ChaWRKY40 Enhances Drought Tolerance of ‘Dawei’ Hazelnuts by Positively Regulating Proline Synthesis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Growth Conditions
2.2. RNA Extraction and qRT–PCR Analysis
2.3. Gene Cloning and Vector Construction
2.4. Bioinformatics Analysis
2.5. Transient ChaWRKY40 Overexpression in Hazelnut Leaves
2.6. Analyses of Physiological Indices and Histochemical Staining
2.7. Yeast One-Hybrid Assay
2.8. Statistical Analysis
3. Results
3.1. Phylogenetic Tree Construction, Homologous Sequence Alignment, and Promoter Sequence Analysis of ChaWRKY40
3.2. Phenotypic Observation and Determination of the Content of Proline, EL, RWC, and the Expression Levels of ChaWRKY40 and ChaP5CS under Drought Stress
3.3. The Effect of Transient ChaWRKY40 Overexpression on Proline and ChaP5CS
3.4. Determination of Proline and ChaP5CS in OE-ChaWRKY40 and EV Plants under Drought Treatment
3.5. Determination of the Content of RWC, EL, MDA, Soluble Sugar, and Soluble Protein in OE-ChaWRKY40 and EV Plants under Drought Treatment
3.6. Determination of Reactive Oxygen Species and Antioxidant Enzymes in OE-ChaWRKY40 and EV Plants under Drought Stress
3.7. ChaWRKY40 Can Directly Bind to the W-Box of ChaP5CS Promoter
4. Discussion
5. Conclusions
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Correction Statement
Appendix A
Primer Name | Primer Sequence (5′–3′) | Tm (°C) | Product Length (bp) |
---|---|---|---|
qRT-ChaWRKY40-F | TTCTTCAAGCCCATCTCC | 54 | 212 |
qRT-ChaWRKY40-R | GTCTTCCCGACACCTTTG | ||
qRT-ChaP5CS-F | CCCAGAGGCAGCAATAAAC | 56 | 281 |
qRT-ChaP5CS-R | AACAGTGCAAGCCAACGAA | ||
G-ChaWRKY40-F | GCTCTAGAATGGAAGCAGCTCATGCCT | 62 | 578 |
G-ChaWRKY40-R | GGGGTACCTTAGGCATGCGTGGAGGAG | ||
Y1H-ChaWRKY40-F | CGGAATTCATGGAAGCAGCTCATGCCT | 60 | 578 |
Y1H-ChaWRKY40-R | CGGGATCCTTAGGCATGCGTGGAGGA | ||
Y1H-ChaP5CS-F | CGAGCTCGCTTTCTACAACATTCTAATTTCTA | 59 | 180 |
Y1H-ChaP5CS-R | GGGGTACCCCCACACTACTTTTTTCTTATTC | ||
ChaWRKY40-F | ATGGAAGCAGCTCATGCCT | 57 | 578 |
ChaWRKY40-R | TTAGGCATGCGTGGAGGAG |
CPEG-6000 (g·L−1) | ΨPEG (bar) |
---|---|
0 | 0 |
50 | −0.47 |
150 | −3.02 |
250 | −7.73 |
References
- Ma, Q.; Wang, G.; Liang, W.; Liang, L.; Zhao, T. The research progresses, germplasm utilization and breeding innovation of Corylus (hazelnuts) in China: A review. J. Fruit Sci. 2013, 30, 159–164. [Google Scholar]
- Köksal, A.İ.; Artik, N.; Şimşek, A.; Güneş, N. Nutrient composition of hazelnut (Corylus avellana L.) varieties cultivated in Turkey. Food Chem. 2006, 99, 509–515. [Google Scholar] [CrossRef]
- Liu, G.; Lin, Y.; Zhang, L.; Feng, B.; Tang, G.; Ren, J.; Wang, Z. Evaluation on nut economic traits of cold resistant Corylus heterophylla × C. avellana. J. Northeast. For. Univ. 2018, 46, 36–39. [Google Scholar]
- Li, C.; Dong, F.; Wang, G.; Zhang, R.; Liang, L. Study on the tolerance and critical water capacity of shoot shriveling in hybrid hazelnuts. J. For. Res. 2010, 23, 330–335. [Google Scholar]
- Xue, J. Physiological Mechanism of Shoot Shriveling Resistance in Excellent Lines of Interspecific Hybrid F1 between Corylus heterophylla Fisch. and Corylus avellana L.; Shanxi Agricultural University: Jinzhong, China, 2015. [Google Scholar]
- Wang, F.; Zhang, B.; Chang, B.; Shi, X.; Shi, Y.; Liu, Y.; Ji, L. Study on shoot shrivelling sensitive period of Ping’ou hybrid hazelnut in Taigu Shanxi. China Fruits 2022, 4, 34–39. [Google Scholar]
- Felagari, K.; Bahramnejad, B.; Siosemardeh, A.; Mirzaei, K.; Lei, X.; Zhang, J. A comparison of the physiological traits and gene expression of brassinosteroids signaling under drought conditions in two chickpea cultivars. Agronomy 2023, 13, 2963. [Google Scholar] [CrossRef]
- Ma, Y.; Ma, R.; Cao, Z.; Li, Y. Effects of PEG stress on physiological characteristics of the lespedeza seedlings leaves. J. Desert Res. 2012, 32, 1662–1668. [Google Scholar]
- Li, Z.; Xu, X.; Jiao, J.; Ling, F.; Li, C. Physiological responses and mechanism of drought resistance in leaves of different olive varieties under osmotic stress. Acta Bot. Boreali Occident. Sin. 2014, 34, 1808–1814. [Google Scholar]
- Ghosh, U.K.; Islam, M.N.; Siddiqui, M.N.; Cao, X.; Khan, M.A.R. Proline, a multifaceted signalling molecule in plant responses to abiotic stress: Understanding the physiological mechanisms. Plant. Biol. 2022, 24, 227–239. [Google Scholar] [CrossRef]
- Yang, S.; Zhu, D.; Ren, Y.; Zhu, Y. Change of leaf membrane permeability and some osmotic regulation substances of 3 poplar varieties under drought stress. Acta Agric. Shanghai 2016, 32, 118–123. [Google Scholar]
- Liang, Q.; Han, Y.; Qiao, Y.; Xie, K.; Li, S.; Dong, Y.; Li, S.; Zhang, S. Effects of drought stress on the growth and physiological characteristics of Sect. Aigeiors clones. J. Beijing For. Univ. 2023, 45, 81–89. [Google Scholar]
- Ren, R. Expression Characteristics of the Proline Synthesis Key Gene P5CS1 in Poplar and Functional Verification of Drought Tolerance; Northwest A&F University: Xianyang, China, 2022. [Google Scholar]
- Shang, T. P5CS1 Cloning and Identification and the Analyze of Proline Metabolic Genes Expression in Citrus; Huazhong Agricultural University: Wuhan, China, 2020. [Google Scholar]
- Yamada, M.; Morishita, H.; Urano, K.; Shiozaki, N.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Yoshiba, Y. Effects of free proline accumulation in petunias under drought stress. J. Exp. Bot. 2005, 56, 1975–1981. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.; Hu, Y.; Zhang, W.; Xie, R.; Guan, H.; Xiong, H.; Jia, L.; Zhang, X.; Zhou, H.; Zheng, D. Revisiting the role of delta-1-pyrroline-5-carboxylate synthetase in drought-tolerant crop breeding. Crop J. 2022, 10, 1213–1218. [Google Scholar] [CrossRef]
- Zhang, Y.; Yang, X.; Nvsvrot, T.; Huang, L.; Cai, G.; Ding, Y.; Ren, W.; Wang, N. The transcription factor WRKY75 regulates the development of adventitious roots, lateral buds and callus by modulating hydrogen peroxide content in poplar. J. Exp. Bot. 2022, 73, 1483–1498. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Gao, J.; Sun, J.; Li, S.; Zhang, B.; Wang, Z.; Zhou, C.; Sulis, D.B.; Wang, J.P.; Chiang, V.L. Dimerization of PtrMYB074 and PtrWRKY19 mediates transcriptional activation of PtrbHLH186 for secondary xylem development in Populus trichocarpa. New Phytol. 2022, 234, 918–933. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.; Ren, S.; Liu, X.; Su, L.; Wu, Y.; Zhang, W.; Li, Y.; Jiang, Y.; Wang, H.; Fu, R.; et al. SlWRKY35 positively regulates carotenoid biosynthesis by activating the MEP pathway in tomato fruit. New Phytol. 2022, 234, 164–178. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Wu, J.; Hu, K.; Wei, S.; Sun, H.; Hu, L.; Han, Z.; Yao, G.; Zhang, H. PyWRKY26 and PybHLH3 cotargeted the PyMYB114 promoter to regulate anthocyanin biosynthesis and transport in red-skinned pears. Hort. Res. 2020, 7, 37. [Google Scholar] [CrossRef]
- Jiang, Y.; Tong, S.; Chen, N.; Liu, B.; Bai, Q.; Chen, Y.; Bi, H.; Zhang, Z.; Lou, S.; Tang, H.; et al. The PalWRKY77 transcription factor negatively regulates salt tolerance and abscisic acid signaling in Populus. Plant J. 2021, 105, 1258–1273. [Google Scholar] [CrossRef]
- Dong, Q.; Tian, Y.; Zhang, X.; Duan, D.; Zhang, H.; Yang, K.; Jia, P.; Luan, H.; Guo, S.; Qi, G.; et al. Overexpression of the transcription factor MdWRKY115 improves drought and osmotic stress tolerance by directly binding to the MdRD22 promoter in apple. Hortic. Plant J. 2023, in press. [Google Scholar] [CrossRef]
- Zhou, R.; Dong, Y.; Liu, X.; Feng, S.; Wang, C.; Ma, X.; Liu, J.; Liang, Q.; Bao, Y.; Xu, S.; et al. JrWRKY21 interacts with JrPTI5L to activate the expression of JrPR5L for resistance to Colletotrichum gloeosporioides in walnut. Plant J. 2022, 111, 1152–1166. [Google Scholar] [CrossRef]
- Yang, Z.; Wang, F.; Wang, J. Sequence and expression pattern analysis of potato StWRKY40 gene. Mol. Breed. 2020, 18, 7283–7292. [Google Scholar]
- Dai, W.; Wang, M.; Gong, X.; Liu, J. The transcription factor FcWRKY40 of Fortunella crassifolia functions positively in salt tolerance through modulation of ion homeostasis and proline biosynthesis by directly regulating SOS2 and P5CS1 homologs. New Phytol. 2018, 219, 972–989. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Ru, J.; Liu, Y.; Yang, J.; Li, M.; Xu, Z.; Fu, J. The maize WRKY transcription factor ZmWRKY40 confers drought resistance in transgenic Arabidopsis. Int. J. Mol. Sci. 2018, 19, 2580. [Google Scholar] [CrossRef]
- Liu, Y.; He, L.; Zhao, X.; Liang, N.; Li, X.; Liang, X.; Zhan, Y. Cloning and expression analysis of FmWRKY40 gene in Fraxinus mandshurica. Mol. Breed. 2017, 15, 833–838. [Google Scholar]
- Huang, Z.; Wang, J.; Li, Y.; Song, L.; Chen, D.; Liu, L.; Jiang, C. A WRKY protein, MfWRKY40, of resurrection plant Myrothamnus flabellifolia plays a positive role in regulating tolerance to drought and salinity stresses of Arabidopsis. Int. J. Mol. Sci. 2022, 23, 8145. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.; Yang, B.; Wei, Y.; Zhang, P.; Wen, P. SA incubation induced accumulation of flavan-3-ols through activated VvANR expression in grape leaves. Sci. Hortic. 2021, 287, 110296–110396. [Google Scholar] [CrossRef]
- Lei, H.; Su, S.; Ma, L.; Ma, Z. Cloning and functional analysis of ChaCBF1, a CBF/DREB1-like transcriptional factor from Corylus heterophylla × C. avellana. J. Beijing For. Univ. 2016, 38, 69–79. [Google Scholar]
- Ding, K.; Wang, L.; Tian, G.; Wang, H.; Li, F.; Pan, Y.; Pang, Z.; Shan, Y. Effect of exogenous uniconazole on antioxidant capacity and osmotic adjustment of potato leaves under drought stress. J. Nucl. Agric. Sci. 2024, 38, 169–178. [Google Scholar]
- Zhang, L.; Fan, J.; Ruan, Y.; Guan, Y. Application of polyethylene glycol in the study of plant osmotic stress physiology. Plant Physiol. Comm. 2004, 40, 361–364. [Google Scholar]
- Michel, B.; Wiggins, O.; Outlaw, W. A guide to establishing water potential of aqueous two-phase solutions (polyethylene glycol plus dextran) by amendment with mannitol. Plant Physiol. 1983, 72, 60–65. [Google Scholar] [CrossRef]
- Gan, Z.; Yuan, X.; Shan, N.; Wan, C.; Chen, C.; Xu, Y.; Xu, Q.; Chen, J. AcWRKY40 mediates ethylene biosynthesis during postharvest ripening in kiwifruit. Plant Sci. 2021, 309, 110948. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, Y.; Li, C.; Chen, X.; Yang, L.; Zhang, J.; Wang, J.; Li, L.; Reynolds, M.P.; Jing, R.; et al. Transcription factor TaWRKY51 is a positive regulator in root architecture and grain yield contributing traits. Front. Plant Sci. 2021, 12, 734614. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Jiang, C.; Chen, C.; Su, K.; Lin, H.; Zhao, Y.; Guo, Y. VvWRKY5 enhances white rot resistance in grape by promoting the jasmonic acid pathway. Hortic. Res. 2023, 10, uhad172. [Google Scholar] [CrossRef]
- Xu, H.; Yang, G.; Zhang, J.; Zou, Q.; Wang, Y.; Qu, C.; Jiang, S.; Wang, N.; Chen, X. Molecular mechanism of apple MdWRKY18 and MdWRKY40 participating in salt stress. Sci. Agric. Sin. 2018, 51, 4514–4521. [Google Scholar]
- Zhang, G.; Liang, C.; Guo, J.; Zhang, Z.; Zhang, P.; Zhao, Q.; Liang, J.; Wen, P. Clone and expression analysis of VvWRKY26 gene in grape (Vitis vinifera). J. Agric. Biotechnol. 2023, 31, 475–487. [Google Scholar]
- Xiao, J. Physiological and biochemical influences of different drought stress on Robinia pseudoacacia seedlings. J. Cent. South Univ. For. Techno. 2015, 35, 23–26. [Google Scholar]
- Li, X.; Hua, Z. Study on osmotic regulation ability and cross relationship of Scutellaria baicalensis under temperature and water stress. J. Agric. Sci. 2023, 51, 162–168. [Google Scholar]
- Chen, T.; Xu, G.; Liu, S.; Mi, X.; Li, Y. Leaf water status and non-structural carbohydrate dynamics with different crown height levels of Populus bolleana Lauche. under drought stress. Acta Bot. Boreali Occident. Sin. 2022, 42, 462–472. [Google Scholar]
- Xu, Y.; Hu, W.; Song, S.; Ye, X.; Ding, Z.; Liu, J.; Wang, Z.; Li, J.; Hou, X.; Xu, B.; et al. MaDREB1F confers cold and drought stress resistance through common regulation of hormone synthesis and protectant metabolite contents in banana. Hortic. Res. 2023, 10, uhac275. [Google Scholar] [CrossRef]
- Li, J. Analysis of Drought Resistance Function of Sugarcane Δ1-pyrroline-5-carboxylate synthase Gene (SoP5CS); Guangxi University: Nanning, China, 2018. [Google Scholar]
- Yang, D.; Ni, R.; Yang, S.; Pu, Y.; Qian, M.; Yang, Y.; Yang, Y. Functional characterization of the Stipa purpurea P5CS gene under drought stress conditions. Int. J. Mol. Sci. 2021, 22, 9599. [Google Scholar] [CrossRef]
- Ren, R.; Wang, H.; Wu, C.; Heng, Q.; Chen, W.; Sun, T.; Zhang, L.; He, H.; Li, X.; Zhang, Y.; et al. Full-length cloning and functional berification of PagP5CS1 from Populus alba × P. glandulosa. J. Northeast. For. Univ. 2023, 38, 90–96. [Google Scholar]
- Li, K.; Gao, Y.; Wu, J. Study on salt tolerance and drought resistance of potato transgenic P5CS gene ‘Dongnong 303’. Jiangsu Agric. Sci. 2014, 42, 131–133. [Google Scholar]
- Liu, Y.; Yang, T.; Lin, Z.; Gu, B.; Xing, C.; Zhao, L.; Dong, H.; Gao, J.; Xie, Z.; Zhang, S.; et al. A WRKY transcription factor PbrWRKY53 from Pyrus betulaefolia is involved in drought tolerance and AsA accumulation. Plant Biotechnol. J. 2019, 17, 1770–1787. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, Y.; Guo, W.; Dai, W.; Zhou, X.; Jiao, Y.; Shen, X. Cloning and function of GsWRKY57 transcription factor gene response to drought stress. Chin. J. Oil Crop Sci. 2019, 41, 524–530. [Google Scholar]
- Zhang, L.; Cheng, J.; Sun, X.; Zhao, T.; Li, M.; Wang, Q.; Li, S.; Xin, H. Overexpression of VaWRKY14 increases drought tolerance in Arabidopsis by modulating the expression of stress-related genes. Plant Cell Rep. 2018, 37, 1159–1172. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhang, R.; Ye, X.; Zheng, X.; Tan, B.; Wang, W.; Li, Z.; Li, J.; Cheng, J.; Feng, J. Overexpressing VvWRKY18 from grapevine reduces the drought tolerance in Arabidopsis by increasing leaf stomatal density. J. Plant Physiol. 2022, 275, 153741. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Chen, Q.; Chen, W.; Liu, X.; Xia, Y.; Guo, Q.; Jing, D.; Liang, G. A WRKY transcription factor, EjWRKY17, from Eriobotrya japonica enhances drought tolerance in transgenic Arabidopsis. Int. J. Mol. Sci. 2021, 22, 5593. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.; Ma, F.; Li, B.; Guo, C.; Hu, T.; Zhang, M.; Liang, Y.; Zhu, J.; Zhan, X. A bHLH transcription factor, SlbHLH96, promotes drought tolerance in tomato. Hortic. Res. 2022, 9, uhac198. [Google Scholar] [CrossRef]
- Han, D.; Zhang, Z.; Ding, H.; Chai, L.; Liu, W.; Li, H.; Yang, G. Isolation and characterization of MbWRKY2 gene involved in enhanced drought tolerance in transgenic tobacco. J. Plant Interact. 2018, 13, 163–172. [Google Scholar] [CrossRef]
- Duan, D.; Yi, R.; Ma, Y.; Dong, Q.; Mao, K.; Ma, F. Apple WRKY transcription factor MdWRKY56 positively modulates drought stress tolerance. Environ. Exp. Bot. 2023, 212, 105400. [Google Scholar] [CrossRef]
- Wang, Z.; Feng, R.; Zhang, X.; Su, Z.; Wei, J.; Liu, J. Characterization of the Hippophae rhamnoides WRKY gene family and functional analysis of the role of the HrWRKY21 gene in resistance to abiotic stresses. Genome 2019, 62, 689–703. [Google Scholar] [CrossRef] [PubMed]
- Gao, H.; Wang, Y.; Xu, P.; Zhang, Z. Overexpression of a WRKY transcription factor TaWRKY2 enhances drought stress tolerance in transgenic wheat. Front. Plant Sci. 2018, 9, 997. [Google Scholar] [CrossRef] [PubMed]
- El-Esawi, M.A.; Al-Ghamdi, A.A.; Ali, H.M.; Ahmad, M. Overexpression of AtWRKY30 transcription factor enhances heat and drought stress tolerance in wheat (Triticum aestivum L.). Genes 2019, 10, 163. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Chen, G.; Zhang, C. The effects of water stress on soluble protein content, the activity of SOD, POD and CAT of two ecotypes of reeds (Phragmites communis). Acta Bot. Boreali Occident. Sin. 2002, 22, 561–565. [Google Scholar]
- Jaffar, M.A.; Song, A.; Faheem, M.; Chen, S.; Jiang, J.; Liu, C.; Fan, Q.; Chen, F. Involvement of CmWRKY10 in drought tolerance of chrysanthemum through the ABA-signaling pathway. Int. J. Mol. Sci. 2016, 17, 693. [Google Scholar] [CrossRef]
- Lin, L.; Yuan, K.; Huang, Y.; Dong, H.; Qiao, Q.; Xing, C.; Huang, X.; Zhang, S. A WRKY transcription factor PbWRKY40 from Pyrus betulaefolia functions positively in salt tolerance and modulating organic acid accumulation by regulating PbVHA-B1 expression. Environ. Exp. Bot. 2022, 196, 104782. [Google Scholar] [CrossRef]
- Han, D.; Han, J.; Xu, T.; Li, T.; Yao, C.; Wang, Y.; Luo, D.; Yang, G. Isolation and preliminary functional characterization of MxWRKY64, a new WRKY transcription factor gene from Malus xiaojinensis Cheng et Jiang. In Vitro Cell. Dev. Plant 2021, 57, 202–213. [Google Scholar] [CrossRef]
- Shan, D.; Wang, C.; Song, H.; Bai, Y.; Zhang, H.; Hu, Z.; Wang, L.; Shi, K.; Zheng, X.; Yan, T.; et al. The MdMEK2–MdMPK6–MdWRKY17 pathway stabilizes chlorophyll levels by directly regulating MdSUFB in apple under drought stress. Plant J. 2021, 108, 814–828. [Google Scholar] [CrossRef]
- Zhang, W.; Zhao, S.; Gu, S.; Cao, X.; Zhang, Y.; Niu, J.; Liu, L.; Li, A.; Jia, W.; Qi, B.; et al. FvWRKY48 binds to the pectate lyase FvPLA promoter to control fruit softening in Fragaria vesca. Plant Physiol. 2022, 189, 1037–1049. [Google Scholar] [CrossRef]
- Chen, Y.; Liu, L.; Feng, Q.; Liu, C.; Bao, Y.; Zhang, N.; Sun, R.; Yin, Z.; Zhong, C.; Wang, Y.; et al. FvWRKY50 is an important gene that regulates both vegetative growth and reproductive growth in strawberry. Hortic. Res. 2023, 10, uhad115. [Google Scholar] [CrossRef]
- Cong, L.; Qu, Y.; Sha, G.; Zhang, S.; Ma, Y.; Chen, M.; Zhai, R.; Yang, C.; Xu, L.; Wang, Z. PbWRKY75 promotes anthocyanin synthesis by activating PbDFR, PbUFGT, and PbMYB10b in pear. Physiol. Plantarum. 2021, 173, 1841–1849. [Google Scholar] [CrossRef]
- Wang, J.; Wang, L.; Yan, Y.; Zhang, S.; Li, H.; Gao, Z.; Wang, C.; Guo, X. GhWRKY21 regulates ABA-mediated drought tolerance by fine-tuning the expression of GhHAB in cotton. Plant Cell Rep. 2021, 40, 2135–2150. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, P.; Chao, R.; Qiu, L.; Ge, W.; Liang, J.; Wen, P. ChaWRKY40 Enhances Drought Tolerance of ‘Dawei’ Hazelnuts by Positively Regulating Proline Synthesis. Forests 2024, 15, 407. https://doi.org/10.3390/f15030407
Zhang P, Chao R, Qiu L, Ge W, Liang J, Wen P. ChaWRKY40 Enhances Drought Tolerance of ‘Dawei’ Hazelnuts by Positively Regulating Proline Synthesis. Forests. 2024; 15(3):407. https://doi.org/10.3390/f15030407
Chicago/Turabian StyleZhang, Pengfei, Ruiqiang Chao, Liping Qiu, Wenjing Ge, Jinjun Liang, and Pengfei Wen. 2024. "ChaWRKY40 Enhances Drought Tolerance of ‘Dawei’ Hazelnuts by Positively Regulating Proline Synthesis" Forests 15, no. 3: 407. https://doi.org/10.3390/f15030407