef] [Green Version]
- Schriefer, A.E.; Cliften, P.F.; Hibberd, M.C.; Sawyer, C.; Brown-Kennerly, V.; Burcea, L.; Klotz, E.; Crosby, S.D.; Gordon, J.I.; Head, R.D. A multi-amplicon 16S rRNA sequencing and analysis method for improved taxonomic profiling of bacterial communities. J. Microbiol. Methods 2018, 154, 6–13. [Google Scholar] [CrossRef]
- Nagamoto-Combs, K.; Manocha, G.D.; Puig, K.; Combs, C.K. An improved approach to align and embed multiple brain samples in a gelatin-based matrix for simultaneous histological processing. J. Neurosci. Methods 2016, 261, 155–160. [Google Scholar] [CrossRef] [Green Version]
- Manocha, G.D.; Floden, A.M.; Miller, N.M.; Smith, A.J.; Nagamoto-Combs, K.; Saito, T.; Saido, T.C.; Combs, C.K. Temporal progression of Alzheimer’s disease in brains and intestines of transgenic mice. Neurobiol. Aging 2019, 81, 166–176. [Google Scholar] [CrossRef] [PubMed]
- Thevaranjan, N.; Puchta, A.; Schulz, C.; Naidoo, A.; Szamosi, J.C.; Verschoor, C.P.; Loukov, D.; Schenck, L.P.; Jury, J.; Foley, K.P.; et al. Age-Associated Microbial Dysbiosis Promotes Intestinal Permeability, Systemic Inflammation, and Macrophage Dysfunction. Cell Host Microbe 2018, 23, 570. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tilg, H.; Zmora, N.; Adolph, T.E.; Elinav, E. The intestinal microbiota fuelling metabolic inflammation. Nat. Rev. Immunol. 2020, 20, 40–54. [Google Scholar] [CrossRef] [PubMed]
- Pervolaraki, E.; Hall, S.P.; Foresteire, D.; Saito, T.; Saido, T.C.; Whittington, M.A.; Lever, C.; Dachtler, J. Insoluble Abeta overexpression in an App knock-in mouse model alters microstructure and gamma oscillations in the prefrontal cortex, affecting anxiety-related behaviours. Dis. Models Mech. 2019, 12, dmm040550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nelson, P.T.; Alafuzoff, I.; Bigio, E.H.; Bouras, C.; Braak, H.; Cairns, N.J.; Castellani, R.J.; Crain, B.J.; Davies, P.; Del Tredici, K.; et al. Correlation of Alzheimer disease neuropathologic changes with cognitive status: A review of the literature. J. Neuropathol. Exp. Neurol. 2012, 71, 362–381. [Google Scholar] [CrossRef]
- Dodiya, H.B.; Kuntz, T.; Shaik, S.M.; Baufeld, C.; Leibowitz, J.; Zhang, X.; Gottel, N.; Zhang, X.; Butovsky, O.; Gilbert, J.A.; et al. Sex-specific effects of microbiome perturbations on cerebral Abeta amyloidosis and microglia phenotypes. J. Exp. Med. 2019, 216, 1542–1560. [Google Scholar] [CrossRef] [Green Version]
- Gao, H.; Shu, Q.; Chen, J.; Fan, K.; Xu, P.; Zhou, Q.; Li, C.; Zheng, H. Antibiotic Exposure Has Sex-Dependent Effects on the Gut Microbiota and Metabolism of Short-Chain Fatty Acids and Amino Acids in Mice. mSystems 2019, 4, e00048-19. [Google Scholar] [CrossRef] [Green Version]
- Serrano-Pozo, A.; Muzikansky, A.; Gomez-Isla, T.; Growdon, J.H.; Betensky, R.A.; Frosch, M.P.; Hyman, B.T. Differential relationships of reactive astrocytes and microglia to fibrillar amyloid deposits in Alzheimer disease. J. Neuropathol. Exp. Neurol. 2013, 72, 462–471. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sanmarco, L.M.; Wheeler, M.A.; Gutierrez-Vazquez, C.; Polonio, C.M.; Linnerbauer, M.; Pinho-Ribeiro, F.A.; Li, Z.; Giovannoni, F.; Batterman, K.V.; Scalisi, G.; et al. Gut-licensed IFNgamma(+) NK cells drive LAMP1(+)TRAIL(+) anti-inflammatory astrocytes. Nature 2021, 590, 473–479. [Google Scholar] [CrossRef]
- Jang, S.E.; Lim, S.M.; Jeong, J.J.; Jang, H.M.; Lee, H.J.; Han, M.J.; Kim, D.H. Gastrointestinal inflammation by gut microbiota disturbance induces memory impairment in mice. Mucosal Immunol. 2018, 11, 369–379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grazul, H.; Kanda, L.L.; Gondek, D. Impact of probiotic supplements on microbiome diversity following antibiotic treatment of mice. Gut Microbes 2016, 7, 101–114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Atarashi, K.; Tanoue, T.; Oshima, K.; Suda, W.; Nagano, Y.; Nishikawa, H.; Fukuda, S.; Saito, T.; Narushima, S.; Hase, K.; et al. Treg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature 2013, 500, 232–236. [Google Scholar] [CrossRef] [PubMed]
- Ivanov, I.I.; Atarashi, K.; Manel, N.; Brodie, E.L.; Shima, T.; Karaoz, U.; Wei, D.; Goldfarb, K.C.; Santee, C.A.; Lynch, S.V.; et al. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 2009, 139, 485–498. [Google Scholar] [CrossRef] [Green Version]
- Bolotin, A.; de Wouters, T.; Schnupf, P.; Bouchier, C.; Loux, V.; Rhimi, M.; Jamet, A.; Dervyn, R.; Boudebbouze, S.; Blottiere, H.M.; et al. Genome Sequence of “Candidatus Arthromitus” sp. Strain SFB-Mouse-NL, a Commensal Bacterium with a Key Role in Postnatal Maturation of Gut Immune Functions. Genome Announc. 2014, 2, e00705-14. [Google Scholar] [CrossRef] [Green Version]
- Stadlbauer, V.; Engertsberger, L.; Komarova, I.; Feldbacher, N.; Leber, B.; Pichler, G.; Fink, N.; Scarpatetti, M.; Schippinger, W.; Schmidt, R.; et al. Dysbiosis, gut barrier dysfunction and inflammation in dementia: A pilot study. BMC Geriatr. 2020, 20, 248. [Google Scholar] [CrossRef]
- Chen, C.; Ahn, E.H.; Kang, S.S.; Liu, X.; Alam, A.; Ye, K. Gut dysbiosis contributes to amyloid pathology, associated with C/EBPbeta/AEP signaling activation in Alzheimer’s disease mouse model. Sci. Adv. 2020, 6, eaba0466. [Google Scholar] [CrossRef]
- Wexler, H.M. Bacteroides: The good, the bad, and the nitty-gritty. Clin. Microbiol. Rev. 2007, 20, 593–621. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Henke, M.T.; Kenny, D.J.; Cassilly, C.D.; Vlamakis, H.; Xavier, R.J.; Clardy, J. Ruminococcus gnavus, a member of the human gut microbiome associated with Crohn’s disease, produces an inflammatory polysaccharide. Proc. Natl. Acad. Sci. USA 2019, 116, 12672–12677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pfeiffer, N.; Desmarchelier, C.; Blaut, M.; Daniel, H.; Haller, D.; Clavel, T. Acetatifactor muris gen. nov., sp. nov., a novel bacterium isolated from the intestine of an obese mouse. Arch. Microbiol. 2012, 194, 901–907. [Google Scholar] [CrossRef] [PubMed]
- Parker, B.J.; Wearsch, P.A.; Veloo, A.C.M.; Rodriguez-Palacios, A. The Genus Alistipes: Gut Bacteria With Emerging Implications to Inflammation, Cancer, and Mental Health. Front. Immunol. 2020, 11, 906. [Google Scholar] [CrossRef] [PubMed]
- Kundu, P.; Torres, E.R.S.; Stagaman, K.; Kasschau, K.; Okhovat, M.; Holden, S.; Ward, S.; Nevonen, K.A.; Davis, B.A.; Saito, T.; et al. Integrated analysis of behavioral, epigenetic, and gut microbiome analyses in App(NL-G-F), App(NL-F), and wild type mice. Sci. Rep. 2021, 11, 4678. [Google Scholar] [CrossRef]
- Re, F.; Strominger, J.L. Separate functional domains of human MD-2 mediate Toll-like receptor 4-binding and lipopolysaccharide responsiveness. J. Immunol. 2003, 171, 5272–5276. [Google Scholar] [CrossRef] [Green Version]
- Belkaid, Y.; Hand, T.W. Role of the microbiota in immunity and inflammation. Cell 2014, 157, 121–141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, H.; Guan, X.; Chen, D.; Ma, W. The Th17/Treg Cell Balance: A Gut Microbiota-Modulated Story. Microorganisms 2019, 7, 583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Dye/Antibody | Clone | Fluorochrome | Source |
---|---|---|---|
Fixable/Viability dye | BV510 | Tonbobio | |
Fc Block | Biolegend | ||
CD45 | 30F11 | PErCPCY5-5 | Biolegend |
CD3 | 17A2 | FITC | Biolegend |
CD4 | RM4-5 | BV605 | Biolegend |
CD25 | PC61 | PE | Biolegend |
CD28 | 37.51 | BV421 | Biolegend |
CD62L | MEL-14 | PECY7 | Biolegend |
CD69 | H1.2F3 | APC | Biolegend |
CD11b | M1/70 | PE | Biolegend |
CD14 | PECY7 | Biolegend | |
CD36 | APC | Biolegend | |
F4/80 | BM8 | BV421 | Biolegend |
LY6C | HK1-4 | APC/FIRE750 | Biolegend |
CD4 | RM4-5 | BV605 | Biolegend |
CD25 | PC61 | APC | Biolegend |
FOXP3 | FJK-16s | PE | eBioscience |
Name | Sequence |
---|---|
V1-V2_F | TCGTCGGCAGCGTCAGAGTTTGATCCTGGCTCAG |
V2_F | TCGTCGGCAGCGTCAGYGGCGIACGGGTGAGTAA |
V3_2_F | TCGTCGGCAGCGTCCCTACGGGAGGCAGCAG |
V4_F | TCGTCGGCAGCGTCGTGCCAGCMGCCGCGGTAA |
V5-V6_F | TCGTCGGCAGCGTCAGGATTAGATACCCTGGTA |
V6_1_F | TCGTCGGCAGCGTCAAACTCAAAKGAATTGACGG |
V7-V8_F | TCGTCGGCAGCGTCGYAACGAGCGCAACCC |
V1-V2_R | GTCTCGTGGGCTCGGTGCTGCCTCCCGTAGGAGT |
V2_R | GTCTCGTGGGCTCGGCYIACTGCTGCCTCCCGTAG |
V3_2_R | GTCTCGTGGGCTCGGGTATTACCGCGGCTGCTGG |
V4_R | GTCTCGTGGGCTCGGGGACTACHVGGGTWTCTAAT |
V5-V6_R | GTCTCGTGGGCTCGGCRRCACGAGCTGACGAC |
V6_1_R | GTCTCGTGGGCTCGGACGAGCTGACGACARCCATG |
V7-V8_R | GTCTCGTGGGCTCGGGACGGGCGGTGWGTRC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kaur, H.; Nookala, S.; Singh, S.; Mukundan, S.; Nagamoto-Combs, K.; Combs, C.K. Sex-Dependent Effects of Intestinal Microbiome Manipulation in a Mouse Model of Alzheimer’s Disease. Cells 2021, 10, 2370. https://doi.org/10.3390/cells10092370
Kaur H, Nookala S, Singh S, Mukundan S, Nagamoto-Combs K, Combs CK. Sex-Dependent Effects of Intestinal Microbiome Manipulation in a Mouse Model of Alzheimer’s Disease. Cells. 2021; 10(9):2370. https://doi.org/10.3390/cells10092370
Chicago/Turabian StyleKaur, Harpreet, Suba Nookala, Surjeet Singh, Santhosh Mukundan, Kumi Nagamoto-Combs, and Colin Kelly Combs. 2021. "Sex-Dependent Effects of Intestinal Microbiome Manipulation in a Mouse Model of Alzheimer’s Disease" Cells 10, no. 9: 2370. https://doi.org/10.3390/cells10092370