Effects of Exogenous Substances Treatment on Fruit Quality and Pericarp Anthocyanin Metabolism of Peach
Abstract
:1. Introduction
2. Materials and Methods
2.1. Test Materials
2.2. Experimental Treatment
2.3. Sampling Method
2.4. Determination Method
2.4.1. Determination of Appearance Quality of Peach Fruit
2.4.2. Determination of Nutritional Quality and Enzyme Activity of Peach Fruit
2.4.3. Quantitative Analysis of Anthocyanin-Related Structural Genes and Regulatory Genes in Peach Peel by qRT-PCR
2.5. Experimental Instruments and Reagents
2.5.1. Experimental Instruments
2.5.2. Reagents
2.6. Data Analysis and Methods
3. Results
3.1. Influence of Exogenous Material Treatment on Peach Fruit Appearance Traits
3.2. Effects of Exogenous Substances on Nutritional Quality of Peach Fruit
3.2.1. Effects of Exogenous Substances on Total Soluble Solids (TSS), Soluble Sugar, and Titratable Acid of Peach Fruit
3.2.2. Effects of Three Exogenous Substances on Anthocyanins, Total Phenols, and Flavonoid Contents in Peach Peel
3.3. Effects of Three Exogenous Substances on PAL and UFGT Enzyme Activities in Peach Peel
3.4. Effects of Three Exogenous Substances on the Expression of Anthocyanin-Related Structural Genes and Regulatory Genes in Peach Peel
4. Discussion
4.1. Effects of Three Exogenous Substances on Fruit Quality and Anthocyanin-Related Enzyme Activities of Peach
4.2. Effects of Three Exogenous Substances on Anthocyanin Metabolism-Related Genes in Peach Fruit
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Shun, F.; Shaopeng, L.; Lina, L.; Fan, W.; Ting, C.; Chao, Y.; Mei, L.; Maofu, L. Regulation of exogenous L-glutamic acid on growth, coloring and nutritional quality of litchi fruit. Acta Bot. Boreali-Occident. Sin. 2015, 35, 2266–2272. [Google Scholar]
- Liangju, W.; Zhonghua, W.; Zhiqiang, L.; Yunna, Z. Effects of L-glutamic acid on anthocyanin accumulation in Fuji apple. J. Fruit Sci. 2006, 23, 157–160+154. [Google Scholar]
- Tong, Z.; Wen-Rong, T.; Xing-Guang, D.; Ting, Z.; Da-Wei, Z.; Hong-Hui, L. Effects of brassinosteroids on quality attributes and ethylene synthesis in postharvest tomato fruit. Postharvest Biol. Technol. 2015, 100, 196–204. [Google Scholar]
- Xiaofeng, Y.; Shiqiu, L.; Shichao, W.; Yulin, F.; Zhenwen, Z.; Yanlun, J. Transcriptomic and Metabolic Analyses Provide New Insights into the Effects of Exogenous Sucrose on Monoterpene Synthesis in “Muscat Hamburg” Grapes. J. Agric. Food Chem. 2021, 69, 4164–4176. [Google Scholar]
- Dong, L.; Xiaochen, Z.; Yanqun, X.; Li, L.i.; Morteza, S.A.; Zisheng, L. Effect of exogenous sucrose on anthocyanin synthesis in postharvest strawberry fruit. Food Chem. 2019, 289, 112–120. [Google Scholar]
- Yajie, L.; Qin, M.; Fan, M.; Cong, G.; Shu, L.; Ya, L. Effects of exogenous sugar treatment on fruit quality and main bioactive substances of strawberry. J. Sichuan Agric. Univ. 2018, 36, 67–71. [Google Scholar]
- Chia-Cheng, K.; Tsui-Yun, C.; Hsin-Yu, W.; Yan-An, J.; Ming-Hsiun, H. Exogenous glutamate rapidly induces the expression of genes involved in metabolism and defense responses in rice roots. BMC Genom. 2017, 18, 186. [Google Scholar]
- Asgher, M.; Sehar, Z.; Rehaman, A.; Rashid, S.; Ahmed, S.; Per, T.S.; Alyemeni, M.N.; Khan, N.A. Exogenously-applied L-glutamic acid protects photosynthetic functions and enhances arsenic tolerance through increased nitrogen assimilation and antioxidant capacity in rice (Oryza sativa L.). Environ. Pollut. 2022, 301, 119008. [Google Scholar] [CrossRef] [PubMed]
- Yelle, S.; Chetelat, R.T.; Dorais, M.; Deverna, J.W.; Bennett, A.B. Sink Metabolism in Tomato Fruit: IV. Genetic and Biochemical Analysis of Sucrose Accumulation. Plant Physiol. 1991, 95, 1026. [Google Scholar] [CrossRef]
- Rolin, D.; Baldet, P.; Just, D.; Chevalier, C.; Biran, M.; Raymond, P. NMR study of low subcellular pH during the development of cherry tomato fruit. Funct. Plant Biol. 2000, 13, 99051. [Google Scholar]
- Boggio, S.B.; Palatnik, J.F.; Heldt, H.W.; Valle, E.M. Changes in amino acid composition and nitrogen metabolizing enzymes in ripening fruits of lycopersicon esculentum mill. Plant Sci. Limerick 2000, 1159, 125–133. [Google Scholar] [CrossRef] [PubMed]
- Kisaka, H.; Kida, T. Transgenic tomato plant carrying a gene for NADP-dependent glutamate dehydrogenase (gdhA) from Aspergillus nidulans. Plant Sci. Limerck 2003, 164, 35–42. [Google Scholar] [CrossRef]
- Lingda, Z.; Jianliang, L.; Houbin, C. Effects of glutamic acid and TDZ on pericarp coloration and fruit quality of litchi. J. Trop. Subtrop. Bot. 2012, 4, 382–387. [Google Scholar]
- Bao-Jun, Z.; Qian, W.; Jing-Hui, W.; Lin-Lin, G.; Jing-Wen, Z.; Ru-Qiang, H. DFR and PAL gene transcription and their correlation with anthocyanin accumulation in Rhodomyrtus tomentosa (Aiton.) Hassk. Turk. J. Biochem. 2019, 44, 289–298. [Google Scholar]
- Jianming, L.; Joanne, C. Brassinosteroid actions in plants. J. Exp. Bot. 1999, 50, 275–282. [Google Scholar]
- Ma, H.; Chen, J.; Liu, Z. Effects of natural brassinolide and PDJ on fruit quality and ripening period. North. Hortic. 2004, 6, 59–60. [Google Scholar]
- Gregory, M.S.; Davies, C.; Shavrukov, Y.; Dry, I.B.; Reid, J.B.; Thomas, M.R. Grapes on steroids. brassinosteroids are involved in grape berry ripening. Plant Physiol. 2006, 140, 150–158. [Google Scholar]
- Zhou, X.; Li, B.; Liu, H. Application effect of brassinolide on processing grape varieties. J. Anhui Agric. Sci. 2003, 31, 2. [Google Scholar]
- Shuichi, I.; Shigeto, T.; Shinichi, H. Retardation of abscission of citrus leaf and fruitlet explants by brassinolide. Plant Growth Regul. 1990, 9, 119–125. [Google Scholar]
- Kutschera, U.; Zhi-Yong, W. Brassinosteroid action in flowering plants: A Darwinian perspective. J. Exp. Bot. 2012, 63, 3511–3522. [Google Scholar] [CrossRef]
- Shin-Lon, H.; Yu-Chan, C.; Wu-Fu, T.; Su-May, Y. Sugar Coordinately and Differentially Regulates Growth- and Stress-Related Gene Expression via a Complex Signal Transduction Network and Multiple Control Mechanisms. Plant Physiol. 2001, 125, 877–890. [Google Scholar]
- Zhang, Q. Relationship between Fruit Coloring and Soluble Sugar and the Effect of Exogenous Sugar on Fruit Coloring. Ph.D. Thesis, Nanjing Agricultural University, Nanjing, China, 2012. [Google Scholar]
- Qian, L.I.; Lijun, Z.; Xu, Z.; Yanye, R.; Zhenhai, C. Regulation of sugar on anthocyanin synthesis and accumulation in plants. Chem. Life 2009, 29, 218–222. [Google Scholar]
- Meng, X.; Wang, X.; Zhang, Y. Study on some factors affecting anthocyanin accumulation in maize roots. J. South China Norm. Univ. 2012, 2002, 25–28. [Google Scholar]
- Zhu, L. Effects of Different Light Intensities and Exogenous Sucrose on Flower Color and Photosynthetic Characteristics of ’Luoyanghong’ Peony. Ph.D. Thesis, Henan Agricultural University, Zhengzhou, China, 2005. [Google Scholar]
- Li, X. Spraying sugar solution to promote fruit coloring during flowering and late fruit development. South. China Fruits 1997, 2, 41. [Google Scholar]
- Mengyao, T.; Hongsheng, Z.; Tang, T.; Yingming, Z.; Jun, L.; Shufen, L.; Pengxia, L. Effects of exogenous sucrose treatment on the color formation of postharvest peach peel. Food Sci. 2022, 43, 177–183. [Google Scholar]
- Ling, Y. Mechanism of Exogenous Sucrose and Abscisic Acid Regulating Strawberry Fruit Ripening. Ph.D. Thesis, Sichuan Agricultural University, Yaan, China, 2018. [Google Scholar]
- Solfanelli, C.; Poggi, A.; Loreti, E.; Alpi, A.; Perata, P. Sucrose-specific induction of the anthocyanin biosynthetic pathway in arabidopsis. Plant Physiol. 2006, 140, 637–646. [Google Scholar] [CrossRef] [PubMed]
- Xie, L.; Zhao, D.; Wang, H.; Ao, H. Effects of brassinolide on quality and antioxidant activity of blueberry. Guizhou Agric. Sci. 2018, 46, 21–25. [Google Scholar]
- Wang, X.; Huang, J. Plant Physiological and Biochemical Experiment Principle and Technology. Master Thesis, Higher Education Press, Beijing, China, 2015. [Google Scholar]
- Guidance of Plant Physiological Experiment. Master’s Thesis, Higher Education Press, Beijing, China, 1990.
- Min, L.; Yueting, S.; Xiaocao, L.; Biswojit, D.; Sangeeta, M.; Dongliang, Q. Proteomics Reveal the Profiles of Color Change in Brunfelsia acuminata Flowers. Int. J. Mol. Sci. 2019, 20, 2000. [Google Scholar]
- Xiaocao, L.; Zhipeng, Q.; Min, L.; Chu, C.; Yueting, S.; Dongliang, Q. Optimization of anthocyanin extraction process from grape peel. Chin. Agric. Sci. Bull. 2019, 35, 114–121. [Google Scholar]
- Wolfe, K.; Wu, X.; Liu, R.H. Antioxidant Activity of Apple Peels. Food Chem. 2003, 51, 609–614. [Google Scholar] [CrossRef]
- Zhu, L.; Shuchai, S.; Chao, M.; Qian, B.; Shaoyan, Y. Effects of brassinolide on photosynthesis and fruit quality of Feicheng peach. Non-Wood For. Res. 2016, 34, 73–78. [Google Scholar]
- Shu, P.; Tingting, Z.; Li, L.; Qin, Y.; Yinxiang, X. Effects of exogenous sucrose treatment on key quality during blueberry fruit development. J. Green Sci. Technol. 2020, 17, 82–84. [Google Scholar]
- Xiaoxue, F. Effects of Brassinolide on Physiological and Biochemical Characteristics and Quality of Red Globe Grape. Ph.D. Thesis, Gansu Agricultural University, Lanzhou, China, 2014. [Google Scholar]
- Zheng, T.; Jianhui, C.; Lingzhu, W.; Jiang, X.; Jiang, W. Brassinolide and its research progress in horticultural plants. Mol. Plant Breed. 2022, 1–9. Available online: http://kns.cnki.net/kcms/detail/46.1068.s.20220113.1105.004.html (accessed on 29 March 2023).
- Yuhan, Y. Detection and Content Analysis of Flavonoids and Synephrine in Yuhan Lemon. Ph.D. Thesis, Southwest University, Chongqing, China, 2011. [Google Scholar]
- Zhu-mei, X.; Zhen-wen, Z.; Shan-shan, H.; Li-ying, L.; Xiang, G.; Li-na, M.; Yu-lin, F. Regulating the secondary metabolism in grape berry using exogenous 24-epibrassinolide for enhanced phenolics content and antioxidant capacity. Food Chem. 2013, 141, 3056–3065. [Google Scholar]
- Jian, H.; Gaopan, S.; Binbin, Z.; Mangling, W.; Zhihua, X.; Weibing, J. Effects of foliar spraying L-glutamic acid and rhamnose on pigment changes and related physiological characteristics of red leaf peach in summer. J. Nanjing Agric. Univ. 2012, 35, 19–24. [Google Scholar]
- Liu, J.; Wu, H. Research progress on the application of brassinolide in fruit trees. Mod. Rural. Sci. Technol. 2012, 436, 58–59. [Google Scholar]
- Zhang, Y.; Liu, W.; Sun, S.; Zhang, C. Research progress on the application of brassinolide in fruit trees. Anhui Agric. Sci. 2010, 38, 6153–6154+6157. [Google Scholar]
- Lewis, D.R.; Ramirez, M.V.; Miller, N.D.; Vallabhaneni, P.; Ray, W.K.; Helm, R.F.; Winkel, B.S.J.; Muday, G.K. Auxin and ethylene induce flavonol accumulation through distinct transcriptional networks. Plant. Physiol. 2011, 156, 144–164. [Google Scholar] [CrossRef]
- Tong, Q.; Liu, L.; Zhao, Y.; Kong, J.; Wang, Y.; Xu, X.; Hilbert, G.; Gomès, E.; Dai, Z. Transcriptome Remodeling in Response to Leaf Removal and Exogenous Abscisic Acid in Berries of Grapevine (Vitis vinifera L.) Fruit Cuttings. Hortic. 2022, 8, 905. [Google Scholar] [CrossRef]
- Liu, L.; Bai, N.; Zheng, Y.; Chen, L.; Zong, Y.; Ye, L.; Li, Y.; Liao, F.; Lu, M.; Yang, L.; et al. Genome-wide identification and analysis of TIFY family in highbush blueberry and their responses to exogenous jasmonic acid. Sci. Hortic. 2022, 305, 111391. [Google Scholar] [CrossRef]
Gene Name | F/R | Primer Sequences/5′-3′ |
---|---|---|
PpPAL | Forward | TTGCCATGGATAACACCAG |
Reverse | GATTTGAAGGCAACCCATTG | |
PbCHS | Forward | CAGAGATACCCAAAGGTTGGAAGGC |
Reverse | AACCATCCTTCCCGACAGCGAT | |
PpCHI | Forward | TGAAGACCTCAAGGAACTTCTCAATGG |
Reverse | ACACAGGTGACAACGATACTGCCACT | |
PpF3H | Forward | TCCGAGGGCAGAGCGAAGAAC |
Reverse | TTGTGGAGGCTTGTGAGGATTGG | |
PpF3′H | Forward | CCCAACTTGACCTACCTCCA |
Reverse | CTTTGGGATGTGGAAGCTGT | |
PpDFR | Forward | GGTCGTCCAGGTGAACATACTGCC |
Reverse | ATTTCTCATGCCATCCATGCCAC | |
PpANS | Forward | AAGTGGGTCACTGCCAAGTGTGTTC |
Reverse | GTGGCTCACAGAAAACTGCCCAT | |
PpUFGT | Forward | CCGCTGCCTCTCCCSAACACTC |
Reverse | CCATCAGCCACATCAAACACCTTTAT | |
PpGST1 | Forward | CAGGGTTGTTCCCAATAGGTT |
Reverse | CAGGGTTGTTCCCAATAGGTT | |
PpMYB10.1 | Forward | CAGGAAGGACAGCGAATGATG |
Reverse | TCGGGGTTGAGGTCTTATTACG | |
PpTEF2 | Forward | GGTGTGACGATGAAGAGTGATG |
Reverse | TGAAGGAGAGGGAAGGTGAAAG |
Variety Name | Treatment | Average Single Fruit Weight (g) | Fruit Hardness (kg/cm2) | Peel Color Difference | |||
---|---|---|---|---|---|---|---|
L* | a* | b* | C* | ||||
‘Baifeng’ | CK | 123.43 ± 6.30 de | 10.25 ± 0.43 fg | 66.60 ± 1.08 cd | 12.44 ± 1.31 cd | 28.02 ± 0.93 a | 34.18 ± 0.27 a |
L1 | 135.71 ± 9.54 cde | 13.77 ± 0.39 abc | 52.79 ± 1.32 bcde | 16.36 ± 1.22 abc | 25.57 ± 0.89 abc | 31.24 ± 2.17 abc | |
L2 | 155.81 ± 5.57 abc | 15.00 ± 0.58 a | 48.41 ± 1.55 cdef | 15.04 ± 2.07 bc | 24.11 ± 0.87 abcd | 32.88 ± 1.01 ab | |
L3 | 138.97 ± 7.15 bcde | 14.07 ± 1.87 ab | 44.86 ± 1.09 ef | 22.28 ± 4.14 ab | 20.85 ± 0.69 d | 25.91 ± 0.33 d | |
Y1 | 122.22 ± 5.49 de | 9.33 ± 1.33 gh | 56.41 ± 2.31 ab | 16.18 ± 0.78 abc | 23.73 ± 0.92 abcd | 29.16 ± 1.44 bcd | |
Y2 | 115.03 ± 5.31 e | 12.60 ± 1.30 bcd | 49.59 ± 1.40 bcd | 16.66 ± 0.98 abc | 23.05 ± 0.98 bcd | 28.90 ± 0.78 bcd | |
Y3 | 142.78 ± 5.95 bcd | 12.15 ± 1.59 cde | 46.72 ± 1.32 def | 22.39 ± 1.99 a | 20.48 ± 1.24 d | 30.72 ± 0.45 bcd | |
Z1 | 162.10 ± 6.64 ab | 8.33 ± 0.33 h | 56.92 ± 1.72 ab | 12.41 ± 1.11 cd | 26.04 ± 1.27 ab | 27.32 ± 0.35 cd | |
Z2 | 175.32 ± 11.43 a | 10.60 ± 0.31 efg | 53.27 ± 1.47 bcd | 17.01 ± 1.39 abc | 21.31 ± 0.76 cd | 27.36 ± 1.05 cd | |
Z3 | 144.95 ± 6.27 bcd | 11.17 ± 0.73 def | 43.29 ± 1.81 a | 19.56 ± 1.23 abc | 20.62 ± 1.09 d | 28.98 ± 1.36 bcd | |
‘Weiduanmihong’ | CK | 285.44 ± 15.58 ab | 9.60 ± 1.82 b | 70.92 ± 1.08 a | 11.70 ± 1.72 abc | 35.78 ± 0.93 a | 39.35 ± 0.68 a |
L1 | 304.62 ± 9.35 abc | 11.00 ± 1.62 ab | 52.04 ± 1.32 bc | 10.95 ± 1.44 abc | 26.00 ± 0.89 bcd | 28.63 ± 0.53 bc | |
L2 | 276.70 ± 12.24 bcd | 6.55 ± 0.51 b | 53.55 ± 1.55 bc | 15.90 ± 1.78 a | 24.31 ± 0.87 cd | 29.60 ± 0.63 bc | |
L3 | 309.59 ± 9.49 ab | 8.10 ± 0.81 ab | 51.13 ± 1.09 bc | 1 5.95 ± 1.14 a | 26.63 ± 0.69 cd | 28.73 ± 0.58 bc | |
Y1 | 320.42 ± 14.52 ab | 9.71 ± 1.12 ab | 56.19 ± 1.32 cd | 11.25 ± 1.46 bcd | 29.83 ± 0.92 b | 30.70 ± 0.73 b | |
Y2 | 295.14 ± 12.92 bc | 10.20 ± 0.54 ab | 52.16 ± 1.40 bc | 12.34 ± 1.20 abc | 23.24 ± 0.98 cd | 26.67 ± 0.56 c | |
Y3 | 349.94 ± 15.76 a | 12.63 ± 1.65 a | 49.59 ± 1.67 cd | 15.59 ± 1.36 ab | 24.30 ± 1.24 cd | 27.33 ± 0.93 c | |
Z1 | 264.08 ± 11.50 bc | 9.80 ± 1.99 ab | 56.07 ± 1.72 b | 10.42 ± 1.71 abc | 26.54 ± 1.27 bc | 28.23 ± 0.68 bc | |
Z2 | 243.36 ± 12.96 d | 9.65 ± 1.82 ab | 48.40 ± 1.47 cd | 10.25 ± 1.65 bcd | 24.39 ± 0.76 cd | 26.95 ± 0.62 c | |
Z3 | 248.78 ± 10.43 d | 11.45 ± 1.81 ab | 44.65 ± 1.81 d | 15.32 ± 1.37 ab | 22.24 ± 1.09 d | 27.47 ± 1.25 c |
Treatment | ‘Baifeng’ | ‘Weiduanmihong’ | ||||||
---|---|---|---|---|---|---|---|---|
Soluble Solids (%) | Soluble Sugar Content (g/L) | Titratable Acid Content (g/L) | Sugar to Acid Ratio | Soluble Solids (%) | Soluble Sugar Content (g/L) | Titratable Acid Content (g/L) | Sugar to Acid Ratio | |
CK | 11.50 ± 0.29 bcd | 9.53 ± 0.51 de | 0.24 ± 0.00 ab | 36.95 ± 1.98 e | 12.27 ± 0.82 b | 9.93 ± 0.64 bcd | 0.24 ± 0.01 bc | 32.42 ± 2.40 ef |
L1 | 10.50 ± 0.29 d | 8.90 ± 0.69 de | 0.23 ± 0.00 b | 38.56 ± 3.32 e | 12.02 ± 0.58 c | 10.86 ± 0.33 ab | 0.28 ± 0.01 ab | 42.69 ± 2.79 cde |
L2 | 12.33 ± 0.41 bc | 8.34 ± 0.30 e | 0.21 ± 0.00 de | 39.70 ± 0.50 de | 12.67 ± 0.33 abc | 10.56 ± 0.78 abc | 0.19 ± 0.01 ef | 55.35 ± 6.07 bc |
L3 | 15.00 ± 0.28 a | 11.63 ± 0.43 abc | 0.20 ± 0.00 ef | 56.88 ± 1.18 b | 13.01 ± 0.29 ab | 10.87 ± 0.58 ab | 0.13 ± 0.00 g | 87.02 ± 7.58 a |
Y1 | 11.83 ± 0.34 bc | 9.53 ± 0.44 de | 0.25 ± 0.00 a | 38.56 ± 2.29 e | 11.00 ± 0.58 c | 7.61 ± 0.20 e | 0.30 ± 0.01 a | 25.79 ± 1.06 f |
Y2 | 11.33 ± 0.17 cd | 9.08 ± 0.29 de | 0.21 ± 0.00 de | 42.79 ± 0.85 cde | 13.77 ± 0.50 a | 10.15 ± 0.89 abc | 0.28 ± 0.01 ab | 36.11 ± 3.59 ef |
Y3 | 14.83 ± 0.44 a | 11.94 ± 0.30 a | 0.19 ± 0.00 g | 64.45 ± 1.95 a | 12.60 ± 0.31 abc | 9.91 ± 0.45 bcd | 0.25 ± 0.00 c | 39.39 ± 1.07 de |
Z1 | 12.67 ± 0.33 b | 10.34 ± 0.68 cd | 0.23 ± 0.00 bc | 45.79 ± 2.41 cd | 11.00 ± 0.58 c | 8.56 ± 0.51 cde | 0.26 ± 0.01 bc | 33.34 ± 1.67 ef |
Z2 | 11.50 ± 0.29 bcd | 10.37 ± 0.27 bcd | 0.22 ± 0.00 cd | 48.14 ± 1.79 c | 13.01 ± 0.68 ab | 11.27 ± 0.60 ab | 0.22 ± 0.00 de | 51.68 ± 1.58 bcd |
Z3 | 14.67 ± 0.54 a | 11.90 ± 0.22 ab | 0.20 ± 0.00 f | 60.60 ± 1.63 ab | 12.80 ± 0.31 ab | 10.16 ± 0.86 abc | 0.19 ± 0.01 f | 63.89 ± 2.70 b |
Treatment | ‘Baifeng’ | ‘Weiduanmihong’ | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
Anthocyanin Content (mg/g) | Cyanidin Pigment Content (μg/mL) | Pelargonidin Pigment Content (μg/mL) | Total Phenolic Content (mg/g) | Flavonoid Content (mg/g) | Anthocyanin Content (mg/g) | Cyanidin Pigment Content (μg/mL) | Pelargonidin Pigment Content (μg/mL) | Total Phenolic Content (mg/g) | Flavonoid Content (mg/g) | |
CK | 1.51 ± 0.11 g | 19.44 ± 0.11 h | 12.75 ± 0.21 f | 0.16 ± 0.00 a | 1.19 ± 0.05 d | 3.81 ± 0.03 g | 25.49 ± 0.39 e | 21.19 ± 1.52 e | 0.31 ± 0.01 e | 3.62 ± 0.98 e |
L1 | 2.71 ± 0.09 e | 22.77 ± 0.26 ef | 13.87 ± 0.31 c | 0.11 ± 0.01 cd | 1.20 ± 0.05 d | 3.54 ± 0.16 g | 23.15 ± 0.62 f | 20.39 ± 0.56 e | 0.29 ± 0.02 e | 2.91 ± 0.58 f |
L2 | 2.80 ± 0.05 e | 24.69 ± 1.19 d | 13.35 ± 0.16 cde | 0.12 ± 0.01 bc | 1.19 ± 0.05 d | 4.57 ± 0.08 de | 26.84 ± 0.26 d | 22.45 ± 0.58 d | 0.37 ± 0.01 abc | 4.28 ± 0.87 cd |
L3 | 5.11 ± 0.29 b | 24.16 ± 0.83 de | 13.44 ± 0.10 cd | 0.01 ± 0.00 d | 0.91 ± 0.11 e | 5.98 ± 0.15 c | 30.33 ± 0.98 c | 24.70 ± 0.82 c | 0.39 ± 0.01 ab | 4.71 ± 0.45 bc |
Y1 | 2.17 ± 0.17 f | 20.61 ± 0.58 gh | 13.04 ± 0.13 def | 0.13 ± 0.00 bc | 1.34 ± 0.05 cd | 2.77 ± 0.10 h | 21.09 ± 0.29 g | 16.48 ± 0.21 f | 0.41 ± 0.01 a | 5.49 ± 0.86 a |
Y2 | 3.82 ± 0.05 d | 27.25 ± 0.39 c | 13.67 ± 0.20 c | 0.12 ± 0.00 bcd | 1.13 ± 0.06 de | 4.16 f ± 0.16 g | 35.98 ± 0.33 a | 30.96 ± 0.52 b | 0.35 ± 0.01 cd | 4.03 ± 0.18 de |
Y3 | 7.35 ± 0.09 a | 39.97 ± 0.23 a | 15.23 ± 0.13 a | 0.16 ± 0.01 a | 1.71 ± 0.02 b | 8.58 ± 0.23 a | 35.93 ± 0.28 a | 33.47 ± 0.26 a | 0.40 ± 0.02 a | 5.12 ± 0.22 ab |
Z1 | 1.73 ± 0.15 fg | 19.74 ± 0.51 h | 12.76 ± 0.13 f | 0.11 ± 0.00 cd | 1.51 ± 0.04 bc | 2.27 ± 0.02 i | 19.02 ± 0.52 h | 15.75 ± 0.32 f | 0.32 ± 0.01 de | 4.35 ± 0.11 cd |
Z2 | 3.11 ± 0.06 e | 21.64 ± 0.74 fg | 12.83 ± 0.15 ef | 0.12 ± 0.00 bcd | 1.57 ± 0.15 bc | 4.92 ± 0.10 d | 27.06 ± 0.74 d | 22.73 ± 0.74 d | 0.35 ± 0.01 bcd | 4.39 ± 0.64 cd |
Z3 | 4.64 ± 0.05 c | 31.44 ± 0.60 b | 14.50 ± 0.10 b | 0.14 ± 0.01 b | 2.73 ± 0.10 a | 6.52 ± 0.02 b | 32.30 ± 0.50 c | 25.47 ± 0.13 c | 0.37 ± 0.01 abc | 4.51 ± 0.82 c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kou, Y.; Ren, J.; Ma, Y.; Guo, R.; Shang, J.; Qiu, D.; Ma, C. Effects of Exogenous Substances Treatment on Fruit Quality and Pericarp Anthocyanin Metabolism of Peach. Agronomy 2023, 13, 1489. https://doi.org/10.3390/agronomy13061489
Kou Y, Ren J, Ma Y, Guo R, Shang J, Qiu D, Ma C. Effects of Exogenous Substances Treatment on Fruit Quality and Pericarp Anthocyanin Metabolism of Peach. Agronomy. 2023; 13(6):1489. https://doi.org/10.3390/agronomy13061489
Chicago/Turabian StyleKou, Yidan, Jinpeng Ren, Yujie Ma, Rongrong Guo, Juane Shang, Dongliang Qiu, and Cuilan Ma. 2023. "Effects of Exogenous Substances Treatment on Fruit Quality and Pericarp Anthocyanin Metabolism of Peach" Agronomy 13, no. 6: 1489. https://doi.org/10.3390/agronomy13061489