Association of IL-4 Polymorphisms with Allergic Rhinitis in Jordanian Population
Abstract
:1. Introduction
2. Patients and Methods
2.1. Genotyping of SNPs
2.2. Statistical Analysis
3. Results
3.1. Genotype and Allele Frequencies
3.2. Haplotype Frequencies
4. Discussion
Limitations
5. Conclusions
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Skoner, D.P. Allergic rhinitis: definition, epidemiology, pathophysiology, detection, and diagnosis. J. Allergy Clin. Immunol. 2001, 108, S2–S8. [Google Scholar] [CrossRef] [PubMed]
- Pawankar, R.; Canonica, G.; Holgate, S.; Lockey, R.; Blaiss, M. WAO White Book on Allergy; Allergy Organization: Milwaukee, WI, USA, 2011; Volume 3, pp. 156–157. [Google Scholar]
- Passali, D.; Cingi, C.; Staffa, P.; Passali, F.; Muluk, N.B.; Bellussi, M.L. The International Study of the Allergic Rhinitis Survey: outcomes from 4 geographical regions. Asia Pac. Allergy 2018, 8, e7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mosmann, T.R.; Coffman, R. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 1989, 7, 145–173. [Google Scholar] [CrossRef] [PubMed]
- Zamorano, J.; Wang, H.Y.; Wang, L.M.; Pierce, J.H.; Keegan, A.D. IL-4 protects cells from apoptosis via the insulin receptor substrate pathway and a second independent signaling pathway. J. Immunol. 1996, 157, 4926–4934. [Google Scholar]
- Yanagida, M.; Fukamachi, H.; Ohgami, K.; Kuwaki, T.; Ishii, H.; Uzumaki, H.; Amano, K.; Tokiwa, T.; Mitsui, H.; Saito, H.; et al. Effects of T-helper 2-type cytokines, interleukin-3 (IL-3), IL-4, IL-5, and IL-6 on the survival of cultured human mast cells. Blood 1995, 86, 3705–3714. [Google Scholar] [CrossRef]
- Lutz, M.B.; Schnare, M.; Menges, M.; Rossner, S.; Rollinghoff, M.; Schuler, G.; Gessner, A. Differential functions of IL-4 receptor types I and II for dendritic cell maturation and IL-12 production and their dependency on GM-CSF. J. Immunol. 2002, 169, 3574–3580. [Google Scholar] [CrossRef] [Green Version]
- Schmidt-Weber, C.B.; Akdis, M.; Akdis, C.A. Th17 cells in the big picture of immunology. J. Allergy Clin. Immunol. 2007, 120, 247–254. [Google Scholar] [CrossRef]
- Hellings, P.W.; Kasran, A.; Liu, Z.; Vandekerckhove, P.; Wuyts, A.; Overbergh, L.; Mathieu, C.; Ceuppens, J.L. IL-17 orchestrates the granulocyte influx into airways after allergen inhalation in a mouse model of allergic asthma. Am. J. Respir. Cell Mol. Biol. 2003, 28, 42–50. [Google Scholar] [CrossRef]
- Ricci, M. IL-4: a key cytokine in atopy. Clin. Exp. Allergy. 1994, 24, 801–812. [Google Scholar] [CrossRef]
- Shang, H.; Cao, X.-L.; Wan, Y.-J.; Meng, J.; Guo, L.-H. IL-4 gene polymorphism may contribute to an increased risk of atopic dermatitis in children. Disease Markers 2016, 2016. [Google Scholar] [CrossRef] [Green Version]
- Fernandez-Botran, R.; Krammer, P.H.; Diamantstein, T.; Uhr, J.W.; Vitetta, E.S. B cell-stimulatory factor 1 (BSF-1) promotes growth of helper T cell lines. J. Exp. Med. 1986, 164, 580–593. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grabstein, K.; Eisenman, J.; Mochizuki, D.; Shanebeck, K.; Conlon, P.; Hopp, T.; March, C.; Gillis, S. Purification to homogeneity of B cell stimulating factor. A molecule that stimulates proliferation of multiple lymphokine-dependent cell lines. J. Exp. Med. 1986, 163, 1405–1414. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mosmann, T.R.; Bond, M.W.; Coffman, R.L.; Ohara, J.; Paul, W.E. T-cell and mast cell lines respond to B-cell stimulatory factor 1. Proc. Natl. Acad. Sci. USA 1986, 83, 5654–5658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, C.A.; Rennick, D.M. Characterization of a murine lymphokine distinct from interleukin 2 and interleukin 3 (IL-3) possessing a T-cell growth factor activity and a mast-cell growth factor activity that synergizes with IL-3. Proc. Natl. Acad. Sci. USA 1986, 83, 1857–1861. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pfeifer, J.; McKenzie, D.T.; Swain, S.L.; Dutton, R.W. B cell stimulatory factor 1 (interleukin 4) is sufficient for the proliferation and differentiation of lectin-stimulated cytolytic T lymphocyte precursors. J. Exp. Med. 1987, 166, 1464–1470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu-Li, J.; Shevach, E.; Mizuguchi, J.; Ohara, J.; Mosmann, T.; Paul, W. B cell stimulatory factor 1 (interleukin 4) is a potent costimulant for normal resting T lymphocytes. J. Exp. Med. 1987, 165, 157–172. [Google Scholar] [CrossRef]
- Zlotnik, A.; Fischer, M.; Roehm, N.; Zipori, D. Evidence for effects of interleukin 4 (B cell stimulatory factor 1) on macrophages: enhancement of antigen presenting ability of bone marrow-derived macrophages. J. Immunol. 1987, 138, 4275–4279. [Google Scholar]
- Zlotnik, A.; Ransom, J.; Frank, G.; Fischer, M.; Howard, M. Interleukin 4 is a growth factor for activated thymocytes: possible role in T-cell ontogeny. Proc. Natl. Acad. Sci. USA 1987, 84, 3856–3860. [Google Scholar] [CrossRef] [Green Version]
- Noelle, R.; Krammer, P.H.; Ohara, J.; Uhr, J.W.; Vitetta, E.S. Increased expression of Ia antigens on resting B cells: an additional role for B-cell growth factor. Proc. Natl. Acad. Sci. USA 1984, 81, 6149–6153. [Google Scholar] [CrossRef] [Green Version]
- Roehm, N.W.; Leibson, H.J.; Zlotnik, A.; Kappler, J.; Marrack, P.; Cambier, J.C. Interleukin-induced increase in Ia expression by normal mouse B cells. J. Exp. Med. 1984, 160, 679–694. [Google Scholar] [CrossRef] [Green Version]
- Bartemes, K.R.; Kephart, G.M.; Fox, S.J.; Kita, H. Enhanced innate type 2 immune response in peripheral blood from patients with asthma. J. Allergy Clin. Immunol. 2014, 134, 671–678.e4. [Google Scholar] [CrossRef] [Green Version]
- Nagakumar, P.; Denney, L.; Fleming, L.; Bush, A.; Lloyd, C.M.; Saglani, S. Type 2 innate lymphoid cells in induced sputum from children with severe asthma. J. Allergy Clin. Immunol. 2016, 137, 624–626.e6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Doherty, T.A.; Baum, R.; Newbury, R.O.; Yang, T.; Dohil, R.; Aquino, M.; Doshi, A.; Walford, H.H.; Kurten, R.C.; Broide, D.H.; et al. Group 2 innate lymphocytes (ILC2) are enriched in active eosinophilic esophagitis. J. Allergy Clin. Immunol. 2015, 136, 792–794.e3. [Google Scholar] [CrossRef] [Green Version]
- Micheal, S.; Minhas, K.; Ishaque, M.; Ahmed, F.; Ahmed, A. IL4 gene polymorphisms and their association with atopic asthma and allergic rhinitis in Pakistani patients. J. Investig. Allergol. Clin. Immunol. 2013, 23, 107–111. [Google Scholar] [PubMed]
- Movahedi, M.; Amirzargar, A.A.; Nasiri, R.; Hirbod-Mobarakeh, A.; Farhadi, E.; Tavakol, M.; Behniafard, N.; Ansaripour, B.; Moradi, B.; Zare, A.; et al. Gene polymorphisms of Interleukin-4 in allergic rhinitis and its association with clinical phenotypes. Am. J. Otolaryng. 2013, 34, 676–681. [Google Scholar] [CrossRef] [PubMed]
- Bayrak Degirmenci, P.; Aksun, S.; Altin, Z.; Bilgir, F.; Arslan, I.; Colak, H.; Ural, B.; Solakoglu Kahraman, D.; Diniz, G.; Ozdemir, B.; et al. Allergic Rhinitis and Its Relationship with IL-10, IL-17, TGF-β, IFN-γ, IL 22, and IL-35. Dis. Markers 2018, 2018, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dreborg, S.; Frew, A. Position paper: allergen standardization and skin tests. Allergy 1993, 48, 49–54. [Google Scholar] [CrossRef]
- Barnes, K.C.; Marsh, D.G. The genetics and complexity of allergy and asthma. Immunol. Today 1998, 19, 325–332. [Google Scholar] [CrossRef]
- Del Prete, G.F.; De Carli, M.; D’Elios, M.M.; Maestrelli, P.; Ricci, M.; Fabbri, L. Allergen exposure induces the activation of allergen-specific Th2 cells in the airway mucosa of patients with allergic respiratory disorders. Eur. J. Immunol. 1993, 23, 1445–1449. [Google Scholar] [CrossRef]
- Robinson, D.S.; Ying, S.; Bentley, A.M.; Meng, Q.; North, J.; Durham, S.R.; Kay, A.B.; Hamid, Q. Relationships among numbers of bronchoalveolar lavage cells expressing messenger ribonucleic acid for cytokines, asthma symptoms, and airway methacholine responsiveness in atopic asthma. J. Allergy Clin. Immunol. 1993, 92, 397–403. [Google Scholar] [CrossRef]
- Bruhn, K.W.; Nelms, K.; Boulay, J.-L.; Paul, W.E.; Lenardo, M.J. Molecular dissection of the mouse interleukin-4 promoter. Proc. Natl. Acad. Sci. USA 1993, 90, 9707–9711. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, M.-P.; Chen, R.-X.; Wang, M.-L.; Zhu, X.-J.; Zhu, L.-P.; Yin, M.; Zhang, Z.D.; Cheng, L. Association study on IL4, IL13 and IL4RA polymorphisms in mite-sensitized persistent allergic rhinitis in a Chinese population. PLoS One 2011, 6, e27363. [Google Scholar] [CrossRef] [PubMed]
- Nakashima, H.; Miyake, K.; Inoue, Y.; Shimizu, S.; Akahoshi, M.; Tanaka, Y.; Otsuka, T.; Harada, M. Association between IL-4 genotype and IL-4 production in the Japanese population. Genes Immun. 2002, 3, 107–109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Li, H.; Wang, X.; Gao, F.; Yu, L.; Chen, X. Association between four SNPs in IL-4 and the risk of gastric cancer in a Chinese population. IJMEG 2017, 8, 45–52. [Google Scholar]
- Zihlif, M.; Mahafza, T.; Obeidat, N.M.; Froukh, T.; Shaban, M.; Al-Akhras, F.M.; Zihlif, N.; Naffa, R. Frequency of genetic polymorphisms of ADAM33 and their association with allergic rhinitis among Jordanians. Gene 2013, 531, 462–466. [Google Scholar] [CrossRef]
- Amarin, J.Z.; Naffa, R.G.; Suradi, H.H.; Alsaket, Y.M.; Obeidat, N.M.; Mahafza, T.M.; Zihlif, M.A. An intronic single-nucleotide polymorphism (rs13217795) in FOXO3 is associated with asthma and allergic rhinitis: a case–case–control study. BMC Med. Genet. 2017, 18, 132. [Google Scholar] [CrossRef] [Green Version]
- Zihlif, M.; Obeidat, N.M.; Zihlif, N.; Mahafza, T.; Froukh, T.; Ghanim, M.T.; Beano, H.; Al-Akhras, F.M.; Naffa, R. Association between gasdermin A and gasdermin B polymorphisms and susceptibility to adult and childhood asthma among Jordanians. Gen. Test. Mol. Bioma. 2016, 20, 143–148. [Google Scholar] [CrossRef]
Primers | Primer Sequence | Annealing Temperature | PCR Product |
---|---|---|---|
rs2243250_F rs2243250_R | TAAACTTGGGAGAACATGGT | 50 | 195bp |
TGGGGAAAGATAGAGTAATA | |||
rs2227284_ F rs2227284_R | CTACTCTTGGCAGTTGCTGGAA | 58 | 220bp |
GGAACTCTCTGTAGAATTATGAACTTTAGGTC |
rs Number | cDNA Coordinates of SNPs | Position | RE | RFLP Fragments |
---|---|---|---|---|
rs2243250 | c.−589 C>T | Promoter | AvaII | C = 177,18, T = 195 |
rs2227284 | c.183+2527T>G | Intron 2 | AluI | T = 122,53,45, G = 122,98 |
Demographic and Clinical Categories | Study Group N = 158 | Control Group N = 140 | Test | p value |
---|---|---|---|---|
Age (years) Mean ± STD | 34.9 ± 13.3 | 35.7 ± 14.6 | Independent samples t-test | 0.615 |
Male sex N (%) | 64 (40.5%) | 55 (39.3%) | χ2 test | 0.771 |
Collegial education level or above N (%) | 97 (61.4% | 88 (62.9%) | χ2 test | 0.878 |
Smokers N (%) | 113 (71.5%) | 102 (72.9%) | χ2 test | 0.827 |
Nasal symptoms | ||||
Sneezing N (%) | 139 (88%) | 85 (60.7%) | χ2 test | <0.0001 |
Rhinorrhea N (%) | 134 (84.8%) | 92 (65.7%) | χ2 test | <0.0001 |
Nasal obstruction N (%) | 135 (85.4%) | 84 (60%) | χ2 test | <0.0001 |
Nasal itching N (%) | 155 (98.1%) | 29 (20.7%) | χ2 test | <0.0001 |
SPT results | ||||
House dust mite N (%) | 123 (77.9%) | Negative SPT | ||
Grass pollen N (%) | 81 (51.3%) | Negative SPT | ||
Tree pollen N (%) | 119 (75.3%) | Negative SPT | ||
Molds N (%) | 22 (13.9%) | Negative SPT | ||
Cats and dogs N (%) | 15 (9.5%) | Negative SPT | ||
Cockroaches N (%) | 47 (29.7%) | Negative SPT |
Group | Total | p-Value (z-Score) | Odds Ratio (95% CI) | |||
---|---|---|---|---|---|---|
Patients | Controls | |||||
rs2243250 (C-589T) | CC | 96 | 88 | 184 | 0.71 | 0.91(0.5727–1.46) |
CT | 53 | 50 | 103 | 0.97 | 1(0.6287–1.62) | |
TT | 9 | 2 | 11 | 0.05 | 4.17(0.885–19.63) | |
rs2227284 (T 2979G) | TT | 19 | 17 | 36 | 0.98 | 0.99(0.5–1.99) |
TG | 68 | 66 | 134 | 0.48 | 0.85(0.536–1.34) | |
GG | 71 | 57 | 128 | 0.46 | 1.19(0.75–1.88) |
Alleles | AR Patients | Controls (%) | Total | p-Value (z-Score) | Odds Ratio (95% CI) |
---|---|---|---|---|---|
rs2243250 (C-589T) | |||||
C | 245 | 226 | 471 | 0.34 | 1.21(0.815–1.8) |
T | 71 | 54 | 125 | ||
rs2227284 (T 2979G) | |||||
T | 106 | 100 | 206 | 0.58 | 1.10(0.785–1.54) |
G | 210 | 180 | 390 |
rs2243250 (C-589T) | Group | Total | p Value (z-Score) | Odds Ratio (95% CI) | ||||
---|---|---|---|---|---|---|---|---|
Patients | Controls | |||||||
CC | rs2227284 (T 2979G) | TT | 19a | 17a | 36 | 0.94 | 0.99(0.5–1.99) | |
TG | 68a | 66a | 134 | 0.52 | 0.85(0.54–1.34) | |||
GG | 9a | 5a | 14 | 0.39 | 1.63(0.53–4.99) | |||
Total | 96 | 88 | 184 | |||||
CT | rs2227284 | GG | 53a | 50a | 103 | 0.97 | 1(0.63–1.621) | |
Total | 53 | 50 | 103 | |||||
TT | rs2227284 | GG | 9a | 2a | 11 | 0.05 | 4.17(0.89–19.63) | |
Total | 9 | 2 | 11 | |||||
Total | rs2227284 (T 2979G) | TT | 19a | 17a | 36 | 0.97 | 0.99(0.5–1.99) | |
TG | 68a | 66a | 134 | 0.48 | 0.85(0.54–1.34) | |||
GG | 71a | 57a | 128 | 0.46 | 1.19(0.75–1.88) | |||
Total | 158 | 140 | 298 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moh’d Al-Rawashdeh, B.; Sadaalhanjori, A.; Ali, E.; Zihlif, M. Association of IL-4 Polymorphisms with Allergic Rhinitis in Jordanian Population. Medicina 2020, 56, 179. https://doi.org/10.3390/medicina56040179
Moh’d Al-Rawashdeh B, Sadaalhanjori A, Ali E, Zihlif M. Association of IL-4 Polymorphisms with Allergic Rhinitis in Jordanian Population. Medicina. 2020; 56(4):179. https://doi.org/10.3390/medicina56040179
Chicago/Turabian StyleMoh’d Al-Rawashdeh, Baeth, Ahmed Sadaalhanjori, Elnagi Ali, and Malek Zihlif. 2020. "Association of IL-4 Polymorphisms with Allergic Rhinitis in Jordanian Population" Medicina 56, no. 4: 179. https://doi.org/10.3390/medicina56040179