Effects of Mangiferin on LPS-Induced Inflammation and SARS-CoV-2 Viral Adsorption in Human Lung Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatments
2.2. Cell Viability
2.3. RNA Extraction and Gene Expression
2.4. GSH Content Quantification
2.5. Scratch Assay
2.6. Evaluation of Mitochondrial Damage (ΔΨm)
2.7. Inhibition of Viral Adsorption
2.8. Molecular Modeling
2.9. Statistical Analysis
3. Results
3.1. MGF Effect on Cell Viability
3.2. MGF Exhibits Anti-Inflammatory Effects Following LPS Stimulation
3.3. Activity of MGF on Host Cell Entry System Used by SARS-CoV-2
3.4. MGF Maintains Redox Balance by Increasing GSH Levels
3.5. MGF Increases Wound Healing following LPS Stimulation
3.6. MGF Restores LPS Mitochondrial Dysfunction
3.7. MGF Activity on SARS-CoV-2 Adsorption
3.8. Molecular Modeling Studies of MGF on SARS-CoV-2
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
Abbreviations
ACE2 | Angiotensin-converting enzyme 2 |
ALI | Acute lung injury |
ARDS | Acute respiratory distress syndrome |
COX-2 | Prostaglandin-endoperoxide synthase |
COXs | Cyclooxygenases |
CTRL | Control |
DMSO | Dimethyl sulfoxide |
DTNB | 2,2-dithio-bis-nitrobenzoic acid |
GSH | Reduced glutathione |
HO-1 | Heme oxygenase 1 |
IL-10 | Interleukin 10 |
IL-6 | Interleukin 6 |
ILs | Interleukins |
LPS | Lipopolysaccharide |
MCP-1 | Monocyte chemoattractant protein-1 |
MGF | Mangiferin |
MMPs | Metalloproteinases |
MTT | Bromide 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium |
RBD | Receptor binding domain |
ROS | Reactive oxygen species |
SARS-CoV-2 | Severe acute respiratory syndrome coronavirus 2 |
TMPRSS2 | Trans-membrane protease serine 2 |
TNF-α | Tumor necrosis factor-alpha |
References
- Kim, M.H.; Lee, S.M.; An, K.W.; Lee, M.J.; Park, D.H. Usage of Natural Volatile Organic Compounds as Biological Modulators of Disease. Int. J. Mol. Sci. 2021, 22, 9421. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, T.; Reker, D.; Schneider, P.; Schneider, G. Counting on natural products for drug design. Nat. Chem. 2016, 8, 531–541. [Google Scholar] [CrossRef] [PubMed]
- Miceli, M.; Bontempo, P.; Nebbioso, A.; Altucci, L. Natural compounds in epigenetics: A current view. Food Chem. Toxicol. 2014, 73, 71–83. [Google Scholar] [CrossRef] [PubMed]
- Barbagallo, I.; Vanella, L.; Cambria, M.T.; Tibullo, D.; Godos, J.; Guarnaccia, L.; Zappala, A.; Galvano, F.; Li Volti, G. Silibinin Regulates Lipid Metabolism and Differentiation in Functional Human Adipocytes. Front. Pharmacol. 2015, 6, 309. [Google Scholar] [CrossRef] [Green Version]
- Palmeri, R.; Monteleone, J.I.; Spagna, G.; Restuccia, C.; Raffaele, M.; Vanella, L.; Li Volti, G.; Barbagallo, I. Olive Leaf Extract from Sicilian Cultivar Reduced Lipid Accumulation by Inducing Thermogenic Pathway during Adipogenesis. Front. Pharmacol. 2016, 7, 143. [Google Scholar] [CrossRef] [Green Version]
- Patil, K.R.; Mahajan, U.B.; Unger, B.S.; Goyal, S.N.; Belemkar, S.; Surana, S.J.; Ojha, S.; Patil, C.R. Animal Models of Inflammation for Screening of Anti-inflammatory Drugs: Implications for the Discovery and Development of Phytopharmaceuticals. Int. J. Mol. Sci. 2019, 20, 4367. [Google Scholar] [CrossRef] [Green Version]
- Li Volti, G.; Musumeci, T.; Pignatello, R.; Murabito, P.; Barbagallo, I.; Carbone, C.; Gullo, A.; Puglisi, G. Antioxidant potential of different melatonin-loaded nanomedicines in an experimental model of sepsis. Exp. Biol. Med. 2012, 237, 670–677. [Google Scholar] [CrossRef]
- Vanella, L.; Barbagallo, I.; Acquaviva, R.; Di Giacomo, C.; Cardile, V.; Abraham, N.G.; Sorrenti, V. Ellagic acid: Cytodifferentiating and antiproliferative effects in human prostatic cancer cell lines. Curr. Pharm. Des. 2013, 19, 2728–2736. [Google Scholar] [CrossRef]
- Matthay, M.A.; Zemans, R.L. The acute respiratory distress syndrome: Pathogenesis and treatment. Annu. Rev. Pathol. 2011, 6, 147–163. [Google Scholar] [CrossRef] [Green Version]
- Huppert, L.A.; Matthay, M.A.; Ware, L.B. Pathogenesis of Acute Respiratory Distress Syndrome. Semin. Respir. Crit. Care Med. 2019, 40, 31–39. [Google Scholar] [CrossRef]
- Kellner, M.; Noonepalle, S.; Lu, Q.; Srivastava, A.; Zemskov, E.; Black, S.M. ROS Signaling in the Pathogenesis of Acute Lung Injury (ALI) and Acute Respiratory Distress Syndrome (ARDS). Adv. Exp. Med. Biol. 2017, 967, 105–137. [Google Scholar] [CrossRef]
- Rahman, I.; Adcock, I.M. Oxidative stress and redox regulation of lung inflammation in COPD. Eur. Respir. J. 2006, 28, 219–242. [Google Scholar] [CrossRef]
- Lima-Martinez, M.M.; Carrera Boada, C.; Madera-Silva, M.D.; Marin, W.; Contreras, M. COVID-19 and diabetes: A bidirectional relationship. Clin. Investig. Arterioscler. 2021, 33, 151–157. [Google Scholar] [CrossRef]
- Majumder, J.; Minko, T. Recent Developments on Therapeutic and Diagnostic Approaches for COVID-19. AAPS J. 2021, 23, 14. [Google Scholar] [CrossRef]
- Mohamadian, M.; Chiti, H.; Shoghli, A.; Biglari, S.; Parsamanesh, N.; Esmaeilzadeh, A. COVID-19: Virology, biology and novel laboratory diagnosis. J. Gene Med. 2021, 23, e3303. [Google Scholar] [CrossRef]
- Wu, X.X.; Huang, X.L.; Chen, R.R.; Li, T.; Ye, H.J.; Xie, W.; Huang, Z.M.; Cao, G.Z. Paeoniflorin Prevents Intestinal Barrier Disruption and Inhibits Lipopolysaccharide (LPS)-Induced Inflammation in Caco-2 Cell Monolayers. Inflammation 2019, 42, 2215–2225. [Google Scholar] [CrossRef]
- Sul, O.J.; Ra, S.W. Quercetin Prevents LPS-Induced Oxidative Stress and Inflammation by Modulating NOX2/ROS/NF-kB in Lung Epithelial Cells. Molecules 2021, 26, 6949. [Google Scholar] [CrossRef]
- Parisi, G.F.; Carota, G.; Castruccio Castracani, C.; Spampinato, M.; Manti, S.; Papale, M.; Di Rosa, M.; Barbagallo, I.; Leonardi, S. Nutraceuticals in the Prevention of Viral Infections, including COVID-19, among the Pediatric Population: A Review of the Literature. Int. J. Mol. Sci. 2021, 22, 2465. [Google Scholar] [CrossRef]
- Goli, M. Review of novel human beta-coronavirus (2019-nCoV or SARS-CoV-2) from the food industry perspective-Appropriate approaches to food production technology. Food Sci. Nutr. 2020, 8, 5228–5237. [Google Scholar] [CrossRef]
- Imran, M.; Arshad, M.S.; Butt, M.S.; Kwon, J.H.; Arshad, M.U.; Sultan, M.T. Mangiferin: A natural miracle bioactive compound against lifestyle related disorders. Lipids Health Dis. 2017, 16, 84. [Google Scholar] [CrossRef]
- Dar, A.; Faizi, S.; Naqvi, S.; Roome, T.; Zikr-ur-Rehman, S.; Ali, M.; Firdous, S.; Moin, S.T. Analgesic and antioxidant activity of mangiferin and its derivatives: The structure activity relationship. Biol. Pharm. Bull. 2005, 28, 596–600. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Di Stefano, A.; Dossena, F.; Gnemmi, I.; D’Anna, S.E.; Brun, P.; Balbi, B.; Piraino, A.; Spanevello, A.; Nucera, F.; Carriero, V.; et al. Decreased humoral immune response in the bronchi of rapid decliners with chronic obstructive pulmonary disease. Respir. Res. 2022, 23, 200. [Google Scholar] [CrossRef] [PubMed]
- Sferrazzo, G.; Palmeri, R.; Restuccia, C.; Parafati, L.; Siracusa, L.; Spampinato, M.; Carota, G.; Distefano, A.; Di Rosa, M.; Tomasello, B.; et al. Mangifera indica L. Leaves as a Potential Food Source of Phenolic Compounds with Biological Activity. Antioxidants 2022, 11, 1313. [Google Scholar] [CrossRef] [PubMed]
- Raffaele, M.; Barbagallo, I.; Licari, M.; Carota, G.; Sferrazzo, G.; Spampinato, M.; Sorrenti, V.; Vanella, L. N-Acetylcysteine (NAC) Ameliorates Lipid-Related Metabolic Dysfunction in Bone Marrow Stromal Cells-Derived Adipocytes. Evid. Based Complement. Altern. Med. 2018, 2018, 5310961. [Google Scholar] [CrossRef] [PubMed]
- Spampinato, M.; Sferrazzo, G.; Pittala, V.; Di Rosa, M.; Vanella, L.; Salerno, L.; Sorrenti, V.; Carota, G.; Parrinello, N.; Raffaele, M.; et al. Non-competitive heme oxygenase-1 activity inhibitor reduces non-small cell lung cancer glutathione content and regulates cell proliferation. Mol. Biol. Rep. 2020, 47, 1949–1964. [Google Scholar] [CrossRef]
- D’Angeli, F.; Guadagni, F.; Genovese, C.; Nicolosi, D.; Trovato Salinaro, A.; Spampinato, M.; Mannino, G.; Lo Furno, D.; Petronio Petronio, G.; Ronsisvalle, S.; et al. Anti-Candidal Activity of the Parasitic Plant Orobanche crenata Forssk. Antibiotics 2021, 10, 1373. [Google Scholar] [CrossRef]
- Perelman, A.; Wachtel, C.; Cohen, M.; Haupt, S.; Shapiro, H.; Tzur, A. JC-1: Alternative excitation wavelengths facilitate mitochondrial membrane potential cytometry. Cell Death Dis. 2012, 3, e430. [Google Scholar] [CrossRef] [Green Version]
- Lan, J.; Ge, J.; Yu, J.; Shan, S.; Zhou, H.; Fan, S.; Zhang, Q.; Shi, X.; Wang, Q.; Zhang, L.; et al. Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor. Nature 2020, 581, 215–220. [Google Scholar] [CrossRef] [Green Version]
- Ronsisvalle, S.; Lissandrello, E.; Fuochi, V.; Petronio Petronio, G.; Straquadanio, C.; Crasci, L.; Panico, A.; Milito, M.; Cova, A.M.; Tempera, G.; et al. Antioxidant and antimicrobial properties of Casteanea sativa Miller chestnut honey produced on Mount Etna (Sicily). Nat. Prod. Res. 2019, 33, 843–850. [Google Scholar] [CrossRef]
- Barbagallo, I.; Vanella, L.; Distefano, A.; Nicolosi, D.; Maravigna, A.; Lazzarino, G.; Di Rosa, M.; Tibullo, D.; Acquaviva, R.; Li Volti, G. Moringa oleifera Lam. improves lipid metabolism during adipogenic differentiation of human stem cells. Eur. Rev. Med. Pharmacol. Sci. 2016, 20, 5223–5232. [Google Scholar]
- Fuochi, V.; Barbagallo, I.; Distefano, A.; Puglisi, F.; Palmeri, R.; Di Rosa, M.; Giallongo, C.; Longhitano, L.; Fontana, P.; Sferrazzo, G.; et al. Biological properties of Cakile maritima Scop. (Brassicaceae) extracts. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 2280–2292. [Google Scholar] [CrossRef]
- Vanella, L.; Tibullo, D.; Godos, J.; Pluchinotta, F.R.; Di Giacomo, C.; Sorrenti, V.; Acquaviva, R.; Russo, A.; Li Volti, G.; Barbagallo, I. Caffeic Acid Phenethyl Ester Regulates PPAR’s Levels in Stem Cells-Derived Adipocytes. PPAR Res. 2016, 2016, 7359521. [Google Scholar] [CrossRef]
- Presti, S.; Manti, S.; Parisi, G.F.; Papale, M.; Barbagallo, I.A.; Li Volti, G.; Leonardi, S. Lactoferrin: Cytokine Modulation and Application in Clinical Practice. J. Clin. Med. 2021, 10, 5482. [Google Scholar] [CrossRef]
- Muhammad, M.; Hassan, T.M.; Baba, S.S.; Radda, M.I.; Mutawakkil, M.M.; Musa, M.A.; AbuBakar, S.; Loong, S.K.; Yusuf, I. Exploring NFkappaB pathway as a potent strategy to mitigate COVID-19 severe morbidity and mortality. J. Public Health Afr. 2022, 13, 1679. [Google Scholar] [CrossRef]
- Zorov, D.B.; Juhaszova, M.; Sollott, S.J. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol. Rev. 2014, 94, 909–950. [Google Scholar] [CrossRef] [Green Version]
- Matkowski, A.; Kus, P.; Goralska, E.; Wozniak, D. Mangiferin—A bioactive xanthonoid, not only from mango and not just antioxidant. Mini Rev. Med. Chem. 2013, 13, 439–455. [Google Scholar]
- Vyas, A.; Syeda, K.; Ahmad, A.; Padhye, S.; Sarkar, F.H. Perspectives on medicinal properties of mangiferin. Mini Rev. Med. Chem. 2012, 12, 412–425. [Google Scholar] [CrossRef]
- Nunez Selles, A.J.; Daglia, M.; Rastrelli, L. The potential role of mangiferin in cancer treatment through its immunomodulatory, anti-angiogenic, apoptopic, and gene regulatory effects. Biofactors 2016, 42, 475–491. [Google Scholar] [CrossRef]
- Kielian, T.L.; Blecha, F. CD14 and other recognition molecules for lipopolysaccharide: A review. Immunopharmacology 1995, 29, 187–205. [Google Scholar] [CrossRef]
- Wang, X.; Yuwen, T.; Yanqin, T. Mangiferin Inhibits Inflammation and Cell Proliferation, and Activates Proapoptotic Events via NF-kappaB Inhibition in DMBA-Induced Mammary Carcinogenesis in Rats. J. Environ. Pathol. Toxicol. Oncol. 2021, 40, 1–9. [Google Scholar] [CrossRef]
- Dong, M.; Li, L.; Li, G.; Song, J.; Liu, B.; Liu, X.; Wang, M. Mangiferin protects against alcoholic liver injury via suppression of inflammation-induced adipose hyperlipolysis. Food Funct. 2020, 11, 8837–8851. [Google Scholar] [CrossRef] [PubMed]
- Lei, L.Y.; Wang, R.C.; Pan, Y.L.; Yue, Z.G.; Zhou, R.; Xie, P.; Tang, Z.S. Mangiferin inhibited neuroinflammation through regulating microglial polarization and suppressing NF-kappaB, NLRP3 pathway. Chin. J. Nat. Med. 2021, 19, 112–119. [Google Scholar] [CrossRef] [PubMed]
- Bulugonda, R.K.; Kumar, K.A.; Gangappa, D.; Beeda, H.; Philip, G.H.; Muralidhara Rao, D.; Faisal, S.M. Mangiferin from Pueraria tuberosa reduces inflammation via inactivation of NLRP3 inflammasome. Sci. Rep. 2017, 7, 42683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barbagallo, I.; Marrazzo, G.; Frigiola, A.; Zappala, A.; Li Volti, G. Role of carbon monoxide in vascular diseases. Curr. Pharm. Biotechnol. 2012, 13, 787–796. [Google Scholar] [CrossRef] [PubMed]
- Sorrenti, V.; Pittala, V.; Romeo, G.; Amata, E.; Dichiara, M.; Marrazzo, A.; Turnaturi, R.; Prezzavento, O.; Barbagallo, I.; Vanella, L.; et al. Targeting heme Oxygenase-1 with hybrid compounds to overcome Imatinib resistance in chronic myeloid leukemia cell lines. Eur. J. Med. Chem. 2018, 158, 937–950. [Google Scholar] [CrossRef]
- Li Volti, G.; Tibullo, D.; Vanella, L.; Giallongo, C.; Di Raimondo, F.; Forte, S.; Di Rosa, M.; Signorelli, S.S.; Barbagallo, I. The Heme Oxygenase System in Hematological Malignancies. Antioxid. Redox Signal. 2017, 27, 363–377. [Google Scholar] [CrossRef]
- Barbagallo, I.; Tibullo, D.; Di Rosa, M.; Giallongo, C.; Palumbo, G.A.; Raciti, G.; Campisi, A.; Vanella, A.; Green, C.J.; Motterlini, R. A cytoprotective role for the heme oxygenase-1/CO pathway during neural differentiation of human mesenchymal stem cells. J. Neurosci. Res. 2008, 86, 1927–1935. [Google Scholar] [CrossRef]
- Owen, J.B.; Butterfield, D.A. Measurement of oxidized/reduced glutathione ratio. Methods Mol. Biol. 2010, 648, 269–277. [Google Scholar] [CrossRef]
- Wang, H.L.; Li, C.Y.; Zhang, B.; Liu, Y.D.; Lu, B.M.; Shi, Z.; An, N.; Zhao, L.K.; Zhang, J.J.; Bao, J.K.; et al. Mangiferin facilitates islet regeneration and beta-cell proliferation through upregulation of cell cycle and beta-cell regeneration regulators. Int. J. Mol. Sci. 2014, 15, 9016–9035. [Google Scholar] [CrossRef] [Green Version]
- Sekiguchi, Y.; Mano, H.; Nakatani, S.; Shimizu, J.; Kataoka, A.; Ogura, K.; Kimira, Y.; Ebata, M.; Wada, M. Mangiferin positively regulates osteoblast differentiation and suppresses osteoclast differentiation. Mol. Med. Rep. 2017, 16, 1328–1332. [Google Scholar] [CrossRef] [Green Version]
- Andrieux, P.; Chevillard, C.; Cunha-Neto, E.; Nunes, J.P.S. Mitochondria as a Cellular Hub in Infection and Inflammation. Int. J. Mol. Sci. 2021, 22, 11338. [Google Scholar] [CrossRef]
- Dinarello, C.A. Interleukin-1 in the pathogenesis and treatment of inflammatory diseases. Blood 2011, 117, 3720–3732. [Google Scholar] [CrossRef]
- Mills, E.L.; Kelly, B.; Logan, A.; Costa, A.S.H.; Varma, M.; Bryant, C.E.; Tourlomousis, P.; Dabritz, J.H.M.; Gottlieb, E.; Latorre, I.; et al. Succinate Dehydrogenase Supports Metabolic Repurposing of Mitochondria to Drive Inflammatory Macrophages. Cell 2016, 167, 457–470.e13. [Google Scholar] [CrossRef] [Green Version]
- Azali, M.A.; Mohamed, S.; Harun, A.; Hussain, F.A.; Shamsuddin, S.; Johan, M.F. Application of Baculovirus Expression Vector system (BEV) for COVID-19 diagnostics and therapeutics: A review. J. Genet. Eng. Biotechnol. 2022, 20, 98. [Google Scholar] [CrossRef]
- Chalfie, M.; Tu, Y.; Euskirchen, G.; Ward, W.W.; Prasher, D.C. Green fluorescent protein as a marker for gene expression. Science 1994, 263, 802–805. [Google Scholar] [CrossRef] [Green Version]
- Kost, T.A.; Condreay, J.P.; Ames, R.S.; Rees, S.; Romanos, M.A. Implementation of BacMam virus gene delivery technology in a drug discovery setting. Drug Discov. Today 2007, 12, 396–403. [Google Scholar] [CrossRef]
- Centers for Disease Control and Prevention; NHI. Biosafety in Microbiological and Biomedical Laboratories, 6th ed.; Department of Health and Human Services: Atlanta, GA, USA, 2020; p. 574.
Gene | Forward | Reverse |
---|---|---|
IL-6 | CCACCGGGAACGAAAGAGAA | GAGAAGGCAACTGGACCGAA |
IL-10 | CCACAAGACAGACTTGCAAAAG | AACAAGTTGTCCAGCTGATCC |
COX-2 | CTGGCGCTCAGCCATACAG | CGCACTTATACTGGTCAAATCCC |
HO-1 | GTTGGGGTGGTTTTTGAGCC | TTAGACCAAGGCCACAGTGC |
TNF-α | GCAACAAGACCACCACTTCG | GATCAAAGCTGTAGGCCCCA |
MCP-1 | CCTTCATTCCCCAAGGGCTC | GGTTTGCTTGTCCAGGTGGT |
ACE2 | TGGAGAAAATCCTTATGCCTCCA | CTCTCCTTGGCCATGTTGTCT |
TMPRSS2 | GTAGGACCAGCCTCCATTTCC | CCTCACCTTTGGTCCTCTGAC |
GAPDH | TTCTTTTGCGTCGCCAGCC | CTTCCCGTTCTCAGCCTTGAC |
Amount per Well | Final Concentration | |
---|---|---|
Pseudovirus SARS-CoV-2 | 2.5 μL | 3.3 × 108 VG/mL |
Sodium butyrate | 0.6 μL | 2 mM |
Compounds with complete media | Adjust to 150 μL | 10 µg/mL LPS (LPS); 20 µg/mL mangiferin (MGF); LPS + MGF |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Spampinato, M.; Carota, G.; Sferrazzo, G.; Fuochi, V.; Distefano, A.; Ronsisvalle, S.; Sipala, F.; Giuffrida, R.; Furneri, P.M.; Di Rosa, M.; et al. Effects of Mangiferin on LPS-Induced Inflammation and SARS-CoV-2 Viral Adsorption in Human Lung Cells. Pharmaceutics 2022, 14, 2845. https://doi.org/10.3390/pharmaceutics14122845
Spampinato M, Carota G, Sferrazzo G, Fuochi V, Distefano A, Ronsisvalle S, Sipala F, Giuffrida R, Furneri PM, Di Rosa M, et al. Effects of Mangiferin on LPS-Induced Inflammation and SARS-CoV-2 Viral Adsorption in Human Lung Cells. Pharmaceutics. 2022; 14(12):2845. https://doi.org/10.3390/pharmaceutics14122845
Chicago/Turabian StyleSpampinato, Mariarita, Giuseppe Carota, Giuseppe Sferrazzo, Virginia Fuochi, Alfio Distefano, Simone Ronsisvalle, Federica Sipala, Rosario Giuffrida, Pio Maria Furneri, Michelino Di Rosa, and et al. 2022. "Effects of Mangiferin on LPS-Induced Inflammation and SARS-CoV-2 Viral Adsorption in Human Lung Cells" Pharmaceutics 14, no. 12: 2845. https://doi.org/10.3390/pharmaceutics14122845