Next Article in Journal
Biofumigation by Mustard Plants as an Application for Controlling Postharvest Gray Mold in Apple Fruits
Previous Article in Journal
Genome-Wide Identification and Expression Analysis of the Chalcone Synthase (CHS) Gene Family in Dendrobium catenatum
Previous Article in Special Issue
Accumulation of Polyphenolics and Differential Expression of Genes Related to Shikimate Pathway during Fruit Development and Maturation of Chinese Olive (Canarium album)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 13
Issue 6
10.3390/agronomy13061489
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Exogenous Substances Treatment on Fruit Quality and Pericarp Anthocyanin Metabolism of Peach

by
Yidan Kou
,
Jinpeng Ren
,
Yujie Ma
,
Rongrong Guo
,
Juane Shang
,
Dongliang Qiu
and
Cuilan Ma
*
College of Horticulture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Author to whom correspondence should be addressed.
Agronomy 2023, 13(6), 1489; https://doi.org/10.3390/agronomy13061489
Submission received: 29 March 2023 / Revised: 13 May 2023 / Accepted: 25 May 2023 / Published: 28 May 2023
(This article belongs to the Special Issue Variety Breeding and Cultivation Techniques of Stone Fruit Trees)
Browse Figures
Versions Notes

Abstract

:
In this study, the two peach cultivars ‘Baifeng’ and ‘Weiduanmihong’ were used as experimental materials, and their fruits were sprayed with different concentrations of L-glutamic acid, brassinolide, and sucrose to study the effects of these three exogenous substances on fruit quality and anthocyanin metabolism of peaches. The results showed that the appearance quality (average single fruit weight, fruit firmness, and peel color difference), nutritional quality (soluble solids, soluble sugar, titratable acid, anthocyanins, total phenols, flavonoids, etc.), peel anthocyanin-related enzyme activity, and related gene expression of ‘Baifeng’ and ‘Weiduanmihong’ peaches treated with three different exogenous substances were different from those of the control. Higher-concentration treatments could significantly improve the appearance of peach fruit, the nutritional quality of peach fruit and the activity of anthocyanin-related enzymes in peel, as well as promote the expression of related genes. Treatment with 400 mg/L L-glutamic acid significantly promoted the average fruit weight of ‘Baifeng’ peaches. Treatment with 800 mg/L L-glutamic acid significantly promoted the increase in PAL enzyme activity and the expression of PpPAL and PpF3H in the two peach varieties and significantly promoted the expression of anthocyanin metabolism genes PpF3′H and PpGST1 in ‘Baifeng’ peach peel and anthocyanin metabolism gene PpUFGT in ‘Weiduanmihong’ peach peel. Treatment with 34 mg/L sucrose significantly increased the fruit firmness of ‘Baifeng’ peaches and the soluble sugar content of ‘Weiduanmihong’ peaches. Treatment with 51 mg/L sucrose significantly promoted the increase in flavonoid content and PpUFGT expression in ‘Baifeng’ peach fruit and significantly promoted the expression of anthocyanin metabolism genes PpDFR and PpANS in ‘Weiduanmihong’ peach peel. Treatment with 0.6 mg/L brassinolide significantly promoted the increase in soluble solids (TTS), soluble sugar, anthocyanin, total phenol content, PAL enzyme activity, UFGT enzyme activity, and the expression of anthocyanin metabolism genes PpDFR and PpMYB10.1 in ‘Baifeng’ peach fruit, and it significantly increased the average single fruit weight, fruit hardness, anthocyanin content, and UFGT enzyme activity of ‘Weiduanmihong’ peach fruit and promoted the expression of anthocyanin metabolism genes PpF3H and PpGST1 in ‘Weiduanmihong’ peach peel. The comprehensive effect of 0.6 mg/L brassinolide treatment on improving peach fruit quality and increasing anthocyanin content produces the best results and could be popularized in production practices.

1. Introduction

The peach (Prunus persica L.) belongs to the genus Prunus of rosaceae. Native to China, it is one of the most widely cultivated deciduous fruit trees in the world. Gutian County of Fujian Province is one of the main cultivation areas of peaches in China. Due to its suitable climate and soil conditions, the cultivated varieties are mostly southern varieties of peach in China. The peach germplasm resources are rich, the fruit color is diverse, the juice is sweet, and the harvest period is long. Colorful, good quality peaches are popular with Chinese consumers.
Fruit color is an important indicator for judging fruit quality and mainly affects the commodity value and economic returns for fruit growers. Fruit quality and color can be influenced not only by natural environmental conditions and tree development, but also by exogenous chemical treatments. In recent years, the effects of L-glutamic acid, brassinolide, and sucrose on fruit quality and color have been studied for litchis [1], apples [2], tomatoes [3], grapes [4], strawberries [5,6], among other fruits. It has been shown that fruit quality and color can be improved by treatment with exogenous substances. L-glutamic acid plays a key role in the regulation of primary metabolism and the growth and development of plants [7]. It can respond to abiotic stresses by regulating various growth and development attributes [8]. During fruit ripening, the content of sucrose [9], glucose, fructose, citrate [10], and L-glutamic acid [11,12] increase. Studies have shown that exogenous spraying of glutamic acid can significantly promote coloring, increase the soluble sugar content, improve the fruit quality of apples, and significantly increase the anthocyanin content and improve the color of red leaf peach leaves. It has been reported that L-glutamic acid helps to improve the color of fruit and leaf and fruit quality. Lingda et al. [13] treated the fruits of early-maturing litchi varieties ‘Sanyuehong’ and ‘Shuidong’ with different concentrations (500 mg/L, 1000 mg/L, and 1500 mg/L) of glutamic acid for 50 d after full bloom, and the results showed that glutamic acid could promote color change in the peel to red, with the red area of peel increasing with the increase in glutamic acid concentration, and the anthocyanin content of the peel also increased. Liangju et al. [2] treated 13-year-old Fuji apple fruits with 200 mg/L, 400 mg/L, and 800 mg/L of glutamic acid, and the results showed that the different concentrations of glutamic acid treatment could promote the accumulation of anthocyanin in the apple peel, increase the coloring area of the fruit and significantly promote the increase the soluble sugar content. Shun et al. [1] applied 0, 1.10, 1.30, 1.50, 1.70, and 1.90 g/L L-glutamic acid on the surface of ‘Feizixiao’ litchi fruit at 45 d after full bloom, and the results showed that treatment with an appropriate concentration of exogenous L-glutamic acid could significantly enhance the growth and peel coloring of the fruit and effectively improve the nutritional quality of the pulp. The most optimal comprehensive effect was observed at a concentration of 1.30 g/L L-glutamic acid, whereas an excessive concentration of L-glutamic acid (1.90 g/L) was found to inhibit the growth of litchi. The results showed that an appropriate concentration of L-glutamic acid could promote the accumulation of anthocyanin in plants and improve fruit quality. Brassinosteroids (BRs), natural phytochemicals extracted from plants, are considered to be phytohormones and can play a role in plant development. BRs have been found in different organs of more than 20 plant species [14,15]. Ma et al. [16] showed that treating grapefruits with BRs could promote the accumulation of anthocyanin and increase the soluble sugar content in grapefruit. Spraying BRs on grape leaves and fruit clusters can increase the fruit setting rate, single fruit weight, vertical and horizontal diameter, soluble sugar content, and anthocyanin content of grapes and also led to earlier ripening of grapes [17,18]. Symons et al. [17] showed that the application of BRs could not only increase anthocyanin content but also increase phenolic content in the fruit. Studies by Shuichi et al. [19] and Kutschera et al. [20] have shown that BRs can delay the senescence process and promote the development of fruits. Sugar provides the carbon skeletons for the synthesis of esters, proteins, and nucleic acids, through the glycolysis pathway, while also supplying energy for the production of secondary metabolites in fruits. Studies have shown that sugars synthesized within fruits can promote the levels of carbon and nitrogen metabolism in the leaves, and the external application of sugar to fruits can also achieve this function [21]. Zhang [22] used ‘Hongxiangsu’ and ‘Red Sun’ as test materials and sprayed pear trees with 2% and 4% sucrose and fructose. The results showed that each treatment could promote chlorophyll degradation and the synthesis and accumulation of anthocyanins. The results of Li et al. [23], Meng et al. [24], Zhu et al. [25] and Li et al. [26] showed that different concentrations of sucrose promoted the accumulation of anthocyanins. Mengyao et al. [27] treated peach fruits with 200 mmol/L sucrose after harvest and reported that it could promote the accumulation of anthocyanin content in the peel, regulate the activity of related enzymes, and promote the up-regulation the expression of anthocyanin-related genes. Ling et al. [28] treated mature strawberries with a sucrose solution of 50 mmol/L, 100 mmol/L, and 150 mmol/L, and the results showed that all three concentrations could increase the contents of soluble sugar and anthocyanin in fruits. Studies on anthocyanin accumulation in Arabidopsis showed that the expression of the anthocyanin-related genes CHS, CHI, F3H, F3′H, and DFR in leaves was up-regulated after 12 h of sucrose, glucose, and fructose treatment [29].
Therefore, in this study, the fruits of the two peach varieties ‘Baifeng’ (red-skinned, white-fleshed peach) and ‘Weiduanmihong’ (green/red-skinned, white/red-fleshed peach) in Fujian Province were used as experimental materials to study the effects of different concentrations of exogenous substances on the quality and color changes of peach fruits, to provide a theoretical basis for breeding or improving the color of peach fruits and obtaining peach varieties with excellent quality.

2. Materials and Methods

2.1. Test Materials

‘Baifeng’ and ‘Weiduanmihong’ peach fruits were harvested in 2021 at Fujian Yikangyuan Farm Co., Ltd., Luanlong Village, Fengpu Township, Gutian County, Ningde City, Fujian Province. ‘Baifeng’ was harvested 101 d after full bloom (30 June), and ‘Weiduanmihong’ was harvested 115 d after full bloom (15 July). The trees were 4–8 years old, with woolly peaches as rootstock.

2.2. Experimental Treatment

The methodology was based largely on the work of Liangju et al. [2], Xie et al. [30], and Ling et al. [28] combined with other experimental research methods. Three exogenous substances, L-glutamic acid, brassinolide, and sucrose, were selected, and the concentration gradients were set as 200 mg/L L-glutamic acid (L1), 400 mg/L L-glutamic acid (L2), and 800 mg/L L-glutamic acid (L3); 0.2 mg/L brassinolide (Y1), 0.4 mg/L brassinolide (Y2), and 0.6 mg/L brassinolide (Y3); 17 mg/L sucrose solution (Z1), 34 mg/L sucrose solution (Z2), and 51 mg/L sucrose solution (Z3). A total of 9 treatments were applied. The full-bloom stage of ‘Baifeng’ and ‘Weiduanmihong’ was on 15 March and 20 March of the same year. The experimental treatments were sprayed on the fruit surface three times, at 65 d, 75 d, and 85 d after the full-bloom stage of peach. Water was used for the control group (control). In this single plant plot experiment, there were three replicates per plant, and three plants per treatment, for a total of 30 plants. The spraying amounts were applied to the fruit surface, with dripping on leaves and fruits.

2.3. Sampling Method

Samples were taken at the fruit harvest maturity stage, and 4 fruits with a clean surface, no mechanical damage, and no pests and diseases were collected from the same height of the tree crown in the east, south, west, and north directions. A total of 12 fruits were collected from 3 trees in each treatment for the determination of experimental indicators.

2.4. Determination Method

2.4.1. Determination of Appearance Quality of Peach Fruit

Average single fruit weight was determined using the EL3002 electronic balance weigher (10 fruits, average); fruit hardness was measured by the GY-3 pointer fruit hardness tester (i.e., select the equatorial part of the fruit, peel, measure 3 places per fruit, take the average, repeat 10 times). Peel color difference was measured with a Konica Minolta colorimeter (L*, a*, and b* indicators represent the brightness of the color, red–green difference, and yellow–blue difference. The value range of L* is [1, 100], and the value range of a* and b* is [−60, +60]. When a* is positive, it represents the red degree; the greater the value, the redder the color. When a* is negative, it represents the green degree; the smaller the value, the greener the color. When b* is positive, it represents the degree of yellow; the greater the value, the yellower the color. When b* is negative, it represents the degree of blue; the smaller the value, the bluer the color. The C* value reflects the color saturation or purity.

2.4.2. Determination of Nutritional Quality and Enzyme Activity of Peach Fruit

The flesh sample was obtained by mixing and grinding the pulp of ten peach fruits. Soluble solid content was determined using a handheld refractometer (place the mixed pulp into the gauze, squeeze the juice drop on the LH-Q20 hand-held refractometer detection prism, read, repeat 3 times). Soluble sugar content was determined by anthrone colorimetry [31]. Titratable acid content was determined by NaOH standard solution titration [32]; sugar acid ratio = soluble sugar content/total acid content. Anthocyanin content was determined using the method of Li et al. [33], slightly modified; total anthocyanin content (mg/g) = sample mass × OD value × dilution multiple. The anthocyanin components were determined using the method of Lu et al. [34], and the content of anthocyanin components was determined using high performance liquid chromatography (HPLC). The determination of total phenol content was based on the Folin phenol method of Li et al. [33]. The flavonoid content was determined according to the rutin reagent method of Wolfe et al. [35]. Phenylalanine ammonialyase (PAL) and flavonoid glycosyltransferase (UFGT) activities were determined using the Solarbio kit. Each indicator was tested 3 times.

2.4.3. Quantitative Analysis of Anthocyanin-Related Structural Genes and Regulatory Genes in Peach Peel by qRT-PCR

Primer sequence design: Primer design was commissioned by Shangya Biological (Fuzhou, China) Co., Ltd. (Table 1), and PpTEF2 was selected as the internal reference gene of peach actin. Peach peel total RNA extraction was determined using the Biopin polysaccharide polyphenol plant total RNA extraction kit (Hangzhou Bori Technology Co., Ltd., Hangzhou, China). The purity of the RNA sample (Table S1) and the integrity (Figure S1) were determined. After the sample was qualified, RNA was reverse-transcribed into cDNA for qRT-PCR analysis.
The expression of the gene was detected by real-time fluorescence quantitative PCR; the real-time fluorescence quantitative reaction systems are presented in Table S2. Three replicates were set for each sample. The qRT-PCR reaction program was set as follows: pre-denaturation: 95 °C for 1 min; denaturation: 95 °C for 15 s; and annealing: 60 °C for 1 min; repeated for 35 cycles.

2.5. Experimental Instruments and Reagents

2.5.1. Experimental Instruments

The following instruments were used in the experiments: a super pure water system (Hunan Colton Water Co., Ltd., Changsha, China), HunterLab Color Quest XE colorimeter (3 nh high-quality computer colorimeter), LH-Q20 Handheld Refractometer, DYY-6C electrophoresis instrument (Beijing Liuyi Biotechnology Co., Ltd., Beijing, China), electrophoresis tank, Biometra PCR amplification instrument (BIO-RAD Co., Hercules, CA, USA), 3K15 high-speed frozen centrifuge (Yangzhou Xima Centrifuge Co., Ltd., Yangzhou, China), UV5100H UV visible spectrophotometer (Shanghai Yuanxi Instrument Co., Ltd., Shanghai, China), and JS-3000 automatic gel imaging analyzer (Shanghai Peiqing Technology Co., Ltd., Shanghai, China).

2.5.2. Reagents

The following reagents were used in the experiments: methanol (chromatographic pure) (Shanghai McLean Biochemical Technology Co., Ltd., Shanghai, China), acetonitrile (chromatographic pure) (Shanghai McLean Biochemical Technology Co., Ltd.), formic acid (chromatographic pure) (Shanghai Aladdin Biochemical Technology Co., Ltd., Shanghai, China), delphinidin glucoside standard (Beijing Solarbio Technology Co., Ltd., Beijing, China), cyanidin glucoside standard (Beijing Solarbio Technology Co., Ltd.), pelargonidin glucoside standard (Beijing Solarbio Technology Co., Ltd.), L-glutamic acid, brassinolide, sucrose, concentrated sulfuric acid, anthrone, ethyl acetate, phenolphthalein, 2,6-dichloroindophenol, oxalic acid, ascorbic acid, concentrated hydrochloric acid, methanol, gallic acid, Folin phenol, rutin, carbazole, galacturonic acid, and anhydrous ethanol; all were of analytical purity.

2.6. Data Analysis and Methods

Excel 2010 was used to process the original data, SPSS 26.0 was used for variance analysis, and Graphpad Prism 8.0 was used to produce charts.

3. Results

3.1. Influence of Exogenous Material Treatment on Peach Fruit Appearance Traits

When treated with three different concentrations of exogenous substances, the average single fruit weight, fruit hardness, and peel color difference of ‘Baifeng’ and ‘Weiduanmihong’ peaches changed significantly (p < 0.05) (Table 2). The appearance of ‘Baifeng’ and ‘Weiduanmihong’ peach fruit is shown in Figure 1. The average fruit weight of ‘Baifeng’ peaches after 34 mg/L sucrose treatment was 175.32 g, which was significantly higher than that produced by other treatments. The average single fruit weight of ‘Weiduanmihong’ peaches treated with 0.6 mg/L brassinolide was 349.94 g, which was significantly higher than that produced by other treatments. The fruit hardness of ‘Baifeng’ peaches was 10.25 kg/cm2. With the exception of 0.2 mg/L brassinolide and 17 mg/L sucrose treatments, the treatments promoted an increase in fruit hardness; 400 mg/L L-glutamic acid treatment had the most significant effect. The fruit hardness of ‘Weiduanmihong’ peaches was 9.60 kg/cm2. With the exception of 400 mg/L and 800 mg/L L-glutamic acid treatments, the treatments increased fruit hardness; 0.6 mg/L brassinolide treatment was the best. In terms of the change in L* value, 800 mg/L L-glutamic acid, 0.6 mg/L brassinolide, and 51 mg/L sucrose treatments significantly reduced the L* value of ‘Baifeng’ and ‘Weiduanmihong’ peach peel. In terms of the change in a* value, 800 mg/L L-glutamic acid, 0.6 mg/L brassinolide, and 51 mg/L sucrose treatments significantly increased the a* value of ‘Baifeng’ peach peel. With the exception of 200 mg/L L-glutamic acid, 0.2 mg/L brassinolide, and 17 mg/L and 34 mg/L sucrose treatments, the a* values of ‘Weiduanmihong’ peach peel were significantly increased by the treatments. In terms of the change in b* value, 800 mg/L L-glutamic acid, 0.6 mg/L brassinolide, and 51 mg/L sucrose treatments significantly reduced the b* value of ‘Baifeng’ peel; 400 mg/L L-glutamic acid, 0.4 mg/L brassinolide, and 51 mg/L sucrose treatments significantly decreased the b* value of ‘Weiduanmihong’ peel. In terms of the change in C* value, 800 mg/L L-glutamic acid as well as 17 mg/L and 34 mg/L sucrose treatments significantly reduced the C* value of ‘Baifeng’ peel; 0.4 mg/L brassinolide and 34 mg/L sucrose treatments significantly reduced the C* value of ‘Weiduanmihong’ peach peel.
The results showed that the average single fruit weight, fruit hardness, and peel color differences of ‘Baifeng’ and ‘Weiduanmihong’ peaches were affected by exogenous substances, and the effects were more significant under high concentrations of exogenous substances.

3.2. Effects of Exogenous Substances on Nutritional Quality of Peach Fruit

3.2.1. Effects of Exogenous Substances on Total Soluble Solids (TSS), Soluble Sugar, and Titratable Acid of Peach Fruit

After treatment with different exogenous substances, the soluble solids (TSS), soluble sugar, and titratable acid of ‘Baifeng’ and ‘Weiduanmihong’ peach fruits changed significantly (Table 3). The TSS content of ‘Baifeng’ peach fruit increased significantly after high-concentration treatment of exogenous substances; 800 mg/L-glutamic acid treatment was the most significant (TSS = 15.0%), followed by 0.6 mg/L brassinolide treatment. In ‘Weiduanmihong’ peach fruit, 0.4 mg/L brassinolide treatment was the most significant (TSS = 13.77%), followed by 800 mg/L L-glutamic acid and 34 mg/L sucrose. For soluble sugar content, 800 mg/L L-glutamic acid, 0.6 mg/L brassinolide, and 51 mg/L sucrose significantly promoted the accumulation of soluble sugar content in ‘Baifeng’ peach fruit, and the changes were consistent with TSS. In ‘Weiduanmihong’ fruit, 34 mg/L sucrose treatment resulted in significantly higher soluble sugar than other treatments, at 11.27 g/L. For titratable acid content, ‘Baifeng’ had the least titratable acid content and the highest sugar–acid ratio under 0.6 mg/L brassinolide treatment. The 800 mg/L L-glutamic acid treatment in ‘Weiduanmihong’ significantly reduced the titratable acid content, and the sugar–acid ratio was the highest. Comprehensive analysis showed that the higher concentrations of the three substances could increase the TSS and soluble sugar content of peach fruit, reduce the titratable acid content, and improve the nutritional quality of peach fruit.

3.2.2. Effects of Three Exogenous Substances on Anthocyanins, Total Phenols, and Flavonoid Contents in Peach Peel

Treatment using different exogenous substances on ‘Baifeng’ and ‘Weiduanmihong’ peach fruit resulted in significant changes in peach fruit anthocyanins, total phenols, and flavonoids (p < 0.05) (Table 4). The anthocyanin content of ‘Baifeng’ peach fruit after the control treatment was 1.51 mg/g. After analysis, 800 mg/L L-glutamic acid, 0.6 mg/L brassinolide, and 51 mg/L sucrose solution significantly increased anthocyanin content by 238.41%, 386.75%, and 207.28%, respectively. The effect of 0.6 mg/L brassinolide on promoting anthocyanin accumulation in peel was more significant; the promoting effect of 0.6 mg/L brassinolide was similar in ‘Weiduanmihong’ and ‘Baifeng’ peach fruit. HPLC analysis showed that cyanidin and pelargonidin were detected in the peels of ‘Baifeng’ and ‘Weiduanmihong’ peaches, and their contents varied with the concentration of exogenous substances; they increased significantly under 0.6 mg/L brassinolide treatment. This is essentially consistent with the change trend of anthocyanin content.
The total phenol content in the peel of ‘Baifeng’ and ‘Weiduanmihong’ peaches varied under different treatments. The total phenol content in ‘Baifeng’ peaches decreased except for in the 0.6 mg/L brassinolide treatment. In ‘Weiduanmihong’, only 200 mg/L L-glutamic acid led to a decrease in total phenol content. Other treatments led to an increase in the total phenol content, and the 0.2 mg/L brassinolide treatment was the most significant. In terms of the change in flavonoid content, the 51 mg/L sucrose treatment significantly promoted the increase in flavonoid content in ‘Baifeng’ peaches, followed by 0.6 mg/L brassinolide treatment. The promotion effect of 0.2 mg/L and 0.6 mg/L brassinolide in ‘Weiduanmihong’ peaches was the most significant. The results showed that brassinolide treatment could significantly increase the contents of anthocyanins, total phenols, and flavonoids in peach fruit, and high concentrations resulted in more significant effects.

3.3. Effects of Three Exogenous Substances on PAL and UFGT Enzyme Activities in Peach Peel

The PAL and UFGT enzyme activities of ‘Baifeng’ peaches were 29.11 mg/mL and 119.30 ng/L, respectively. The PAL enzyme activity was the most significant under 800 mg/L L-glutamic acid treatment, followed by 0.6 mg/L brassinolide and 51 mg/L sucrose treatments. UFGT enzyme activity was significantly increased under 0.6 mg/L brassinolide treatment. The PAL and UFGT enzyme activities of ‘Weiduanmihong’ peaches were 56.01 mg/mL and 118.81 ng/L, respectively (Figure 2). It was seen that 800 mg/L L-glutamic acid treatment significantly promoted PAL enzyme activity, followed by 0.6 mg/L brassinolide treatment, which was consistent with the change rule of PAL enzyme activity in ‘Baifeng’ peach peel. UFGTase activity was significantly promoted by 800 mg/L L-glutamic acid and 0.6 mg/L brassinolide. The results showed that 800 mg/L L-glutamic acid and 0.6 mg/L brassinolide treatment significantly promoted PAL and UFGT enzyme activities in peach peel.

3.4. Effects of Three Exogenous Substances on the Expression of Anthocyanin-Related Structural Genes and Regulatory Genes in Peach Peel

After treatment with different exogenous substances, the expression differences of anthocyanin-related structural genes PpPAL, PpUFGT, PpCHS, PpCHI, PpF3H, PpF3′H, PpDFR, and PpANS in the peel of ‘Baifeng’ and ‘Weiduanmihong’ peaches were inconsistent (Figure 3, Figure 4 and Figure 5). In ‘Baifeng’, 800 mg/L L-glutamic acid significantly promoted the expression of PpPAL, PpF3H, and PpF3′H; 0.6 mg/L brassinolide significantly promoted the expression of PpDFR but inhibited the expression of PpCHI; 0.2 mg/L brassinolide significantly promoted the expression of PpF3H; 0.4 mg/L brassinolide significantly promoted the expression of PpANS; 51 mg/L sucrose solution significantly promoted the expression of PpPAL, PpUFGT, PpF3H, and PpCHS. In addition, in ‘Weiduanmihong’ peaches, 800 mg/L L-glutamic acid significantly promoted the expression of PpPAL, PpF3H, PpUFGT, PpCHS, and PpANS, but there was no significant difference in the expression of PpF3′H; 400 mg/L L-glutamic acid significantly promoted the expression of PpF3′H; the 51 mg/L sucrose solution significantly promoted the expression of PpPAL, PpUFGT, PpDFR, and PpANS, but had no significant effect on the expression of PpCHS; the 17 mg/L sucrose solution significantly promoted the expression of PpCHS; 0.6 mg/L brassinolide significantly promoted the expression of PpF3H and inhibited the expression of PpDFR. The results showed that the anthocyanin structural genes PpPAL, PpUFGT, PpCHS, PpCHI, PpF3H, PpF3′H, PpDFR, and PpANS in peach peel may be regulated by different concentrations of exogenous substances to a certain extent, and their expression levels are different.
PpGST1 and PpMYB10.1 are anthocyanin transporter genes and regulatory genes. The expression of the two genes was different after treatment with different concentrations of L-glutamic acid, brassinolide, and sucrose solution (Figure 6). Compared with the control, there was no significant difference in the expression of PpGST1 in ‘Baifeng’ peaches. The expression of PpGST1 was significantly increased by 0.6 mg/L brassinolide and 51 mg/L sucrose in ‘Weiduanmihong’ peaches. PpMYB10.1 was significantly regulated by 0.6 mg/L brassinolide in ‘Baifeng’, and 400 mg/L L-glutamic acid and 0.4 mg/L brassinolide in ‘Weiduanmihong’.

4. Discussion

4.1. Effects of Three Exogenous Substances on Fruit Quality and Anthocyanin-Related Enzyme Activities of Peach

Compared with the control, the average fruit weight and fruit hardness of ‘Baifeng’ and ‘Weiduanmihong’ peaches were significantly increased after being treated with different concentrations of L-glutamic acid, brassinolide, and sucrose. The increase in fruit hardness can prolong the storage and sales time of fruit after harvest. The content and proportion of sugar and acid determine the flavor of fruit. In this study, high-concentration treatments of three exogenous substances significantly increased the content of soluble solids and soluble sugar and decreased the content of titratable acid, which was consistent with the results for ‘Hongli’ peach [36] fruit, and similar results were also found in apples [2] and blueberries [37]. The sugar–acid ratio of peach fruit increased after treatment with three exogenous substances, which may be related to the low accumulation or degradation of titratable acid in the mature period of ‘Baifeng’ and ‘Weiduanmihong’ as fresh food varieties, or to the significant accumulation of sugar content by exogenous substances. In this study, the total phenolic content of each treatment group of ‘Baifeng’ was not significantly higher than that of the control; rather, the content decreased. Only the 0.6 mg/L brassinolide treatment was similar to the content in the control treatment, which was contrary to the conclusion of Feng Xiaoxue et al. [38]. This may be related to the differences in fruit types and genotypes; after brassinolide treatment, the content of total phenols and flavonoids in ‘Weiduanmihong’ fruit increased significantly, which may be related to the fact that brassinolide can stimulate various physiological and biological processes and improve physiological functions such as plant stress resistance [39]. Flavonoids and anthocyanins have rich biological activities and have good effects in preventing vascular diseases and diabetes [40]. Improving the content of flavonoids and anthocyanins in peach fruit is helpful to enrich fruit nutrition.
Sugar content is closely related to anthocyanin accumulation during fruit growth. In this study, after treatment with L-glutamic acid, brassinolide and sucrose, the change trend of anthocyanin content in peach peel was essentially consistent with that of soluble sugar content, which was related to sugar as a precursor in the process of anthocyanin metabolism. It can not only promote the metabolism of anthocyanin in fruit but also induce anthocyanin synthesis through specific signal transduction pathways as a signal molecule [23]. Under 0.6 mg/L brassinolide treatment, the anthocyanin content of ‘Baifeng’ and ‘Weiduanmihong’ peach fruits was significantly different from that of the control, with the soluble sugar content of ‘Baifeng’ fruit having the most notable increase. The increase was similar to the results of Zeng et al. [13], Zhu et al. [41], and Symons et al. [17]. After treatment with three kinds of exogenous substances, the changes in color difference parameters and PAL and UFGT enzyme activities in peach peel were essentially consistent with the changes of anthocyanin content, indicating that different concentrations of exogenous substances could increase the activity of anthocyanin-related enzymes and promote the accumulation of anthocyanin in peach peel. However, the difference between the low concentration treatment and the control was small, which was consistent with the views of Tian et al. [27] and Han Jian et al. [42]. Comprehensive analysis showed that L-glutamic acid, brassinolide, and sucrose treatments promoted the color and anthocyanin-related metabolic enzyme activities of peach fruit. Among them, brassinolide is more effective than L-glutamic acid and sucrose. At present, the application of brassinolide in fruit trees mainly focuses on improving fruit setting rate, improving quality, regulating vegetative growth and improving stress resistance [43,44].

4.2. Effects of Three Exogenous Substances on Anthocyanin Metabolism-Related Genes in Peach Fruit

At present, the effects of L-glutamic acid, brassinolide, and sucrose on anthocyanin metabolism-related genes in peach fruit have not been reported. This study mainly discusses the changes of several related structural genes and regulatory genes in the anthocyanin metabolism pathway of peach fruit, so as to explain the key genes affecting the increase in anthocyanin content after treatment with exogenous substances. Under 0.6 mg/L brassinolide treatment, the anthocyanin content of ‘Baifeng’ and ‘Weiduanmihong’ peaches was significantly higher than that of other treatments, and the expression levels of its metabolism-related genes PpDFR and PpMYB10.1 were significantly increased, followed by PpF3H and PpUFGT, while the expression level of PpCHS was significantly lower than that of the control, indicating that PpDFR, PpF3H, PpUFGT, and PpMYB10.1 under 0.6 mg/L brassinolide treatment play a key role in anthocyanin synthesis in peach fruit. Lewis et al. [45] used natural indole-3-acetic acid (IAA) to treat Arabidopsis thaliana and found that the expression levels of anthocyanin structural genes CHS and F3H were up-regulated. The expression of CHS was opposite to the expression of PpCHS under 0.6 mg/L brassinolide treatment in this study, suggesting that it may be related to the type of exogenous substances.
Tong et al. [46] studied the quality of grapes by using exogenous abscisic acid and mechanical defoliation. The results showed that spraying exogenous abscisic acid and defoliation simultaneously changed the carbon supply, and the balance between sugar and anthocyanin could be re-established through genome-wide transcriptome remodeling, thereby improving the quality of grape berries. Liu et al. [47] studied the response mechanism of TIFE family genes to exogenous jasmonic acid during the development of highbush blueberry flowers and fruits, which provided information regarding the response mechanism of L-glutamic acid, brassinolide, and sucrose treatment on key genes of anthocyanin metabolism in peach fruit in the later stage of the experiment and provided directions for further research on how to improve the quality of peach fruit by exogenous material treatment.

5. Conclusions

After treatment with different concentrations of L-glutamic acid, brassinolide, and sucrose solution, the quality of peach fruit was shown to be significantly improved by high-concentration treatment. Among them, the quality of ‘Baifeng’ and ‘Weiduanmihong’ peach fruit was significantly improved under the treatment of 0.6 mg/L brassinolide. The anthocyanin content, related enzyme activity, and the expression of metabolism-related genes PpDFR and PpMYB10.1 were significantly increased; the comprehensive treatment effect showed the best results. Brassinolide is known as the sixth largest plant hormone; it is safe, non-toxic, and can be used in Fujian peach plantations.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy13061489/s1, Table S1. Total RNA concentration and OD value of peach peel treated with three exogenous substances. Figure S1. Electrophoretogram of total RNA in peach peel treated with three exogenous substances. Note: M: loading buffer; numbers 1–10 and 1′–10′ represent control, L-glutamate (200 mg/L, 400 mg/L, 800 mg/L), brassinolide (0.2 mg/L, 0.4 mg/L, 0.6 mg/L), and sucrose (17 mg/L, 34 mg/L, 51 mg/L) in the ‘Baifeng’ and ‘Weiduanmihong’ treatment groups, respectively. Table S2. Real-time fluorescence quantitative reaction system table.

Author Contributions

Conceptualization, C.M. and Y.K.; methodology, Y.K., J.R., Y.M., R.G., J.S. and D.Q.; software, Y.K.; validation, Y.K., J.R., Y.M., R.G. and J.S.; formal analysis, Y.K.; investigation, Y.K.; resources, D.Q. and C.M.; data curation, Y.K.; writing—original draft preparation, C.M. and Y.K.; writing—review & editing, C.M. and Y.K.; visualization, C.M. and Y.K.; supervision, C.M.; project administration, D.Q. and C.M.; funding acquisition, C.M. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by Fujian Provincial Natural Science Foundation Projects (2022J01590) and National College Student Innovation Training Program (202210389036).

Acknowledgments

The authors thank the teachers and students of the laboratory for their help and support during the experiment and article writing process and are extremely grateful to Qingzhong Su from Yikangyuan Agricultural Co., Ltd., in Luanlong Village, Fengpu Township, Gutian County, who kindly provided large quantities of ‘Baifeng’ and ‘Weiduanmihong’ peach trees and fruits.

Conflicts of Interest

The author declares that there is no conflict of interest.

References

  1. Shun, F.; Shaopeng, L.; Lina, L.; Fan, W.; Ting, C.; Chao, Y.; Mei, L.; Maofu, L. Regulation of exogenous L-glutamic acid on growth, coloring and nutritional quality of litchi fruit. Acta Bot. Boreali-Occident. Sin. 2015, 35, 2266–2272. [Google Scholar]
  2. Liangju, W.; Zhonghua, W.; Zhiqiang, L.; Yunna, Z. Effects of L-glutamic acid on anthocyanin accumulation in Fuji apple. J. Fruit Sci. 2006, 23, 157–160+154. [Google Scholar]
  3. Tong, Z.; Wen-Rong, T.; Xing-Guang, D.; Ting, Z.; Da-Wei, Z.; Hong-Hui, L. Effects of brassinosteroids on quality attributes and ethylene synthesis in postharvest tomato fruit. Postharvest Biol. Technol. 2015, 100, 196–204. [Google Scholar]
  4. Xiaofeng, Y.; Shiqiu, L.; Shichao, W.; Yulin, F.; Zhenwen, Z.; Yanlun, J. Transcriptomic and Metabolic Analyses Provide New Insights into the Effects of Exogenous Sucrose on Monoterpene Synthesis in “Muscat Hamburg” Grapes. J. Agric. Food Chem. 2021, 69, 4164–4176. [Google Scholar]
  5. Dong, L.; Xiaochen, Z.; Yanqun, X.; Li, L.i.; Morteza, S.A.; Zisheng, L. Effect of exogenous sucrose on anthocyanin synthesis in postharvest strawberry fruit. Food Chem. 2019, 289, 112–120. [Google Scholar]
  6. Yajie, L.; Qin, M.; Fan, M.; Cong, G.; Shu, L.; Ya, L. Effects of exogenous sugar treatment on fruit quality and main bioactive substances of strawberry. J. Sichuan Agric. Univ. 2018, 36, 67–71. [Google Scholar]
  7. Chia-Cheng, K.; Tsui-Yun, C.; Hsin-Yu, W.; Yan-An, J.; Ming-Hsiun, H. Exogenous glutamate rapidly induces the expression of genes involved in metabolism and defense responses in rice roots. BMC Genom. 2017, 18, 186. [Google Scholar]
  8. Asgher, M.; Sehar, Z.; Rehaman, A.; Rashid, S.; Ahmed, S.; Per, T.S.; Alyemeni, M.N.; Khan, N.A. Exogenously-applied L-glutamic acid protects photosynthetic functions and enhances arsenic tolerance through increased nitrogen assimilation and antioxidant capacity in rice (Oryza sativa L.). Environ. Pollut. 2022, 301, 119008. [Google Scholar] [CrossRef] [PubMed]
  9. Yelle, S.; Chetelat, R.T.; Dorais, M.; Deverna, J.W.; Bennett, A.B. Sink Metabolism in Tomato Fruit: IV. Genetic and Biochemical Analysis of Sucrose Accumulation. Plant Physiol. 1991, 95, 1026. [Google Scholar] [CrossRef]
  10. Rolin, D.; Baldet, P.; Just, D.; Chevalier, C.; Biran, M.; Raymond, P. NMR study of low subcellular pH during the development of cherry tomato fruit. Funct. Plant Biol. 2000, 13, 99051. [Google Scholar]
  11. Boggio, S.B.; Palatnik, J.F.; Heldt, H.W.; Valle, E.M. Changes in amino acid composition and nitrogen metabolizing enzymes in ripening fruits of lycopersicon esculentum mill. Plant Sci. Limerick 2000, 1159, 125–133. [Google Scholar] [CrossRef] [PubMed]
  12. Kisaka, H.; Kida, T. Transgenic tomato plant carrying a gene for NADP-dependent glutamate dehydrogenase (gdhA) from Aspergillus nidulans. Plant Sci. Limerck 2003, 164, 35–42. [Google Scholar] [CrossRef]
  13. Lingda, Z.; Jianliang, L.; Houbin, C. Effects of glutamic acid and TDZ on pericarp coloration and fruit quality of litchi. J. Trop. Subtrop. Bot. 2012, 4, 382–387. [Google Scholar]
  14. Bao-Jun, Z.; Qian, W.; Jing-Hui, W.; Lin-Lin, G.; Jing-Wen, Z.; Ru-Qiang, H. DFR and PAL gene transcription and their correlation with anthocyanin accumulation in Rhodomyrtus tomentosa (Aiton.) Hassk. Turk. J. Biochem. 2019, 44, 289–298. [Google Scholar]
  15. Jianming, L.; Joanne, C. Brassinosteroid actions in plants. J. Exp. Bot. 1999, 50, 275–282. [Google Scholar]
  16. Ma, H.; Chen, J.; Liu, Z. Effects of natural brassinolide and PDJ on fruit quality and ripening period. North. Hortic. 2004, 6, 59–60. [Google Scholar]
  17. Gregory, M.S.; Davies, C.; Shavrukov, Y.; Dry, I.B.; Reid, J.B.; Thomas, M.R. Grapes on steroids. brassinosteroids are involved in grape berry ripening. Plant Physiol. 2006, 140, 150–158. [Google Scholar]
  18. Zhou, X.; Li, B.; Liu, H. Application effect of brassinolide on processing grape varieties. J. Anhui Agric. Sci. 2003, 31, 2. [Google Scholar]
  19. Shuichi, I.; Shigeto, T.; Shinichi, H. Retardation of abscission of citrus leaf and fruitlet explants by brassinolide. Plant Growth Regul. 1990, 9, 119–125. [Google Scholar]
  20. Kutschera, U.; Zhi-Yong, W. Brassinosteroid action in flowering plants: A Darwinian perspective. J. Exp. Bot. 2012, 63, 3511–3522. [Google Scholar] [CrossRef]
  21. Shin-Lon, H.; Yu-Chan, C.; Wu-Fu, T.; Su-May, Y. Sugar Coordinately and Differentially Regulates Growth- and Stress-Related Gene Expression via a Complex Signal Transduction Network and Multiple Control Mechanisms. Plant Physiol. 2001, 125, 877–890. [Google Scholar]
  22. Zhang, Q. Relationship between Fruit Coloring and Soluble Sugar and the Effect of Exogenous Sugar on Fruit Coloring. Ph.D. Thesis, Nanjing Agricultural University, Nanjing, China, 2012. [Google Scholar]
  23. Qian, L.I.; Lijun, Z.; Xu, Z.; Yanye, R.; Zhenhai, C. Regulation of sugar on anthocyanin synthesis and accumulation in plants. Chem. Life 2009, 29, 218–222. [Google Scholar]
  24. Meng, X.; Wang, X.; Zhang, Y. Study on some factors affecting anthocyanin accumulation in maize roots. J. South China Norm. Univ. 2012, 2002, 25–28. [Google Scholar]
  25. Zhu, L. Effects of Different Light Intensities and Exogenous Sucrose on Flower Color and Photosynthetic Characteristics of ’Luoyanghong’ Peony. Ph.D. Thesis, Henan Agricultural University, Zhengzhou, China, 2005. [Google Scholar]
  26. Li, X. Spraying sugar solution to promote fruit coloring during flowering and late fruit development. South. China Fruits 1997, 2, 41. [Google Scholar]
  27. Mengyao, T.; Hongsheng, Z.; Tang, T.; Yingming, Z.; Jun, L.; Shufen, L.; Pengxia, L. Effects of exogenous sucrose treatment on the color formation of postharvest peach peel. Food Sci. 2022, 43, 177–183. [Google Scholar]
  28. Ling, Y. Mechanism of Exogenous Sucrose and Abscisic Acid Regulating Strawberry Fruit Ripening. Ph.D. Thesis, Sichuan Agricultural University, Yaan, China, 2018. [Google Scholar]
  29. Solfanelli, C.; Poggi, A.; Loreti, E.; Alpi, A.; Perata, P. Sucrose-specific induction of the anthocyanin biosynthetic pathway in arabidopsis. Plant Physiol. 2006, 140, 637–646. [Google Scholar] [CrossRef] [PubMed]
  30. Xie, L.; Zhao, D.; Wang, H.; Ao, H. Effects of brassinolide on quality and antioxidant activity of blueberry. Guizhou Agric. Sci. 2018, 46, 21–25. [Google Scholar]
  31. Wang, X.; Huang, J. Plant Physiological and Biochemical Experiment Principle and Technology. Master Thesis, Higher Education Press, Beijing, China, 2015. [Google Scholar]
  32. Guidance of Plant Physiological Experiment. Master’s Thesis, Higher Education Press, Beijing, China, 1990.
  33. Min, L.; Yueting, S.; Xiaocao, L.; Biswojit, D.; Sangeeta, M.; Dongliang, Q. Proteomics Reveal the Profiles of Color Change in Brunfelsia acuminata Flowers. Int. J. Mol. Sci. 2019, 20, 2000. [Google Scholar]
  34. Xiaocao, L.; Zhipeng, Q.; Min, L.; Chu, C.; Yueting, S.; Dongliang, Q. Optimization of anthocyanin extraction process from grape peel. Chin. Agric. Sci. Bull. 2019, 35, 114–121. [Google Scholar]
  35. Wolfe, K.; Wu, X.; Liu, R.H. Antioxidant Activity of Apple Peels. Food Chem. 2003, 51, 609–614. [Google Scholar] [CrossRef]
  36. Zhu, L.; Shuchai, S.; Chao, M.; Qian, B.; Shaoyan, Y. Effects of brassinolide on photosynthesis and fruit quality of Feicheng peach. Non-Wood For. Res. 2016, 34, 73–78. [Google Scholar]
  37. Shu, P.; Tingting, Z.; Li, L.; Qin, Y.; Yinxiang, X. Effects of exogenous sucrose treatment on key quality during blueberry fruit development. J. Green Sci. Technol. 2020, 17, 82–84. [Google Scholar]
  38. Xiaoxue, F. Effects of Brassinolide on Physiological and Biochemical Characteristics and Quality of Red Globe Grape. Ph.D. Thesis, Gansu Agricultural University, Lanzhou, China, 2014. [Google Scholar]
  39. Zheng, T.; Jianhui, C.; Lingzhu, W.; Jiang, X.; Jiang, W. Brassinolide and its research progress in horticultural plants. Mol. Plant Breed. 2022, 1–9. Available online: http://kns.cnki.net/kcms/detail/46.1068.s.20220113.1105.004.html (accessed on 29 March 2023).
  40. Yuhan, Y. Detection and Content Analysis of Flavonoids and Synephrine in Yuhan Lemon. Ph.D. Thesis, Southwest University, Chongqing, China, 2011. [Google Scholar]
  41. Zhu-mei, X.; Zhen-wen, Z.; Shan-shan, H.; Li-ying, L.; Xiang, G.; Li-na, M.; Yu-lin, F. Regulating the secondary metabolism in grape berry using exogenous 24-epibrassinolide for enhanced phenolics content and antioxidant capacity. Food Chem. 2013, 141, 3056–3065. [Google Scholar]
  42. Jian, H.; Gaopan, S.; Binbin, Z.; Mangling, W.; Zhihua, X.; Weibing, J. Effects of foliar spraying L-glutamic acid and rhamnose on pigment changes and related physiological characteristics of red leaf peach in summer. J. Nanjing Agric. Univ. 2012, 35, 19–24. [Google Scholar]
  43. Liu, J.; Wu, H. Research progress on the application of brassinolide in fruit trees. Mod. Rural. Sci. Technol. 2012, 436, 58–59. [Google Scholar]
  44. Zhang, Y.; Liu, W.; Sun, S.; Zhang, C. Research progress on the application of brassinolide in fruit trees. Anhui Agric. Sci. 2010, 38, 6153–6154+6157. [Google Scholar]
  45. Lewis, D.R.; Ramirez, M.V.; Miller, N.D.; Vallabhaneni, P.; Ray, W.K.; Helm, R.F.; Winkel, B.S.J.; Muday, G.K. Auxin and ethylene induce flavonol accumulation through distinct transcriptional networks. Plant. Physiol. 2011, 156, 144–164. [Google Scholar] [CrossRef]
  46. Tong, Q.; Liu, L.; Zhao, Y.; Kong, J.; Wang, Y.; Xu, X.; Hilbert, G.; Gomès, E.; Dai, Z. Transcriptome Remodeling in Response to Leaf Removal and Exogenous Abscisic Acid in Berries of Grapevine (Vitis vinifera L.) Fruit Cuttings. Hortic. 2022, 8, 905. [Google Scholar] [CrossRef]
  47. Liu, L.; Bai, N.; Zheng, Y.; Chen, L.; Zong, Y.; Ye, L.; Li, Y.; Liao, F.; Lu, M.; Yang, L.; et al. Genome-wide identification and analysis of TIFY family in highbush blueberry and their responses to exogenous jasmonic acid. Sci. Hortic. 2022, 305, 111391. [Google Scholar] [CrossRef]
Agronomy 13 01489 g001 550
Figure 1. The ripening stage of the fruits of ‘Baifeng’ and ‘Weiduanmihong’ after treated with exogenous substances. Note: (a) is ‘Baifeng’; (b) is ‘Weiduanmihong’.
Figure 1. The ripening stage of the fruits of ‘Baifeng’ and ‘Weiduanmihong’ after treated with exogenous substances. Note: (a) is ‘Baifeng’; (b) is ‘Weiduanmihong’.
Agronomy 13 01489 g001
Agronomy 13 01489 g002 550
Figure 2. Effects of three exogenous substances on PAL and UFGT enzyme activities in peach peel. Note: (a,b) indicate PAL and UFGT enzymatic activity of ‘Baifeng’, respectively; (c,d) indicate PAL and UFGT enzymatic activity of ‘Weiduanmihong’. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Figure 2. Effects of three exogenous substances on PAL and UFGT enzyme activities in peach peel. Note: (a,b) indicate PAL and UFGT enzymatic activity of ‘Baifeng’, respectively; (c,d) indicate PAL and UFGT enzymatic activity of ‘Weiduanmihong’. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Agronomy 13 01489 g002
Agronomy 13 01489 g003 550
Figure 3. Effects of three exogenous substances on the expression of PpPAL, PpUFGT, and PpCHS. Note: (a) is ’Baifeng’; (b) is ’Weiduanmihong’. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Figure 3. Effects of three exogenous substances on the expression of PpPAL, PpUFGT, and PpCHS. Note: (a) is ’Baifeng’; (b) is ’Weiduanmihong’. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Agronomy 13 01489 g003
Agronomy 13 01489 g004 550
Figure 4. Effects of three exogenous substances on the expression of PpCHI, PpF3H, and PpF3′H. Note: (a) is ’Baifeng’; (b) is ’Weiduanmihong’. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Figure 4. Effects of three exogenous substances on the expression of PpCHI, PpF3H, and PpF3′H. Note: (a) is ’Baifeng’; (b) is ’Weiduanmihong’. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Agronomy 13 01489 g004
Agronomy 13 01489 g005 550
Figure 5. Effects of three exogenous substances on the expression of DFR and ANS. Note: (a) is ’Baifeng’; (b) is ’Weiduanmihong’. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Figure 5. Effects of three exogenous substances on the expression of DFR and ANS. Note: (a) is ’Baifeng’; (b) is ’Weiduanmihong’. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Agronomy 13 01489 g005
Agronomy 13 01489 g006 550
Figure 6. Effects of three exogenous substances on the expression of anthocyanin-related regulatory genes PpGST1 and PpMYB10.1 in peach peel. Note: (a) is ’Baifeng’; (b) is ’Weiduanmihong’. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Figure 6. Effects of three exogenous substances on the expression of anthocyanin-related regulatory genes PpGST1 and PpMYB10.1 in peach peel. Note: (a) is ’Baifeng’; (b) is ’Weiduanmihong’. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Agronomy 13 01489 g006
Table
Table 1. Real-time fluorescent quantitative genes and their PCR primer sequences.
Table 1. Real-time fluorescent quantitative genes and their PCR primer sequences.
Gene NameF/RPrimer Sequences/5′-3′
PpPALForwardTTGCCATGGATAACACCAG
ReverseGATTTGAAGGCAACCCATTG
PbCHSForwardCAGAGATACCCAAAGGTTGGAAGGC
ReverseAACCATCCTTCCCGACAGCGAT
PpCHIForwardTGAAGACCTCAAGGAACTTCTCAATGG
ReverseACACAGGTGACAACGATACTGCCACT
PpF3HForwardTCCGAGGGCAGAGCGAAGAAC
ReverseTTGTGGAGGCTTGTGAGGATTGG
PpF3′HForwardCCCAACTTGACCTACCTCCA
ReverseCTTTGGGATGTGGAAGCTGT
PpDFRForwardGGTCGTCCAGGTGAACATACTGCC
ReverseATTTCTCATGCCATCCATGCCAC
PpANSForwardAAGTGGGTCACTGCCAAGTGTGTTC
ReverseGTGGCTCACAGAAAACTGCCCAT
PpUFGTForwardCCGCTGCCTCTCCCSAACACTC
ReverseCCATCAGCCACATCAAACACCTTTAT
PpGST1ForwardCAGGGTTGTTCCCAATAGGTT
ReverseCAGGGTTGTTCCCAATAGGTT
PpMYB10.1ForwardCAGGAAGGACAGCGAATGATG
ReverseTCGGGGTTGAGGTCTTATTACG
PpTEF2ForwardGGTGTGACGATGAAGAGTGATG
ReverseTGAAGGAGAGGGAAGGTGAAAG
Table
Table 2. Effects of three exogenous substances on appearance quality of peach fruit.
Table 2. Effects of three exogenous substances on appearance quality of peach fruit.
Variety NameTreatmentAverage Single Fruit Weight (g)Fruit Hardness (kg/cm2)Peel Color Difference
L*a*b*C*
‘Baifeng’CK123.43 ± 6.30 de10.25 ± 0.43 fg66.60 ± 1.08 cd12.44 ± 1.31 cd28.02 ± 0.93 a34.18 ± 0.27 a
L1135.71 ± 9.54 cde13.77 ± 0.39 abc52.79 ± 1.32 bcde16.36 ± 1.22 abc25.57 ± 0.89 abc31.24 ± 2.17 abc
L2155.81 ± 5.57 abc15.00 ± 0.58 a48.41 ± 1.55 cdef15.04 ± 2.07 bc24.11 ± 0.87 abcd32.88 ± 1.01 ab
L3138.97 ± 7.15 bcde14.07 ± 1.87 ab44.86 ± 1.09 ef22.28 ± 4.14 ab20.85 ± 0.69 d25.91 ± 0.33 d
Y1122.22 ± 5.49 de9.33 ± 1.33 gh56.41 ± 2.31 ab16.18 ± 0.78 abc23.73 ± 0.92 abcd29.16 ± 1.44 bcd
Y2115.03 ± 5.31 e12.60 ± 1.30 bcd49.59 ± 1.40 bcd16.66 ± 0.98 abc23.05 ± 0.98 bcd28.90 ± 0.78 bcd
Y3142.78 ± 5.95 bcd12.15 ± 1.59 cde46.72 ± 1.32 def22.39 ± 1.99 a20.48 ± 1.24 d30.72 ± 0.45 bcd
Z1162.10 ± 6.64 ab8.33 ± 0.33 h56.92 ± 1.72 ab12.41 ± 1.11 cd26.04 ± 1.27 ab27.32 ± 0.35 cd
Z2175.32 ± 11.43 a10.60 ± 0.31 efg53.27 ± 1.47 bcd17.01 ± 1.39 abc21.31 ± 0.76 cd27.36 ± 1.05 cd
Z3144.95 ± 6.27 bcd11.17 ± 0.73 def43.29 ± 1.81 a19.56 ± 1.23 abc20.62 ± 1.09 d28.98 ± 1.36 bcd
‘Weiduanmihong’CK285.44 ± 15.58 ab9.60 ± 1.82 b70.92 ± 1.08 a11.70 ± 1.72 abc35.78 ± 0.93 a39.35 ± 0.68 a
L1304.62 ± 9.35 abc11.00 ± 1.62 ab52.04 ± 1.32 bc10.95 ± 1.44 abc26.00 ± 0.89 bcd28.63 ± 0.53 bc
L2276.70 ± 12.24 bcd6.55 ± 0.51 b53.55 ± 1.55 bc15.90 ± 1.78 a24.31 ± 0.87 cd29.60 ± 0.63 bc
L3309.59 ± 9.49 ab8.10 ± 0.81 ab51.13 ± 1.09 bc1 5.95 ± 1.14 a26.63 ± 0.69 cd28.73 ± 0.58 bc
Y1320.42 ± 14.52 ab9.71 ± 1.12 ab56.19 ± 1.32 cd11.25 ± 1.46 bcd29.83 ± 0.92 b30.70 ± 0.73 b
Y2295.14 ± 12.92 bc10.20 ± 0.54 ab52.16 ± 1.40 bc12.34 ± 1.20 abc23.24 ± 0.98 cd26.67 ± 0.56 c
Y3349.94 ± 15.76 a12.63 ± 1.65 a49.59 ± 1.67 cd15.59 ± 1.36 ab24.30 ± 1.24 cd27.33 ± 0.93 c
Z1264.08 ± 11.50 bc9.80 ± 1.99 ab56.07 ± 1.72 b10.42 ± 1.71 abc26.54 ± 1.27 bc28.23 ± 0.68 bc
Z2243.36 ± 12.96 d9.65 ± 1.82 ab48.40 ± 1.47 cd10.25 ± 1.65 bcd24.39 ± 0.76 cd26.95 ± 0.62 c
Z3248.78 ± 10.43 d11.45 ± 1.81 ab44.65 ± 1.81 d15.32 ± 1.37 ab22.24 ± 1.09 d27.47 ± 1.25 c
Note: L1 (200 mg/L L-glutamic acid); L2 (400 mg/L L-glutamic acid); L3 (800 mg/L L-glutamic acid); Y1 (0.2 mg/L brassinolide); Y2 (0.4 mg/L brassinolide); Y3 (0.6 mg/L brassinolide); Z1 (17 mg/L sucrose); Z2 (34 mg/L sucrose); Z3 (51 mg/L sucrose). Color difference L* represents black and white channel (0 represents black, and 100 represents white); a* represents the red-green channel; a > 0 means the color is reddish; a < 0 means the color is greenish; b* represents the yellow-blue channel; b > 0 means the color is yellowish; b < 0 means the color is blueish; the C* value reflects the color saturation or purity. The greater the chroma, the brighter the color. Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Table
Table 3. Effects of three exogenous substances on soluble solids (TSS), soluble sugar and titratable acid of peach fruit.
Table 3. Effects of three exogenous substances on soluble solids (TSS), soluble sugar and titratable acid of peach fruit.
Treatment‘Baifeng’‘Weiduanmihong’
Soluble Solids (%)Soluble Sugar Content (g/L)Titratable Acid Content (g/L)Sugar to Acid RatioSoluble Solids (%)Soluble Sugar Content (g/L)Titratable Acid Content (g/L)Sugar to Acid Ratio
CK11.50 ± 0.29 bcd9.53 ± 0.51 de0.24 ± 0.00 ab36.95 ± 1.98 e12.27 ± 0.82 b9.93 ± 0.64 bcd0.24 ± 0.01 bc32.42 ± 2.40 ef
L110.50 ± 0.29 d8.90 ± 0.69 de0.23 ± 0.00 b38.56 ± 3.32 e12.02 ± 0.58 c10.86 ± 0.33 ab0.28 ± 0.01 ab42.69 ± 2.79 cde
L212.33 ± 0.41 bc8.34 ± 0.30 e0.21 ± 0.00 de39.70 ± 0.50 de12.67 ± 0.33 abc10.56 ± 0.78 abc0.19 ± 0.01 ef55.35 ± 6.07 bc
L315.00 ± 0.28 a11.63 ± 0.43 abc0.20 ± 0.00 ef56.88 ± 1.18 b13.01 ± 0.29 ab10.87 ± 0.58 ab0.13 ± 0.00 g87.02 ± 7.58 a
Y111.83 ± 0.34 bc9.53 ± 0.44 de0.25 ± 0.00 a38.56 ± 2.29 e11.00 ± 0.58 c7.61 ± 0.20 e0.30 ± 0.01 a25.79 ± 1.06 f
Y211.33 ± 0.17 cd9.08 ± 0.29 de0.21 ± 0.00 de42.79 ± 0.85 cde13.77 ± 0.50 a10.15 ± 0.89 abc0.28 ± 0.01 ab36.11 ± 3.59 ef
Y314.83 ± 0.44 a11.94 ± 0.30 a0.19 ± 0.00 g64.45 ± 1.95 a12.60 ± 0.31 abc9.91 ± 0.45 bcd0.25 ± 0.00 c39.39 ± 1.07 de
Z112.67 ± 0.33 b10.34 ± 0.68 cd0.23 ± 0.00 bc45.79 ± 2.41 cd11.00 ± 0.58 c8.56 ± 0.51 cde0.26 ± 0.01 bc33.34 ± 1.67 ef
Z211.50 ± 0.29 bcd10.37 ± 0.27 bcd0.22 ± 0.00 cd48.14 ± 1.79 c13.01 ± 0.68 ab11.27 ± 0.60 ab0.22 ± 0.00 de51.68 ± 1.58 bcd
Z314.67 ± 0.54 a11.90 ± 0.22 ab0.20 ± 0.00 f60.60 ± 1.63 ab12.80 ± 0.31 ab10.16 ± 0.86 abc0.19 ± 0.01 f63.89 ± 2.70 b
Note: Values in the same column followed by different lowercase letters indicate significant difference at the 0.05 level.
Table
Table 4. Effects of three exogenous substances on the contents of anthocyanins, total phenols, and flavonoids in peach peel.
Table 4. Effects of three exogenous substances on the contents of anthocyanins, total phenols, and flavonoids in peach peel.
Treatment‘Baifeng’‘Weiduanmihong’
Anthocyanin Content (mg/g)Cyanidin Pigment Content
(μg/mL)		Pelargonidin Pigment Content
(μg/mL)		Total Phenolic Content (mg/g)Flavonoid Content (mg/g)Anthocyanin Content (mg/g)Cyanidin Pigment Content (μg/mL)Pelargonidin Pigment Content (μg/mL)Total Phenolic Content (mg/g)Flavonoid Content (mg/g)
CK1.51 ± 0.11 g19.44 ± 0.11 h12.75 ± 0.21 f0.16 ± 0.00 a1.19 ± 0.05 d3.81 ± 0.03 g25.49 ± 0.39 e21.19 ± 1.52 e0.31 ± 0.01 e3.62 ± 0.98 e
L12.71 ± 0.09 e22.77 ± 0.26 ef13.87 ± 0.31 c0.11 ± 0.01 cd1.20 ± 0.05 d3.54 ± 0.16 g23.15 ± 0.62 f20.39 ± 0.56 e0.29 ± 0.02 e2.91 ± 0.58 f
L22.80 ± 0.05 e24.69 ± 1.19 d13.35 ± 0.16 cde0.12 ± 0.01 bc1.19 ± 0.05 d4.57 ± 0.08 de26.84 ± 0.26 d22.45 ± 0.58 d0.37 ± 0.01 abc4.28 ± 0.87 cd
L35.11 ± 0.29 b24.16 ± 0.83 de13.44 ± 0.10 cd0.01 ± 0.00 d0.91 ± 0.11 e5.98 ± 0.15 c30.33 ± 0.98 c24.70 ± 0.82 c0.39 ± 0.01 ab4.71 ± 0.45 bc
Y12.17 ± 0.17 f20.61 ± 0.58 gh13.04 ± 0.13 def0.13 ± 0.00 bc1.34 ± 0.05 cd2.77 ± 0.10 h21.09 ± 0.29 g16.48 ± 0.21 f0.41 ± 0.01 a5.49 ± 0.86 a
Y23.82 ± 0.05 d27.25 ± 0.39 c13.67 ± 0.20 c0.12 ± 0.00 bcd1.13 ± 0.06 de4.16 f ± 0.16 g35.98 ± 0.33 a30.96 ± 0.52 b0.35 ± 0.01 cd4.03 ± 0.18 de
Y37.35 ± 0.09 a39.97 ± 0.23 a15.23 ± 0.13 a0.16 ± 0.01 a1.71 ± 0.02 b8.58 ± 0.23 a35.93 ± 0.28 a33.47 ± 0.26 a0.40 ± 0.02 a5.12 ± 0.22 ab
Z11.73 ± 0.15 fg19.74 ± 0.51 h12.76 ± 0.13 f0.11 ± 0.00 cd1.51 ± 0.04 bc2.27 ± 0.02 i19.02 ± 0.52 h15.75 ± 0.32 f0.32 ± 0.01 de4.35 ± 0.11 cd
Z23.11 ± 0.06 e21.64 ± 0.74 fg12.83 ± 0.15 ef0.12 ± 0.00 bcd1.57 ± 0.15 bc4.92 ± 0.10 d27.06 ± 0.74 d22.73 ± 0.74 d0.35 ± 0.01 bcd4.39 ± 0.64 cd
Z34.64 ± 0.05 c31.44 ± 0.60 b14.50 ± 0.10 b0.14 ± 0.01 b2.73 ± 0.10 a6.52 ± 0.02 b32.30 ± 0.50 c25.47 ± 0.13 c0.37 ± 0.01 abc4.51 ± 0.82 c
Note: Values in the same column followed by different lowercase letters indicate a significant difference at the 0.05 level.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kou, Y.; Ren, J.; Ma, Y.; Guo, R.; Shang, J.; Qiu, D.; Ma, C. Effects of Exogenous Substances Treatment on Fruit Quality and Pericarp Anthocyanin Metabolism of Peach. Agronomy 2023, 13, 1489. https://doi.org/10.3390/agronomy13061489

AMA Style

Kou Y, Ren J, Ma Y, Guo R, Shang J, Qiu D, Ma C. Effects of Exogenous Substances Treatment on Fruit Quality and Pericarp Anthocyanin Metabolism of Peach. Agronomy. 2023; 13(6):1489. https://doi.org/10.3390/agronomy13061489

Chicago/Turabian Style

Kou, Yidan, Jinpeng Ren, Yujie Ma, Rongrong Guo, Juane Shang, Dongliang Qiu, and Cuilan Ma. 2023. "Effects of Exogenous Substances Treatment on Fruit Quality and Pericarp Anthocyanin Metabolism of Peach" Agronomy 13, no. 6: 1489. https://doi.org/10.3390/agronomy13061489

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop