Next Article in Journal
Ghanaian Cocoa (Theobroma cacao L.) Bean Shells Coproducts: Effect of Particle Size on Chemical Composition, Bioactive Compound Content and Antioxidant Activity
Previous Article in Journal
Genotypic and Phenotypic Characterization of Two Triticum aestivum L.—Dasypyrum villosum Translocations Lines in the Same Wheat Genetic Background
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 11
Issue 2
10.3390/agronomy11020400
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Exogenous Serotonin Improves Salt Tolerance in Rapeseed (Brassica napus L.) Seedlings

by
Yue Liu
1,
Xiaoyu Ding
1,
Yan Lv
1,
Yong Cheng
1,
Chunsheng Li
2,
Lei Yan
1,
Shanshan Tian
1 and
Xiling Zou
1,*
1
Key Lab of Biology and Genetic Improvement of Oil Crops of Ministry of Agriculture and Rural Affairs, Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences, Wuhan 430062, China
2
Hubei Institute of New Socialist Countryside Development, Hubei Engineering University, Xiaogan 432000, China
*
Author to whom correspondence should be addressed.
Agronomy 2021, 11(2), 400; https://doi.org/10.3390/agronomy11020400
Submission received: 22 January 2021 / Revised: 21 February 2021 / Accepted: 22 February 2021 / Published: 23 February 2021
Browse Figures
Review Reports Versions Notes

Abstract

:
Serotonin is a well-known agent that plays various roles in animals, and is little known in plants. In this study, the effect of exogenous serotonin was tested on Brassica napus L. (rapeseed) under salt stress. The results revealed that exogenous application of 200 µmol/L serotonin had the best protection under salinity. Exogenous serotonin effectively alleviated the growth inhibition of seedlings caused by salinity, and significantly promoted the accumulation of the fresh and dry weights of roots and shoots. Besides, although the H2O2 and malondialdehyde (MDA) contents were raised under salinity, they were reduced by exogenous serotonin. The chlorophyll content was decreased under salinity, and was increased by exogenous serotonin. Under salinity, serotonin effectively activated antioxidant enzyme system through improving the catalase (CAT), superoxide dismutase (SOD), and peroxidase (POD) activities, and the expression of POD7, CAT3 and Cu-SOD genes was also up-regulated. The results also revealed exogenous serotonin increased the solute content by promoting the accumulation of soluble sugar and protein. In conclusion, salinity caused a toxicity to seedlings through oxidative damage to chlorophyll and cell membrane integrity, and serotonin possessed the ability of scavenging reactive oxygen species, osmotic pressure regulation and promoting growth, thus alleviating salinity of rape seedlings.

1. Introduction

Salinity is an important abiotic stress to crop yield [1]. The stress leads to ionic, osmotic, secondary, and especially oxidative stress. Reactive oxygen species (ROS), including H2O2 and hydroxyl radical, are naturally generated by many cellular pathways [2], which interfere with normal metabolism by changing membrane lipids through peroxides. Under normal conditions, ROS are maintained at a low levels in chloroplast, mitochondria and peroxisome, and the rate of their production increases rapidly under adverse conditions [3]. Oxidative stress causes a significant increase in cell membrane peroxidation and malondialdehyde (MDA) content, which is harmful to plants. Under salinity, photosynthesis, osmoregulation, lipid metabolism and other major processes are affected [4,5], resulting plant growth inhibition and yield loss.
When plants are exposed to salt stress, ion compartmentalization occurs, which induces Na+/H+ transporter activity and scavenges ROS. In order to prevent the damage caused by reactive oxygen species, the plant antioxidant defense system plays a critical role in controling the ROS content, and peroxidase (POD), superoxide dismutase (SOD) and catalase (CAT) are important protective enzymes in enzymatic defense system. The activities of POD, SOD and CAT were increased [6,7], and the expressions of related genes were also enhanced under salinity [8,9,10]. Under salt stress, Osmolytes, such as sugars and protein, are accumulated and external osmotic pressure are decreased. In order to maintain the balance of osmotic pressure in cells, osmotic adjustment substances such as soluble sugar (SS), soluble protein (SP) and proline (pro) are accumulated in plants prevent water leakage [1,10]. The accumulation of proline can significantly increase the tolerance of plants to salt stress [4]. The ability of salt tolerance involves regulation of ion and osmotic balance, as well as the repair effect on stress injury (detoxification), and some transgenic plants tolerant to salinity have been developed, with over-expressing genes related to salt absorption and transportation, ROS scavenging enzymes or compatible solute accumulation [11].
Exogenous hormones are extensively used to improve plant stress resistance, and it is vital to explore potential growth regulators and their mechanisms. Serotonin is an ubiquitous monoamine, and mediates a series of activities of various animal cells as a neurotransmitter, hormone and mitotic factor [12,13]. It is widely found in plants, and is also reported to be involved in a series of physiological functions related to germination, flowering, growth regulation, delay of senescence, and response to stresses [14,15,16,17]. Moreover, exogenous serotonin decreased the H2O2 and MDA content [18,19], and alleviated seedling growth inhibition under salt stress in sunflower (Helianthus annuus L.) [20].
Rapeseed (Brassica napus L.) is planted worldwide [21], and is greatly affected by salinity as other crop species. It is interesting to study whether serotonin could improve salt tolerance and explore the possible mechanism in rapeseed. Then, in this study, the effect of exogenous serotonin possible on rapeseed was studied under salinity by evaluating a number of phenotypic, physiological indices, antioxidant enzyme activities and gene expressions.

2. Materials and Methods

2.1. The Materials

ZS11, a rapeseed variety was used as the experimental material, and the experiment was carried out in the greenhouse.

2.2. Experimental Methods

Healthy seeds were sowed on the gauze that was submerged in 1/4 concentration of nutrient solution (NS). After 7 days, the seedlings were evenly selected and planted in the pot with modified Hogland nutrient solution [22], and each pot contained 24 seedlings. Then, the seedlings were hydroponically cultured in the growth chamber, and the nutrient solution was renewed every other day.
One week later, uniform seedlings with two leaves were selected for the following treatments: (1) only NS (The control, C); (2) NS + 0.75% NaCl (NaCl treatment, N); (3) NS + 0.75% NaCl + 50 µmol/L serotonin (50 Ser); (4) NS + 0.75% NaCl + 100 µmol/L serotonin (100 Ser) (5) NS + 0.75% NaCl + 200 µmol/L serotonin (200 Ser); (6) NS + 0.75% NaCl + 300 µmol/L serotonin (300 Ser).

2.3. The Measurements

After 7 days of treatment, seedlings were randomly selected from each group, and the length and fresh weight of the root and shoot of each plant were measured. There were 3 biological repeats in all treatments, and each replicate included 8 seedlings.
The content of chlorophyll was determined by a SPAD meter (SPAD-502, Minota, tokyo, Japan), and the same position of three seedlings was measured in each replication.
After one day of treatment, the third leaf was collected and stored at −80 °C, and the biochemical indexes of POD, SOD, H2O2, MDA, PRO, soluble protein (SP), soluble sugar (SS) were measured as previously mentioned [23]. Serotonin was purchased from Shanghai Yuanye Biotechnology Co., Ltd. All the biochemical indicators of leaves were determined using commercial kits (Jiancheng, Nanjing, China).

2.4. The RT-qPCR

The third leaf of the seedlings was taken at 1, 2, 4, 8, 12 and 24 h after treatment, and the control samples were collected at the same time. HiPure Total RNA Mini Kit (Magen Biotech Co., Ltd., Beijing, China) was used for RNA extraction, and a cDNA synthesis Kit (Thermo Fisher Scientific, Rockford, IL, USA) was used for reverse transcription. The expression of actin was used as control. Primers were designed by Primer Premier 5 (Table 1). The reagents, procedures and instruments of RT qPCR were followed as described by Yan et al. [24]. The calculation was performed using 2−ΔΔCT method, and the standard error between three biological copies of each experiment was calculated.

2.5. Statistical Analysis

Data were subjected to analysis of variance (ANOVA); mean separation was performed using the least significance difference (Duncan, p < 0.05) procedure from the SPSS statistical package ((International Business Machines Corporation, Armonk, NY, USA). Graphs were plotted using Origin 8.0 (OriginLab Corporation, Northampton, MA, USA).

3. Results

3.1. Effects of Exogenous Serotonin on Phenotypical of B. napus under Salinity

After 7 days of NaCl treatment, the seedlings showed typical symptoms of salt poisoning, such as yellow, rolled and smaller leaves in plants (Figure 1). These symptoms were alleviated by adding 50, 100, 200 or 300 µmol/L serotonin. When the concentration of serotonin was 50–200 µmol/L, the growth of rape seedlings gradually improved under salt stress. However, when 300 µmol/L serotonin was added, the growth vigor of rape seedlings was significantly weaker than that of 200 µmol/L serotonin.

3.2. Effects of Exogenous Serotonin on the Growth under Salinity

As shown in Table 2, all the characters were significantly reduced by salinity. Exogenous serotonin promoted the growth of seedlings under salinity, and 200 µmol/L of exogenous serotonin increased the fresh and dry weight of the shoot and root by 43.4%, 43.4%, 48.5%, and 19.5% compared to that without serotonin under salinity, respectively. However, the root length decreased slightly after serotonin was applied. There was no significant difference in the shoot length of seedlings among the treatments.

3.3. Effects of Exogenous Serotonin on MDA, H2O2 and Chlorophyll Contents under Salinity

The content of MDA was significantly increased by 319.7% under salinity, and it was decreased by exogenous serotonin (Figure 2A). The change trend of the H2O2 content was similar to that of the MDA content. Under salinity, the H2O2 content in leaves was increased by 26.9% compared with the control, and that of seedlings treated with 50, 100, 200 and 300 µmol/L serotonin was decreased by 11.8%, 12.7%, 14.6% and 4.5% compared with that under salt stress, respectively (Figure 2B). In addition, the chlorophyll content of leaves was decreased by 47.9% under salinity, but was increased by serotonin (Figure 2C). The chlorophyll accumulation of the seedlings with 300 µmol/L of serotonin was lower than that of the seedlings with 200 µmol/L serotonin.

3.4. Effects of Exogenous Serotonin on Osmoregulatory Substances under Salinity

Compared to that of the control, the SS content in leaves under salinity was significantly increased (Figure 3A), and exogenous serotonin had a significant positive effect under salinity. The highest SP content was found in the seedlings exposed to salinity with 200 µmol/L of exogenous serotonin. However, compared with 200 µmol/L serotonin, the use of 300 µmol/L serotonin reduced SP content by 8.0% (Figure 3B). Under salinity, the proline content was increased by 1308.0% under salinity (Figure 3C). There were no differences between the proline content of the NaCl and that with 50 or 100 µmol/L serotonin. Compared with that under salt stress, the proline content was increased by 13.9% with 200 µmol/L serotonin, and was decreased by 28.1% when exogenous serotonin was added at 300 µmol/L.

3.5. Effects of Exogenous Serotonin on Antioxidant Enzymes under Salinity

The POD activity was significantly increased under salinity (Figure 4A), and was further enhanced by exogenous application of serotonin. The POD activity was the highest with 200 µmol/L of serotonin, and was decreased by 300 µmol/L of serotonin. The CAT activity of seedlings was increased under salinity, and 50, 100, 200 and 300 µmol/L of exogenous serotonin further increased the CAT activity by 10.0%, 11.3%, 24.9% and 3.4% compared with that under salt stress, respectively (Figure 4B). A similar trend was also found in the SOD activity under the treatments (Figure 4C). The SOD activity was increased by 3.4% under the stress, while it was further increased by 1.9%, 5.2%, 10.6% and 3.1% compared with that under salt stress with the application of 50, 100, 200, and 300 µmol/L of exogenous serotonin, respectively.
The expression patterns of the POD7, CAT3, and Cu-SOD genes were detected at 1 h, 2 h, 4 h, 8 h, 12 h and 24 h of the treatment. The expressions of POD7, CAT3, and Cu-SOD were down-regulated at 1h of salinity, and were up-regulated a few hours later. The expression of POD7 was up-regulated at 2 h, 4 h, 8 h, 12 h and 24 h of salinity, and 200 µmol/L of exogenous serotonin up-regulated the expression level of POD7 at each time point compared to that of the control or salinity (Figure 5A). Expression of CAT3 was up-regulated at 12 h and 24 h under salinity, and the expression of CAT3 was further up-regulated by exogenous serotonin at 12 h and 24 h (Figure 5B). The expression of Cu-SOD was up-regulated by 8 h and 12 h of salinity and application of exogenous serotonin (Figure 5C).

4. Discussion

Salinity severely inhibits plant growth, and it is important to improve stress tolerance of crops [25,26]. Therefore, the effects of exogenous serotonin on rapeseed seedlings under salinity were studied in this study. The phenotypical data showed that salinity significantly inhibited plant growth (Figure 1 and Table 2), and resulted in an obvious decrease in the fresh and dry weight of plants. Application of exogenous serotonin noticeably alleviated the negative effect of salinity and promoted the seedling growth. Our results showed exogenous serotonin significantly increased the root weight, but not the root length. Therefore, serotonin may be involved in the formation of lateral roots as that in Arabidopsis [27]. With the increase of concentration, the alleviating effect of serotonin on salt stress gradually increased, but when the concentration reached 300 μmol/L, the alleviating effect began to weaken obviously, which indicated that high concentration of serotonin not only could not alleviate salt stress, but also could produce ion toxicity to plants [10].
Salinity affected the photosynthetic capacity of photosynthetic organs and decreased photosynthetic characters in plants [28]. Under stress, the chlorophyll decrease has always been an adverse effect on crop growth [28,29]. In our study, exogenous serotonin significantly increased the chlorophyll concentration, which may be one of the reasons for promoting seedling growth. Salt stress may affect photosynthesis through osmotic stress, ion toxicity and accumulation of photosynthetic products. Meanwhile, it also affects the process of light absorption, electron transfer and carbon assimilation. Studies have shown that salt stress caused severe damage to chloroplast layer structure and rupture of plasma membrane, which affected plant growth and development under photosynthesis [2,28]. Abiotic stress leads to excessive ROS production in plant cells, and salinity can produce a large number of ROS [30]. H2O2 is one of ROS, and the high concentration of H2O2 can cause lipid peroxidation and membrane permeability changes [31,32]. In this study, H2O2 was increased under salinity, and the addition of exogenous serotonin inhibited the increase of H2O2 (Figure 2B). MDA is an end-product of lipid peroxidation, indicating the degree of membrane lipid peroxidation [33]. MDA affects the function and activity of nucleic acid, protein and enzyme, and even makes them lose their function [4,5]. Our results revealed that salinity significantly increased the MDA content, while exogenous serotonin significantly decreased the MDA content compared with that under salt stress (Figure 2A). Salinity damaged cell membrane and increased the MDA content, and serotonin improves salt tolerance by reducing the MDA content under salinity. It was also indicated that the membrane lipid peroxidation of plants was enhanced under salt stress, resulting in the increase of the MDA content. The addition of serotonin alleviated the membrane lipid peroxidation under salt stress [34].
In order to reduce oxidative damage and maintain cell metabolic function, it is necessary to keep a balance between ROS production and degradation under stress, and the antioxidant system can control ROS levels in plants [35]. When seedlings are exposed to salinity, ROS accumulated in plants could be removed through the synergistic action of protective enzymes (SOD, POD and CAT) [36]. In this study, these enzyme activities were enhanced under salinity (Figure 4). Exogenous application of serotonin further increased the activity of POD, SOD and CAT, resulting the decrease of the ROS content. Previous reports have reported serotonin had an anti-age effect by effectively eliminating ROS [16]. Meanwhile, the qPCR results revealed that exogenous serotonin significantly up-regulated the expression of POD7, CAT3, and Cu-SOD (Figure 5), indicating serotonin stimulated the activities of the main antioxidant enzymes by up-regulating the expression of corresponding genes, thus protecting cells under adverse conditions. This study indicated that there are two ways for serotonin in protecting the plants from injuries induced by oxidative stress under salinity. On the one hand, serotonin might act as a free radical scavenger indepdent of the antioxidant system [18,19]. On the other hand, it can enhance the gene expression and the activity of antioxidant enzymes [20].
Another major factor of salt tolerance is the ability of osmolyte accumulation to regulate cell osmotic pressure. The main osmolytes include free proline, soluble sugar and protein, and their content is also indicators of stress tolerance. Proline is reported to be accumulated as a compatible osmolyte mediating osmotic adjustment under salinity [37,38,39]. Besides, proline also play a role in detoxifying by scavenging ROS in injured cells [40]. In our study, the content of proline was increased under salinity, and was further enhanced by serotonin (Figure 3C). In addition, other studies also have shown that SS and SP played important roles in both osmoregulatory and active oxygen scavenging system [21,41,42]. In this study, exogenous application of serotonin also increased the content of SS and SP under salinity (Figure 3A,B).

5. Conclusions

Oxidative damage by salinity resulted in chlorophyll damage and decreased cell membrane integrity, which inhibited the growth of rapeseed seedlings. Exogenous serotonin has the function of antioxidation, regulating osmotic activity and promoting growth, which could effectively improve salt tolerance of plants.

Author Contributions

X.Z. conceived of the study and participated in its design. Y.L. (Yue Liu) carried out most of the work and drafted the manuscript. C.L. was involved in designing and planning the work, and in interpreting the results. Y.C. and X.D. prepared the seeds and helped with the data analysis. L.Y. and S.T. participated the assessment of physiological indicators. Y.L. (Yan Lv) helped to revise the English in this article. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key R&D Program of China (2018YFD0100905); Hubei Special Project of Central Dovernment Guiding Local Science and Technology Development (2019ZYYD038); The Agricultural Science and Technology Innovation Program (ASTIP); The Hubei Agricultural Science and Technology Innovation Center (2016-620-000-001-048).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chang, B.; Yang, L.; Cong, W.; Zu, Y.; Tang, Z. The improved resistance to high salinity induced by trehalose is associated with ionic regulation and osmotic adjustment in Catharanthus roseus. Plant Physiol. Biochem. 2014, 77, 140–148. [Google Scholar] [CrossRef] [PubMed]
  2. Arif, Y.; Singh, P.; Siddiqui, H.; Bajguz, A.; Hayat, S. Salinity induced physiological and biochemical changes in plants: An omic approach towards salt stress tolerance. Plant Physiol. Biochem. 2020, 156, 64–77. [Google Scholar] [CrossRef] [PubMed]
  3. Yin, Z.P.; Li, S.; Ren, J.; Song, X.S. Role of spermidine and spermine in alleviation of drought-induced oxidative stress and photosynthetic inhibition in Chinese dwarf cherry (Cerasus humilis) seedlings. Plant Growth Regul. 2014, 74, 209–218. [Google Scholar] [CrossRef]
  4. Koca, H.; Bor, M.; Ozdemir, F.; Turkan, I. The effect of salt stress on lipid peroxidation, antioxidative enzymes and proline content of sesame cultivars. Environ. Exp. Bot. 2007, 60, 344–351. [Google Scholar] [CrossRef]
  5. Yang, Y.; Guo, Y. Unraveling salt stress signaling in plants. J. Integr. Plant Biol. 2018, 60, 796–804. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Gao, S.; Yan, R.; Chen, F. Effects of different storage temperatures and times on germination and antioxidant responses of Jatropha curcas L. seeds. J. Agric. Sci. Technol. 2015, 17, 1619–1628. [Google Scholar]
  7. Seleiman, M.; Semida, W.; Rady, M.; Mohamed, G.; Sahmi, A. Sequential application of antioxidants rectifies ion imbalance and strengthens antioxidant systems in salt-stressed cucumber. Plants 2020, 9, 1783. [Google Scholar] [CrossRef]
  8. Hernandez, J.A.; Jimenez, A.; Mullineaux, P.; Sevilla, F. Tolerance of pea (Pisum sativum L.) to long-term salt stress is associated with induction of antioxidant defences. Plant Cell Environ. 2000, 23, 853–862. [Google Scholar] [CrossRef]
  9. Hu, T.; Li, H.Y.; Zhang, X.Z.; Luo, H.J.; Fu, J.M. Toxic effect of NaCl on ion metabolism, antioxidative enzymes and gene expression of perennial ryegrass. Ecotoxicol. Environ. Saf. 2011, 74, 2050–2056. [Google Scholar] [CrossRef] [PubMed]
  10. Zeng, L.; Cai, J.; Li, J.; Lu, G.; Li, C.; Fu, G.; Zhang, X.; Ma, H.; Liu, Q.; Zou, X.; et al. Exogenous application of a low concentration of melatonin enhances salt tolerance in rapeseed (Brassica napus L.) seedlings. J. Integr. Agric. 2018, 17, 328–335. [Google Scholar] [CrossRef] [Green Version]
  11. Badawi, G.H.; Yamauchi, Y.; Shimada, E.; Sasaki, R.; Kawano, N.; Tanaka, K. Enhanced tolerance to salt stress and water deficit by overexpressing superoxide dismutase in tobacco (Nicotiana tabacum) chloroplasts. Plant Sci. 2004, 166, 919–928. [Google Scholar] [CrossRef]
  12. Turlejski, K. Evolutionary ancient roles of serotonin: Long-lasting regulation of activity and development. Acta Neurobiol. Exp. 1996, 56, 619. [Google Scholar]
  13. Pelagio-Flores, R.; Muñoz-Parra, E.; Ortiz-Castro, R.; López-Bucio, J. Melatonin regulates Arabidopsis root system architecture likely acting independently of auxin signaling. J Pineal Res. 2012, 53, 279–288. [Google Scholar] [CrossRef] [PubMed]
  14. Csaba, G.; Pál, K. Effects of insulin, triiodothyronine, and serotonin on plant seed development. Protoplasma 1982, 110, 20–22. [Google Scholar] [CrossRef]
  15. Murch, S.J.; Campbell, S.S.B.; Saxena, P.K. The role of serotonin and melatonin in plant morphogenesis: Regulation of auxin-induced root organogenesis in in vitro-cultured explants of st. John’s Wort (Hypericum perforatum L.). In Vitro Cell. Dev. Biol. Plant. 2001, 37, 786–793. [Google Scholar] [CrossRef]
  16. Kang, K.; Kim, Y.; Park, S.; Back, K. Senescence-Induced Serotonin Biosynthesis and Its Role in Delaying Senescence in Rice Leaves. Plant Physiol. 2009, 150, 1380–1393. [Google Scholar] [CrossRef] [Green Version]
  17. Pelagio-Flores, R.; Ruiz-Herrera, L.F.; López-Bucio, J. Serotonin modulates Arabidopsis root growth via changes in reactive oxygen species and jasmonic acid-ethylene signaling. Physiol. Plant 2016, 158, 92–105. [Google Scholar] [CrossRef]
  18. Arnao, M.B.; Hernández-Ruiz, J. Melatonin: Plant growth regulator and/or biostimulator during stress? Trends Plant Sci. 2014, 19, 789–797. [Google Scholar] [CrossRef] [PubMed]
  19. Nawaz, M.A.; Huang, Y.; Bie, Z.; Ahmed, W.; Reiter, R.J.; Niu, M.; Hameed, S. Melatonin: Current status and future perspectives in plant science. Front. Plant Sci. 2016, 6, 1230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. Mukherjee, S.; David, A.; Yadav, S.; Baluška, F.; Bhatla, S.C. Salt stress-induced seedling growth inhibition coincides with differential distribution of serotonin and melatonin in sunflower seedling roots and cotyledons. Physiol. Plant 2014, 152, 714–728. [Google Scholar] [CrossRef] [PubMed]
  21. Yong, H.Y.; Wang, C.; Bancroft, I.; Li, F.; Wu, X.; Kitashiba, H.; Nishio, T. Identification of a gene controlling variation in the salt tolerance of rapeseed (Brassica napus L.). Planta 2015, 242, 313–326. [Google Scholar] [CrossRef] [PubMed]
  22. Cui, L.; Feng, X.; Lin, C.J.; Wang, X.; Meng, B.; Wang, X.; Wang, H. Accumulation and translocation of 198Hg in four crop species. Environ. Toxicol. Chem. 2014, 33, 334–340. [Google Scholar] [CrossRef]
  23. Li, J.; Zeng, L.; Cheng, Y.; Lu, G.; Fu, G.; Ma, H.; Liu, Q.; Zhang, X.; Zou, X.; Li, C. Exogenous melatonin alleviates damage from drought stress in Brassica napus L. (rapeseed) seedlings. Acta Physiol. Plant. 2018, 40, 43. [Google Scholar] [CrossRef]
  24. Yan, L.; Shah, T.; Cheng, Y.; Lü, Y.; Zou, X. Physiological and molecular responses to cold stress in rapeseed (Brassica napus L.). J. Integr. Agric. 2019, 18, 2742–2752. [Google Scholar] [CrossRef]
  25. Golldack, D.; Lüking, I.; Yang, O. Plant tolerance to drought and salinity: Stress regulating transcription factors and their functional significance in the cellular transcriptional network. Plant Cell Rep. 2011, 30, 1383–1391. [Google Scholar] [CrossRef] [PubMed]
  26. Feng, Y.; Chen, X.; He, Y.; Kou, X.; Xue, Z. Effects of Exogenous Trehalose on the Metabolism of Sugar and Abscisic Acid in Tomato Seedlings under Salt Stress. Trans. Tianjin Univ. 2019, 25, 451–471. [Google Scholar] [CrossRef] [Green Version]
  27. Pelagio-Flores, R.; Ortíz-Castro, R.; Méndez-Bravo, A.; Macías-Rodríguez, L.; López-Bucio, J. Serotonin, a tryptophan-derived signal conserved in plants and animals, regulates root system architecture probably acting as a natural auxin inhibitor in Arabidopsis thaliana. Plant Cell Physiol. 2011, 52, 490–508. [Google Scholar] [CrossRef] [Green Version]
  28. Naeem, M.S.; Warusawitharana, H.; Liu, H.; Liu, D.; Ahmad, R.; Waraich, E.A.; Xu, L.; Zhou, W. 5-Aminolevulinic acid alleviates the salinity-induced changes in Brassica napus as revealed by the ultrastructural study of chloroplast. Plant Physiol. Biochem. 2012, 57, 84–92. [Google Scholar] [CrossRef]
  29. Muller, O.; Cohu, C.M.; Stewart, J.J.; Protheroe, J.A.; Demmig-Adams, B.; Adams, W.W. Association between photosynthesis and contrasting features of minor veins in leaves of summer annuals loading phloem via symplastic versus apoplastic routes. Physiol. Plant 2014, 152, 174–183. [Google Scholar] [CrossRef]
  30. Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
  31. Sairam, R.K.; Srivastava, G.C. Changes in antioxidant activity in sub-cellular fractions of tolerant and susceptible wheat genotypes in response to long term salt stress. Plant Sci. 2002, 162, 897–904. [Google Scholar] [CrossRef]
  32. Upchurch, R.G. Fatty acid unsaturation, mobilization, and regulation in the response of plants to stress. Biotechnol. Lett. 2008, 30, 967–977. [Google Scholar] [CrossRef]
  33. Moller, I.M.; Jensen, P.E.; Hansson, A. Oxidative modifications to cellular components in plants. Annu. Rev. Plant Biol. 2007, 58, 459–481. [Google Scholar] [CrossRef] [Green Version]
  34. Zhang, T.; Shi, Z.; Zhang, X.; Zheng, S.; Wang, J.; Mo, J. Alleviating effects of exogenous melatonin on salt stress in cucumber. Sci. Hortic. 2020, 262, 109070. [Google Scholar] [CrossRef]
  35. Schutzendubel, A.; Polle, A. Plant responses to abiotic stresses: Heavy metal-induced oxidative stress and protection by mycorrhization. J. Exp. Bot. 2002, 53, 1351–1365. [Google Scholar] [CrossRef] [PubMed]
  36. Zhang, H.; Zhang, N.; Yang, R.; Wang, L.; Sun, Q.; Li, D.; Cao, Y.; Weeda, S.; Zhao, B.; Ren, S.; et al. Melatonin promotes seed germination under high salinity by regulating antioxidant systems, ABA and GA(4) interaction in cucumber (Cucumis sativus L.). J. Pineal Res. 2014, 57, 269–279. [Google Scholar] [CrossRef] [PubMed]
  37. Hare, P.D.; Cress, W.A.; Staden, J.V. Dissecting the roles of osmolyte accumulation during stress. Plant Cell Environ. 1998, 21, 535–553. [Google Scholar] [CrossRef]
  38. Zhu, J.K. Plant salt tolerance. Trends Plant Sci. 2001, 6, 66–71. [Google Scholar] [CrossRef]
  39. Farhangi-Abriz, S.; Torabian, S. Antioxidant enzyme and osmotic adjustment changes in bean seedlings as affected by biochar under salt stress. Ecotoxicol. Environ. Saf. 2017, 137, 64–70. [Google Scholar] [CrossRef] [PubMed]
  40. Ashraf, M.; Harris, P.J.C. Potential biochemical in dicators of salinity tolerance in plants. Plant Sci. 2004, 166, 3–16. [Google Scholar] [CrossRef]
  41. Fahimirad, S.; Karimzadeh, G.; Ghanati, F. Cold-induced changes of antioxidant enzymes activity and lipid peroxidation in two canola (Brassica napus L.) cultivars. J. Plant Physiol. Breed. 2013, 3, 1–11. [Google Scholar]
  42. Signorelli, S. The Fermentation Analogy: A Point of View for Understanding the Intriguing Role of Proline Accumulation in Stressed. Front. Plant Sci. 2016, 7, 1339. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Agronomy 11 00400 g001 550
Figure 1. Exogenous serotonin alleviated salinity of rapeseed seedlings. C, NaCl, NaCl + 50 Ser, NaCl + 100 Ser, NaCl + 200 Ser and NaCl + 300 Ser represent the seedling were treated by 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (NaCl), 0.75% NaCl and 50 µmol/L serotonin (NaCl + 50 Ser), 0.75% NaCl and 100 µmol/L serotonin (NaCl + 100 Ser), 0.75% NaCl and 200 µmol/L serotonin (NaCl + 200 Ser), 0.75% NaCl and 300 µmol/L serotonin (NaCl + 300 Ser) respectively. The three-week-old seedlings are shown above: two-week-old seedlings after one week of treatment.
Figure 1. Exogenous serotonin alleviated salinity of rapeseed seedlings. C, NaCl, NaCl + 50 Ser, NaCl + 100 Ser, NaCl + 200 Ser and NaCl + 300 Ser represent the seedling were treated by 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (NaCl), 0.75% NaCl and 50 µmol/L serotonin (NaCl + 50 Ser), 0.75% NaCl and 100 µmol/L serotonin (NaCl + 100 Ser), 0.75% NaCl and 200 µmol/L serotonin (NaCl + 200 Ser), 0.75% NaCl and 300 µmol/L serotonin (NaCl + 300 Ser) respectively. The three-week-old seedlings are shown above: two-week-old seedlings after one week of treatment.
Agronomy 11 00400 g001
Agronomy 11 00400 g002 550
Figure 2. Effects of different concentrations of serotonin on the MDA, H2O2, Chlorophyll contents under salt stress. (A), the malonyldialdehyde (MDA) content; (B), the hydrogen peroxide (H2O2) content; (C), the Chlorophyll content. C, N, 50 Ser, 100 Ser, 200 Ser and 300 Ser represent the seedling were treated by 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (N), 0.75% NaCl and 50 µmol/L serotonin (50 Ser), 0.75% NaCl and 100 µmol/L serotonin (100 Ser), 0.75% NaCl and 200 µmol/L serotonin (200 Ser), 0.75% NaCl and 300 µmol/L serotonin (300 Ser) respectively. Error bars represent SD (n = 3). Different letters, a, b, c, d, and e, indicate significant differences (p < 0.05).
Figure 2. Effects of different concentrations of serotonin on the MDA, H2O2, Chlorophyll contents under salt stress. (A), the malonyldialdehyde (MDA) content; (B), the hydrogen peroxide (H2O2) content; (C), the Chlorophyll content. C, N, 50 Ser, 100 Ser, 200 Ser and 300 Ser represent the seedling were treated by 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (N), 0.75% NaCl and 50 µmol/L serotonin (50 Ser), 0.75% NaCl and 100 µmol/L serotonin (100 Ser), 0.75% NaCl and 200 µmol/L serotonin (200 Ser), 0.75% NaCl and 300 µmol/L serotonin (300 Ser) respectively. Error bars represent SD (n = 3). Different letters, a, b, c, d, and e, indicate significant differences (p < 0.05).
Agronomy 11 00400 g002
Agronomy 11 00400 g003 550
Figure 3. Effects of different concentrations of serotonin on the osmolyte content under salt stress. (A), total soluble sugar (SS) content. (B), total soluble protein (SP) content. (C), proline (Pro) content. C, N, 50 Ser, 100 Ser, 200 Ser and 300 Ser represent the seedling were treated by 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (N), 0.75% NaCl and 50 µmol/L serotonin (50 Ser), 0.75% NaCl and 100 µmol/L serotonin (100 Ser), 0.75% NaCl and 200 µmol/L serotonin (200 Ser), 0.75% NaCl and 300 µmol/L serotonin (300 Ser) respectively. Error bars represent SD (n = 3). Different letters, a, b, c, and d, indicate significant differences (p < 0.05).
Figure 3. Effects of different concentrations of serotonin on the osmolyte content under salt stress. (A), total soluble sugar (SS) content. (B), total soluble protein (SP) content. (C), proline (Pro) content. C, N, 50 Ser, 100 Ser, 200 Ser and 300 Ser represent the seedling were treated by 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (N), 0.75% NaCl and 50 µmol/L serotonin (50 Ser), 0.75% NaCl and 100 µmol/L serotonin (100 Ser), 0.75% NaCl and 200 µmol/L serotonin (200 Ser), 0.75% NaCl and 300 µmol/L serotonin (300 Ser) respectively. Error bars represent SD (n = 3). Different letters, a, b, c, and d, indicate significant differences (p < 0.05).
Agronomy 11 00400 g003
Agronomy 11 00400 g004 550
Figure 4. Effects of different concentrations of serotonin on the antioxidant enzymatic activities under salt stress. (A), the peroxidase (POD) activities. (B), the catalase (CAT) activities. (C), the superoxide dismutase (SOD) activities. C, N, 50 Ser, 100 Ser, 200 Ser and 300 Ser represent the seedling were treated by 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (N), 0.75% NaCl and 50 µmol/L serotonin (50 Ser), 0.75% NaCl and 100 µmol/L serotonin (100 Ser), 0.75% NaCl and 200 µmol/L serotonin (200 Ser), 0.75% NaCl and 300 µmol/L serotonin (300 Ser) respectively. Error bars represent SD (n = 3). Different letters, a, b, c, and d, indicate significant differences (p < 0.05).
Figure 4. Effects of different concentrations of serotonin on the antioxidant enzymatic activities under salt stress. (A), the peroxidase (POD) activities. (B), the catalase (CAT) activities. (C), the superoxide dismutase (SOD) activities. C, N, 50 Ser, 100 Ser, 200 Ser and 300 Ser represent the seedling were treated by 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (N), 0.75% NaCl and 50 µmol/L serotonin (50 Ser), 0.75% NaCl and 100 µmol/L serotonin (100 Ser), 0.75% NaCl and 200 µmol/L serotonin (200 Ser), 0.75% NaCl and 300 µmol/L serotonin (300 Ser) respectively. Error bars represent SD (n = 3). Different letters, a, b, c, and d, indicate significant differences (p < 0.05).
Agronomy 11 00400 g004
Agronomy 11 00400 g005 550
Figure 5. Effects of 200 µmol/L serotonin on the relative expression analysis of antioxidant enzyme genes under salt stress. (A–C), the transcriptional levels of genes POD7 (XM_013819255.1), CAT3 (XM_013786778.1), Cu-SOD (XM_013808924.1) were analyzed by real-time quantitative PCR (RT-qPCR). 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (NaCl), 0.75% NaCl and 200 µmol/L serotonin (200 Ser). Error bars represent SD (n = 3). Different letters, a, b and c, indicate significant differences (p < 0.05).
Figure 5. Effects of 200 µmol/L serotonin on the relative expression analysis of antioxidant enzyme genes under salt stress. (A–C), the transcriptional levels of genes POD7 (XM_013819255.1), CAT3 (XM_013786778.1), Cu-SOD (XM_013808924.1) were analyzed by real-time quantitative PCR (RT-qPCR). 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (NaCl), 0.75% NaCl and 200 µmol/L serotonin (200 Ser). Error bars represent SD (n = 3). Different letters, a, b and c, indicate significant differences (p < 0.05).
Agronomy 11 00400 g005
Table
Table 1. The list of primers for qRT-PCR of Rapeseed Seedlings.
Table 1. The list of primers for qRT-PCR of Rapeseed Seedlings.
GeneAccession NumberForward PrimerReverse Primer
POD7XM_013819255.1CCGTGGCTACAGCAACAGTCCTCACCGCTACTACCAGTCAAGG
CAT3XM_013786778.1GAAGGCTTCGGTGTCCACACGGCTCCACCAACCACCTTT
Cu-SODXM_013808924.1GGTAACGGATCTGATTGGACGACGGTGGTTCCATCACAAGAA
ActinAF111812CTCCTGAAGAGCACCCTGCCCTCGTAGATTGGCACA
Table
Table 2. Effect of different concentrations of serotonin on various physiological indicators in rapeseed seedlings under salt stress.
Table 2. Effect of different concentrations of serotonin on various physiological indicators in rapeseed seedlings under salt stress.
TreatmentRoot
Length(cm)		Shoot
Length (cm)		Shoot Fresh
Weights (g)		Shoot Dry
Weight (g)		Root Fresh
Weights (g)		Root Dry
Weight (g)
C34.50 ± 0.34 a3.01 ± 0.04 a3.5608 ± 0.1746 a0.2290 ± 0.005 a0.4006 ± 0.0103 b0.0359 ± 0.0027 ab
N33.18 ± 0.33 b2.98 ± 0.05 a1.5218 ± 0.301 d0.1172 ± 0.003 d0.2915 ± 0.003 d0.0333 ± 0.0015 b
50 Ser30.87 ± 0.38 c2.24 ± 0.03 d1.8342 ± 0.1344 c0.1474 ± 0.0024 c0.3786 ± 0.0077 b0.0324 ± 0.0007 bc
100 Ser28.87 ± 0.5 d2.83 ± 0.05 ab2.1052 ± 0.0012 bc0.1639 ± 0.0046 b0.4002 ± 0.004 b0.0323 ± 0.0009 bc
200 Ser26.75 ± 0.45 e2.63 ± 0.03 bc2.1825 ± 0.0009 b0.1681 ± 0.0025 b0.4330 ± 0.011 a0.0398 ± 0.0004 a
300 Ser24.92 ± 0.26 f2.55 ± 0.16 c1.8171 ± 0.029 c0.1448 ± 0.0023 c0.3290 ± 0.0113 c0.0285 ± 0.0005 c
Note: C, N, 50 Ser, 100 Ser, 200 Ser and 300 Ser represent the seedling were treated by 0 NaCl and 0 serotonin (C), 0.75% NaCl and 0 serotonin (N), 0.75% NaCl and 50 µmol/L serotonin (50 Ser), 0.75% NaCl and 100 µmol/L serotonin (100 Ser), 0.75% NaCl and 200 µmol/L serotonin (200 Ser),0.75% NaCl and 300 µmol/L serotonin (300 Ser) respectively. Date represent mean ± SD, n = 3. Different letters, a, b, c, d, e, and f, indicate significant differences (p < 0.05).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Liu, Y.; Ding, X.; Lv, Y.; Cheng, Y.; Li, C.; Yan, L.; Tian, S.; Zou, X. Exogenous Serotonin Improves Salt Tolerance in Rapeseed (Brassica napus L.) Seedlings. Agronomy 2021, 11, 400. https://doi.org/10.3390/agronomy11020400

AMA Style

Liu Y, Ding X, Lv Y, Cheng Y, Li C, Yan L, Tian S, Zou X. Exogenous Serotonin Improves Salt Tolerance in Rapeseed (Brassica napus L.) Seedlings. Agronomy. 2021; 11(2):400. https://doi.org/10.3390/agronomy11020400

Chicago/Turabian Style

Liu, Yue, Xiaoyu Ding, Yan Lv, Yong Cheng, Chunsheng Li, Lei Yan, Shanshan Tian, and Xiling Zou. 2021. "Exogenous Serotonin Improves Salt Tolerance in Rapeseed (Brassica napus L.) Seedlings" Agronomy 11, no. 2: 400. https://doi.org/10.3390/agronomy11020400

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop