Next Article in Journal
Hexavalent Chromium Inhibited Zebrafish Embryo Development by Altering Apoptosis- and Antioxidant-Related Genes
Next Article in Special Issue
A Bioinformatics Toolkit for Next-Generation Sequencing in Clinical Oncology
Previous Article in Journal
Moringa oleifera: A Review on the Antiproliferative Potential in Breast Cancer Cells
Previous Article in Special Issue
The Spectrum of Germline Nucleotide Variants in Gastric Cancer Patients in the Kyrgyz Republic
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
CIMB
Volume 45
Issue 8
10.3390/cimb45080435
cimb-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development and Evaluation of a New qPCR Assay for the Detection of Mycoplasma in Cell Cultures

by
José A. Carrillo-Ávila
*,
Amanda de la Fuente
,
Rocío Aguilar-Quesada
,
Gertrudis Ligero
,
Juan Manuel del Río-Ortiz
and
Purificación Catalina
Andalusian Public Health System Biobank, Coordinating Node, Av. del Conocimiento, S/N, 18016 Granada, Spain
*
Author to whom correspondence should be addressed.
Curr. Issues Mol. Biol. 2023, 45(8), 6903-6915; https://doi.org/10.3390/cimb45080435
Submission received: 24 July 2023 / Revised: 11 August 2023 / Accepted: 16 August 2023 / Published: 18 August 2023
(This article belongs to the Special Issue Next-Generation Sequencing (NGS) Technique and Personalized Medicine)
Browse Figures
Review Reports Versions Notes

Abstract

:
In recent years, cell culture has become an important tool not only in research laboratories, but also in diagnostic and biotechnological development laboratories. Mycoplasma contamination is present in up to 35% of cell cultures used in research and in cell therapies. This fact represents a significant problem since such contamination can cause disastrous effects on eukaryotic cells by altering their cellular parameters, which, in turn, can lead to unreliable experimental results. For this reason, it is mandatory to carry out continuous testing for the presence of Mycoplasma in cell culture and the development of appropriate methodologies for this purpose. An ideal detection methodology should be fast, sensitive, and reliable. In this study, we propose an alternative detection method based on real-time PCR in conjunction with a novel combination of primers and probes that have been improved to increase their efficiency. The new PCR method demonstrates 100% sensitivity and specificity results in the detection of common Mycoplasma species that contaminate cell cultures. Whilst 11 of 45 tested supernatants were positive for Mycoplasma (24.4%) using the new PCR method (corresponding to 5 of the 14 lines tested (35.71%)), only 10 of 45 supernatants showed positive results with the commercial Venor®GeM qEP and Plasmotest® kit. In addition, the new PCR method exhibits a high capacity to detect less-frequent Mycoplasma species, such as those related to the M. mycoides cluster. The use of an alternative Mycoplasma-detection method in cell culture labs can guarantee the detection of Mycoplasma contamination, especially in cases when dubious results are recorded.

1. Introduction

Animal cell cultures have become a basic, frequent, and fundamental tool not only in research laboratories, but also in diagnostic and biotechnological development laboratories [1]. In this sense, animal cell lines are used in in vitro models to investigate new therapeutic approaches against different diseases [2,3]. For this reason, it is essential that cell cultures are kept aseptic. Although different microorganisms (bacterial, fungi, yeast, or viruses) are capable of contaminating cell cultures [4], Mollicutes (or interchangeably Mycoplasma) are the fundamental cause of contamination. Despite the availability of sophisticated technology and specialisations used in manipulating cell cultures, biological contamination primarily due to Mycoplasma contamination remains a significant challenge.
Mycoplasma contamination of cell cultures was first described 50 years ago [5], and it is claimed that approximately 5–35% of current cell cultures are contaminated [6]. The Mycoplasma genus comprises microorganisms with distinctive characteristics, including high resistance to antibiotics [7], reduced metabolism, the lack of a rigid cell wall, a small size (0.3–0.8 μm), and high flexibility, so they are able to pass through common antibacterial filters (0.45 μm) [8]. These microorganisms grow slowly, even if they are in optimal conditions, and also have a long latency phase where they persist for a long time without being obvious. This is due to its limited biosynthetic capabilities and the obligatory dependence on eukaryotic cells. During this time, these microorganisms obtain nutrients both from the culture medium and from the metabolism of eukaryotic cells [7].
Mycoplasma contamination is a significant problem in animal cell lines. The impact of Mycoplasma on different cell types varies. Furthermore, the degree of cytopathogenesis also varies among different Mycoplasma species, something that, on occasion, goes unnoticed, which is the reason why respective contamination is not readily detected [8,9]. However, Mycoplasmas can extensively affect the host’s DNA, RNA, and protein metabolism, impact intracellular amino acid and available ATP levels, modify cellular surface antigens, and provoke the fragmentation of DNA and other significant chromosomal alterations [9]. This seriously impacts cell viability, gene expression, morphology, metabolism, and the growth rate of infected cells [10,11]. Consequently, scientific results based on contaminated cell cultures are unreliable and pose a significant obstacle for the pharmaceutical industry and its work on cell therapy [12,13].
The primary sources of Mycoplasma contamination are foetal bovine serum or other contaminated laboratory reagents, incorrect sample handling by laboratory personnel, and cross-contamination with other contaminated laboratory lines, for example, as a result of an exchange of cell lines between different laboratory and research groups. It is worth highlighting the importance of cell manipulation by laboratory personnel, which means that there is transfer of Mycoplasma through laboratory equipment, through culture media, sera, and reagents, in incubators, the contamination of liquid N2 in tanks in which the contaminated cells are stored, and transmission via airborne particles and aerosols. In this way, M. orale, M. fermentans, and M. horminis account for half of all infections in cell cultures and are species found physiologically in the human oropharyngeal tract [9].
Different methodologies have been developed to detect Mycoplasma in cell cultures. The World Health Organization has proposed using harmonising assays for Mycoplasma DNA detection [14]. At present, numerous methods with different sensitivities and specificities regarding Mycoplasma testing are available, including microbiological culture, direct DNA staining (Hoechst), colorimetric detection assays, and Nucleic Acid Amplification Techniques (NAT assays) [15]. Although the microbiological culture method has been considered the ‘gold standard’ for detecting viable Mycoplasma, this specific testing method is time-consuming (a minimum of 28 days) [16,17]. The most widely used and sensitive tests are NAT assays in their different variations, i.e., quantitative, semiquantitative, or qualitative assays [18,19,20].
Of the more than 200 known species of Mycoplasma, a limited number of species (namely, M. arginini, M. fermentans, M. hominis, M. hyorhinis, M. orale, M. pneumoniae, Acholeplasma laidlawii, Spiroplasma citri, and Ureaplasma) is responsible for more than 90% of instances of cell culture contamination [7,21]. However, only a few NAT-based kits are currently available [22], some of which are hard to obtain in Spain. Even still, some kits use identical protocols and only guarantee the detection of the most common species of Mycoplasma or fail to detect some common species bellow 10 CFU/mL [22]. Notwithstanding this, the need to design an alternative PCR for the specific, wide-ranging, and simultaneous detection of all common Mollicutes has been demonstrated since it has been observed that, in some cases, the primers that are used in some NAT-based kits lack specificity, whilst, in others, the sensitivity of the assay is not uniform across the analysed species [22,23,24,25,26].
The Andalusian Public Health System Biobank (BBSSPA), as a fundamental part of the National Bank of Cell Lines (BNLC), is in charge of depositing cell lines for their assignment to research projects that may require them. This deposit process includes traceability control through Short Tandem Repeat (STR) analysis, Mycoplasma contamination control, and karyotype and any other genetic analysis necessary to verify the suitability of the deposited line. Among these control processes, testing for the absence of Mycoplasma is essential to guarantee the absence of altered gene expression and cellular metabolism that could compromise future experiments. In our experience, we have observed the detection of sometimes uncertain or confusing results. The importance of successfully detecting Mycoplasma contamination in cell cultures, in conjunction with the current lack of an infallible commercial methodology that can be used to detect Mycoplasma contamination, led us to develop an alternative, highly sensitive, real-time PCR assay detection method that can be used in our laboratory and in the scientific community to assure the correct analysis of Mycoplasma contamination. The developed method is based on the selective amplification of a DNA fragment using a new and original set of universal and degenerate primers targeting the 16S rDNA region from a large selection of the Mycoplasma species genomes.

2. Materials and Methods

2.1. Supernatant Samples

A total of 14 cell lines were received in the BBSSPA between February 2018 and December 2019. These cell lines were cultivated at different passages, and a total of 45 supernatants from 14 cell lines were tested for Mycoplasma detection (Table 1). Each supernatant sample (1 mL) was recovered and stored at −80 °C until the time of testing using NAT assays.

2.2. Samples for Cell Culture Screening

The samples were processed according to Venor®GeM qEP guidelines for analysis using NAT assays. The Mycoplasma-detection process involved a simplified DNA isolation protocol that did not require an additional DNA isolation kit. For each sample, 500 μL of supernatant was transferred to a 1.5 mL tube and was incubated at 95 °C for 10 min. After a brief period of centrifugation, 2 μL of each sample was used for qPCR detection.

2.3. Standard DNA

A M. fermentans DNA standard (Promocell, Heidelberg, Germany, Cat. No. PK-CA91-0117) containing the strain NCTC 10117 was used for qPCR optimisation. The DNA was supplied at 1 × 106 copies/μL.
A collection of Mycoplasma Sensitivity Standards (Minerva Biolabs, Heidelberg, Germany, Cat. No. 102-0002) containing 10 CFU/mL was also used to assess the sensitivity and specificity of the qPCR assay. The standards contain inactive Mycoplasma DNA of 9 species: A. laidlawii, M. arginini, M. fermentans, M. gallisepticum, M. hyorhinis, M. orale, M. pneumoniae, M. synoviae, and S. citri, as well as a negative control sample. The lyophilised material was reconstituted using 1 mL of Essential 8TM DMEM/F12(Ham) (1:1) culture medium (ThermoFisher Scientific, Waltham, MA, USA, Cat. No. A1516901). After 5 min of incubation at room temperature, the samples were vortexed for 10 s. Finally, a Venor®GeM Sample Preparation Kit (Minerva Biolabs, Heidelberg, Germany, Cat. No. 56-1200) was used to purify the Mycoplasma Standards. Then, 200 µL of the standards was treated and isolated as a sample following the manufacturer’s recommendations. The sample was subsequently resuspended in 60 µL of resuspension buffer.

2.4. The Design of Primers and Probes

The study and alignment of the 16S rDNA regions of different Mycoplasma species were performed, including species known to commonly contaminate cell cultures and unusual species [7,8,10]. The targeted species included M. pneumoniae (NR_041751.1), M. gallisepticum (NR_104952), M. bovis (NR_102850), M. fermentans (NR_044666), M. synoviae (NR_044811), M. hyorhinis (NR_041845), M. orale (AY796060), M. salivarium (NR_041745), M. hominis (NR_041881), M. arginini (LC158832), Acholeplasma laidlawii (NR_07444.8), Spiroplasma citri (NR_036849), M. bovis (NR_102850.2), M. penetrans (NR_118664.1), M. urealyticum (NR_041710.1), M. buccale (AB680682.1), M. felis (U09787.1), M. dispar (AF412979.1), M. microti (AF212859.1), M. conjunctivae (U44770.1), M. canis (AF340023.1), M. hyopneumoniae (GU227406.1), and M. capricolum (DQ157864.1). In addition to these species, the 16S rDNA regions from other bacteria, including Escherichia coli (NR_024570.1), Chlamydia pneumoniae (NR_026527.1), Legionella pneumophila (NR_041742.1), and Streptococcus pneumoniae (NR_028665.1), were considered, thereby avoiding cross-reactions. A sequence alignment of the 16S rDNA regions was performed using the Unipro Ugene v38.0 software.
Due to the high number of Mycoplasma species that must be detected and the significant degree of diversity in the sequences across the different species examined for this study, only limited areas of the 16S rDNA gene can be used in the design of primers and probes that are common to most Mycoplasma species. Therefore, as proposed by Uphoff and Drexler [8], an equimolecular mixture of the six proposed forward primers was used as a forward primer, except where two of them were simplified into a single primer in anticipation of a degenerate position; specifically, we used the primer CGCCTGAGTAGTACGTWCGC instead of CGCCTGAGTAGTACGTTCGC and CGCCTGAGTAGTACGTACGC, as well as the primer TGCCTGRGTAGTACATTCGC instead of TGCCTGAGTAGTACATTCGC and TGCCTGGGTAGTACATTCGC, as proposed by Uphoff and Drexler [8]. Furthermore, we designed a new reverse primer to amplify a fragment of approximately 256 bp in length. For qPCR detection, we selected a new ‘FAM’-labelled probe (Table 2) designed based on the small region conserved in all selected Mycoplasma species and included it between the forward and reverse oligos used. All of the primers and probes were supplied by Sigma-Aldrich.
A synthetic DNA fragment (169 bp) was designed as an internal amplification control. This synthetic amplification sequence was designed to be amplified using the same forward and reverse primers employed in Mycoplasma amplification but presenting a different internal sequence. A specific HEX label probe was used for the internal control, as depicted in Figure 1. This fragment was synthesised by chemical synthesis and cloned into a pMA-T vector by the GeneArt gene synthesis service (ThermoFisher Scientific, Waltham, MA, USA), providing us with a 2543 bp plasmid.

2.5. qPCR Conditions

The optimal qPCR conditions were established to guarantee the maximum sensitivity using serial dilutions of an M. fermentans DNA standard (1 × 105 copies/μL to 1 copy/μL). Primers and probes described in the previous section were tested using a TaqMan Fast Advanced Master Mix (ThermoFisher Scientific, Waltham, MA, USA, Ref: A44260) in a QuanStudio-6 thermocycler (ThermoFisher Scientific, Waltham, MA, USA). Different final primer concentrations for Mycoplasma (250, 500, 750, and 1000 nM) were tested for the sep-up of the assay. In the same way, five probe concentrations for Mycoplasma and for the internal control (Myco-S1 Probe and Myco-IC-S1 Probe, respectively) (62.5, 93.75, 125, 187.5, and 250 nM) were tested. In addition, different dilutions of the internal control, between 1 × 10−4 and 1 × 10−9 copies/μL, were tested to guarantee correct detection without compromising the efficiency of the test.
Finally, after qPCR optimisation, each PCR reaction was prepared in a final volume of 20 μL, containing 10 μL TaqMan Fast Advanced Master Mix (2×), 1 μL of 10 μM primers (U&D-F (Myco U&D-F1, Myco U&D-F2, Myco U&D-F3, and Myco U&D-F4) and Myco-R5) (final concentration of 500 nM), 0.75 μL of 5 μM Myco-S1-Probe (final concentration of 187.5 nM), 0.375 μL of 5 μM Myco-IC-S1-Probe (final concentration of 93.75 nM), 1 μL of an internal control plasmid (1 × 10−6 ng/μL), and 4.875 μL of water. Finally, 2 μL of the sample was added. For the PCR program, a 20 s initial denaturation was used, followed by 45 cycles with 1 s at 95 °C and 20 s at 60 °C for annealing and extension, following the manufacturer’s recommendations. Fluorescent readings were performed for FAM and HEX fluorochromes.

2.6. qPCR Mycoplasma Detection with a Venor®GeM qEP Kit

A Venor®GeM qEP (Minerva Biolabs, Berlín, Germany, Ref: 11-9100) kit was used for Mycoplasma detection following the manufacturer’s instructions. The kit is designed to provide positive tests for A. laidlawii, M. hyorhinis, M. fermentans, M. orale, M. synoviae, M. pneumoniae, M. arginini, M. gallisepticum, S. citri, M. arthritidis, M. genitalium, M. hominis, M. penetrans, M. salivarium, and Ureaplasma urealyticum. Two microlitres of pre-treated supernatant was used in a 25 μL final PCR volume following the PCR program, as recommended by the manufacturer. Using a QuanStudio-6 Thermocycler, FAM and HEX wavelengths were employed for Mycoplasma detection and internal control detection, respectively.

2.7. Purification of Amplified Bands

The amplified fragments were separated in a 2% agarose gel at 60 V. Specific Mycoplasma bands (≈256 bp) were extracted from the agarose and purified with Buffer QG (Qiagen, Hilden, Germany, Ref: 19063) and a QIAquick PCR purification kit (Qiagen, Hilden, Germany, Ref: 28104) according to the manufacturer´s instructions. The amplicons were resuspended in 30 μL of Buffer EB and quantified (A260) using a Nanodrop EP spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA).

2.8. DNA Sequencing

The purified 16S rDNA fragments were used in sequencing reactions with a BigDye Terminator v3.2 Cycle Sequencing kit (Applied Biosystems, Waltham, MA, USA, Ref: 4336917) using a Seq Studio Genetic Analyzer (Applied Biosystems, Waltham, MA, USA). The sequencing reactions were prepared in a final volume of 10 μL, with 20 ng of DNA, 3.2 pmol of the forward or reverse PCR primers (Table 2), and 4 μL of BigDye Terminator 3.1 Ready Reaction Mix. An equimolecular mix of Myco U&D-F1, F2, F3, and F4 was used as a forward primer, with Myco-R5 as a reverse primer. The sequencing reaction was performed using a thermocycler (Eppendorf EP gradient S, Hamburg, Germany) with an initial incubation step at 96 °C for 1′ and 25 cycles (96 °C for 10″, 50 °C for 10″, and 60 °C for 4′). The reactions were subsequently purified with a BigDye XTerminator Purification Kit (Applied Biosystems, Waltham, MA, USA, Ref: 4376484) following the manufacturer’s instructions and sequenced via capillary electrophoresis using a SeqStudio Genetic Analyzer Cartridge (Applied Biosystems, Waltham, MA, USA, Ref: A32656) and Plate Manager software v1.1 (Applied Biosystems, Waltham, MA, USA). The_BigDye Terminator v3.1 dye set and MediumSeq run module were selected for sequencing the samples in the Plate Manager software v1.1.

2.9. Sequence Assembly and Clustering

The homology of the 16S rDNA sequences was checked using the Nucleotide BLASTn database (from the Nucleotide BLAST, National Center for Biotechnology Information) to compare the sequenced 16S rDNA with other 16S ribosomal RNA sequences available in the rRNA/ITS databases.

2.10. Mycoplasma Detection with Plasmotest®

The Plasmotest® kit (InvivoGen, San Diego, CA, USA, Rep-pt1) allows for the specific detection of Mycoplasma lipopeptides, which can interact with TLR2 receptors on HEK-BlueTM-2 cells. The activation of the signalling cascade leads to the secretion of alkaline phosphatase, which is detected via colorimetry thanks to the HEK-BlueTM detection medium that presents a purple/blue hue in the presence of alkaline phosphatase. Cells should be used two days after passage and before reaching 80% confluency. Culture flasks for each cell line were used for Plasmotest testing. The testing protocol was performed according to the manufacturer’s recommendations, and the test results were interpreted after a 24 h incubation period at 37 °C. The kit used in the test included negative and positive controls.

2.11. Controls Used in the Study

The following controls were used for study validation:
-
Venor®GeM qEP includes a positive control in the kit that was used as an additional sample. Ultrapure water included in the kit was added as a negative control.
-
A M. fermentans DNA standard containing 1 × 102 copies of strain NCTC 10117 was used as the new qPCR assay positive control. Ultrapure water was added as a negative control.
-
1/10 dilutions of the negative and positive controls included in the Plasmotest® kit were used as controls and treated as any other sample.

3. Results

3.1. Mycoplasma qPCR Development

In this study, we conducted a validation test of a novel qPCR technique for the specific detection of a large number of Mycoplasma species. This was achieved by using 16S ribosomal RNA sequences available in rRNA/ITS databases. The PCR conditions were fine-tuned to ensure optimal detection and included the use of quantified M. fermentans DNA standard dilutions in triplicate. The inclusion and optimisation of an internal amplification control were thus achieved without compromising the sensitivity of the PCR reaction, thereby ensuring the efficiency of the PCR reaction.
Once the PCR conditions were established, the sensitivity of the qPCR was assessed by means of 10 CFU of lyophilised standards resuspended in 1 mL of Essential 8TM DMEM/F12(Ham) (1:1) culture medium. Following isolation, 2 µL was used for qPCR, and the assays were performed in triplicate. All of the samples were detected via qPCR, and negative and positive controls validated the results that we obtained, as detailed in Table 3.

3.2. Comparative Analysis of Detection Methods

To evaluate the new PCR technique, we performed a comparative analysis of Mycoplasma detection methods based on 14 different cell line supernatants of different origins at different passages (see Table 1). A total of 45 culture supernatants were used for Mycoplasma detection, including the new qPCR technique (being tested), a commercial Venor®GeM qEP kit, and a culture flask of each cell line at the same passage for Plasmotest testing. Positive results were obtained for 11 supernatants from five different cell lines (cell lines 5, 6, 7, 8, and 13). Eleven samples tested positive for Mycoplasma with the qPCR optimised in this study, while only 10 positive samples were detected with Venor®GeM qEP and Plasmotest kits. Neither the Venor®GeM qEP kit nor the Plasmotest kit detected one of the samples tested for cell line 5, although at different passages, the Venor®GeM qEP kit did not detect Sample 42, and the Plasmotest kit did not detect Sample 43 (Table 1). It is important to note that Samples 14, 17, and 18 from cell lines 5 and 6 showed 3 to 10 positive results with the Venor®GeM qEP kit, despite not exhibiting clear and exponential amplification, as specified in the kit’s guidelines (Figure 2).
The 11 samples that tested positive were sequenced. Their accession numbers are indicated in Table 1. Using the BLASTn database, we detected that one of the samples (Sample 15) presented 100% homology with M. hyorhinis. The other 10 samples showed identical sequences, and the most significant homologies (>99%) were detected with Mycoplasma sp. related to the M. mycoides cluster (M. cottewii and M. yeatsii). The complete 16S rDNA sequence was also sequenced to authenticate Mycoplasma identification (Accession number OP364020) [27].

4. Discussion

Mycoplasma contamination is a significant issue in cell cultures, and therefore, it is essential to have a precise, efficient, sensitive, and rapid diagnostic method for the detection of Mycoplasma contamination in laboratories that work with cell cultures [1]. The presence of Mycoplasma in cell culture alters cell growth and metabolism, producing alterations in DNA, the altered expression of surface antigens and cytokines, and causes changes in cell morphology, among many other consequences. These alterations mean that the results derived from the use of these cells are not credible or reproducible, which entails serious consequences in research and in the pharmaceutical industry [13]. As a result, most academic journals require that the research they publish certify that the study was conducted using Mycoplasma-free cell lines. Furthermore, the sterility of a cell line culture must be demonstrated to be deposited in a cell line bank [2,15,28].
Real-time PCR assays have gained importance in recent years for their role in detecting conserved sequences of Mycoplasma [1,8,10]. Due to the large number of existing Mycoplasma species and their genetic variability, developing a unique and infallible system for detecting Mycoplasma in cell culture is challenging. Although several commercial kits are available, most of them cannot be used for real-time PCR, and many of the available qPCR kits do not enjoy worldwide distribution. It is also important to consider that specific recommended protocols, such as PCR amplification programs and stated amplification sizes, are identical across different kits. These peculiarities lead us to infer that the primers used in many of these testing kits (and (potentially) the manufacturer of these kits) are the same, thus resulting in their shared strengths and weaknesses. It is also important to mention that manufacturers do not disclose what primers are used in their protocols, thereby rendering it impossible for researchers to elucidate the underlying reason(s) for discrepant test results. The documentation that accompanies the different kits includes (i) diverse sensitivity and specificity specifications and (ii) claims regarding the detection of the presence of a highly variable number of Mycoplasma species. Given this scenario, in combination with our experience in the detection of unclear positives with existing commercial methodologies, we have developed a new qPCR technique as an alternative Mycoplasma contamination detection system. The internal control that is integrated into the reaction in our detection system ensures the integrity of the qPCR and the detection of inhibitory agents. We claim that this technique is a valuable option for the scientific community and quality control laboratories for testing cell culture supernatants and resolving ambiguous or discrepant cases of Mycoplasma contamination.
Similar to other PCR methodologies, the new PCR methodology evaluated in this study is based on the 16S ribosomal gene of a cohort of Mycoplasma and Ureoplasma species, owing to this gene’s high degree of conservation in specific regions. Our findings regarding this new methodology corroborate its optimal sensitivity regarding the detection of the nine species that were tested, which are responsible for 98% of Mycoplasma contaminations, but also include atypical species related to the M. mycoides cluster, as previously validated through sequencing [7,27,29]. It is important to note that claims concerning the sensitivity of Mycoplasma detection assays are regulated by the European Pharmacopoeia, Section 2.6.7 [26]. As stated in this document, a sensitivity of 10 CFU/mL is required if a PCR assay is to be used for the detection of Mycoplasma. Our experiment detected a minimum of 10 CFU/mL for the nine species tested, with Cq values between 29.4 for S. citri and 36.74 for M. pneumoniae and M. arginini. Other PCR tests have been previously evaluated and proven to be sensitive to at least 10 CFU/mL for detecting Mycoplasma in culture supernatants [30], while the sensitivity of other published assays has been comparatively lower [22,31,32].
In this study, we analysed 45 supernatants from 14 cell lines at different passages. The new PCR developed in this study revealed that 11 out of these 45 supernatants tested positive for Mycoplasma (24.4%), although only 5 of the 14 cell lines tested positive (35.71%) positive. These positivity values are consistent with values reported in the literature [6]. Two Mycoplasma species were detected in the cell cultures through sequencing, namely M. hyorninis in one sample and a Mycoplasma sp. related to the M. mycoides cluster in 10 different samples. While M. hyorninis is a typical contaminant in cell cultures [7,21], the Mycoplasma sp. related to the M. mycoides cluster is usually found in infected cattle and small ruminants [33]. Previous studies have identified these microorganisms in the ear canal of goats and have reported on their presence in bovine milk and bovine lung tissue [34,35]. The contamination of cell cultures with Mycoplasma sp. related to the M. mycoides cluster has only been described twice previously [36,37]. Sequencing revealed that the species were identical in the 10 supernatants. Since they correspond to four cell lines from the same laboratory, we infer a common source of contamination, probably associated with the use of contaminated foetal bovine serum during cell line culture [36]. The complete 16S ribosomal DNA sequence cited in this study has been fully sequenced and is described in Carrillo-Avila et al. [27].
For the evaluation of the results, we have considered as true positives, those samples with a positive result based on at least two of the methodologies used. The novel PCR assay showed a congruence of 97.7% with the Venor®GeM qEP PCR test and the Plasmotest colorimetric test. Comparing the results of the novel PCR test with the colorimetric assay, we observed a false negative outcome for Sample 43 (cell line 5) using the Plasmotest kit. This false negative could be due to the inadequate growth of this cell culture since the confluence of this cell culture was less than optimal (i.e., <80%). The growth difficulty experienced with this cell line has been reported on by other authors [32]. Thus, determining the optimal growth conditions and confluence may pose a limitation for Mycoplasma detection using the colorimetric assay in the Plasmotest kit. A lack of specificity has also been described as a limitation of this colorimetric test since it can produce results for other bacteria and yeasts [38]. Nonetheless, colorimetric kits are widely accepted as an appropriate alternative tool for verifying test results [39], particularly in laboratories where routine PCR assays cannot be performed.
However, we note that 22.2% (10 out of 45) of the supernatants tested in this study indicated positivity for Mycoplasma using the Venor®GeM qEP PCR assay. This corresponds to 35.71% (5 out of 17) of the tested cell lines. The findings of this study are consistent with the results obtained using the newly developed PCR assay, except for Sample 42 (cell line 5), which tested negative with the Venor®GeM qEP PCR assay. Nonetheless, this sample tested positive using the new PCR test, and sequencing analysis revealed the presence of a Mycoplasma sp. related to the M. mycoides cluster that is similar to the other supernatants from cell line 5. Sample 42 also tested positive using the colorimetric assay, indicating that the negative result obtained with the Venor®GeM qEP PCR test was, in all probability, a false negative. This result may be due to the lower sensitivity of the Venor®GeM qEP PCR test with regards to Mycoplasma sp. related to the M. mycoides cluster. Notably, the amplification of Mycoplasma sp. in Sample 42 using the new PCR technique occurred at a higher cycle of Ct (31.87), thereby indicating a lower concentration of Mycoplasma in this particular sample. This decrease in sensitivity is also consistent with the non-exponential amplification observed for Samples 14, 17, and 18 from cell lines 5 and 6 using the Venor®GeM qEP kit, despite being considered ‘positive’ according to the kit’s specifications. Results compatible with those exposed have been previously observed by other authors, since different commercial NAT assays are frequently not capable of detecting some species of Mycoplasma at the <10 CFU/mL required in the European and Japanese pharmacopeias. Even some methods are not able to detect frequent Mycoplasmas, like M. orale and M. synoviae, and other Mycoplasmas, like M. ixodetis. These facts have led to the suggestion of the need to develop species-specific assays to supplement the deficiencies observed with commercial platforms [22].
If we take into account the premise of considering as true positives, those samples with a positive result based on at least two of the methodologies used, we can conclude a 100% sensitivity and specificity for the new PCR assay. The test is even able to detect a minimum of 10 CFU/mL for the nine species regulated by the European Pharmacopoeia, Section 2.6.7 [26]. However, an important limitation of our study is that broad-range sensitive detection cannot be guaranteed because only a limited number of known Mycoplasma species have been tested. It is even necessary to assay a large number of cell culture samples to have more robust sensitivity and specificity data.

5. Conclusions

The peculiarities of the Mycoplasma genus pose a significant challenge to the development of an infallible method for its detection. The occasional manifestation of inconclusive NAT outcomes and/or the requirement to perform a confirmation test (to confirm one’s test results) in conjunction with the enormous degree of heterogeneity in existing Mycoplasma species, the emergence of novel mutations as a consequence of natural evolution, and the ability of these species (including unusual species) to infect cell cultures indicate that the continuous evaluation and adjustment of diagnostic systems is necessary. The proposed new PCR assay for Mycoplasma detection was able to detect the minimum of 10 CFU/mL for the nine species regulated by the European Pharmacopoeia, Section 2.6.7 [40], in addition to showing 100% sensitivity with the 45 supernatant samples from 14 different cell lines. According to the good results obtained, the clinical significance of the new PCR assay is highest with the species and samples analysed. Despite the routine use of a commercial method for Mycoplasma detection, implementing an alternative Mycoplasma detection technique in cell culture laboratories is a step towards guaranteeing the detection of Mycoplasma contamination, particularly contamination by unusual species or in difficult samples that contain a low bacterium titre.

Author Contributions

Conceptualization, J.A.C.-Á., R.A.-Q. and P.C.; Methodology, A.d.l.F., G.L. and J.M.d.R.-O.; Validation, J.A.C.-Á.; Investigation, J.A.C.-Á., A.d.l.F., G.L. and J.M.d.R.-O.; Writing—original draft, J.A.C.-Á., R.A.-Q. and P.C.; Writing—review & editing, J.A.C.-Á. and A.d.l.F.; Visualization, J.A.C.-Á.; Supervision, J.A.C.-Á. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Consejería de Salud y Consumo, Junta de Andalucía, by the ISCIII Platform Biobans and Biomodels (PT20/00065).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The Mycoplasma sequences described in this study are available in the National Center for Biotechnology Information (NCBI) database under access numbers OP626179-89. The datasets generated and/or analysed during this study are available from the corresponding author on request.

Acknowledgments

We would like to thank Susana Alonso Fernández for her administrative assistance during the processing of the reagents used in this study and her work in the publication of the study’s results.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Soheily, Z.; Soleimani, M.; Majidzadeh-Ardebili, K. Detection of Mycoplasma Contamination of Cell Culture by A Loop-Mediated Isothermal Amplification Method. Cell J. 2019, 21, 43–48. [Google Scholar] [CrossRef] [PubMed]
  2. Corral-Vazquez, C.; Aguilar-Quesada, R.; Catalina, P.; Lucena-Aguilar, G.; Ligero, G.; Miranda, B.; Carrillo-Avila, J.A. Cell lines authentication and mycoplasma detection as minimun quality control of cell lines in biobanking. Cell Tissue Bank. 2017, 18, 271–280. [Google Scholar] [CrossRef] [PubMed]
  3. Shannon, M.; Capes-Davis, A.; Eggington, E.; Georghiou, R.; Huschtscha, L.I.; Moy, E.; Power, M.; Reddel, R.R.; Arthur, J.W. Is cell culture a risky business? Risk analysis based on scientist survey data. Int. J. Cancer 2016, 138, 664–670. [Google Scholar] [CrossRef] [PubMed]
  4. Weiskirchen, S.; Schroder, S.K.; Buhl, E.M.; Weiskirchen, R. A Beginner’s Guide to Cell Culture: Practical Advice for Preventing Needless Problems. Cells 2023, 12, 682. [Google Scholar] [CrossRef]
  5. Stanbridge, E. Mycoplasmas and cell cultures. Bacteriol. Rev. 1971, 35, 206–227. [Google Scholar] [CrossRef]
  6. Young, L.; Sung, J.; Stacey, G.; Masters, J.R. Detection of Mycoplasma in cell cultures. Nat. Protoc. 2010, 5, 929–934. [Google Scholar] [CrossRef]
  7. Uphoff, C.C.; Drexler, H.G. Detection of Mycoplasma contamination in cell cultures. Curr. Protoc. Mol. Biol. 2014, 106, 28.4.1–28.4.14. [Google Scholar] [CrossRef]
  8. Uphoff, C.C.; Drexler, H.G. Comparative PCR analysis for detection of mycoplasma infections in continuous cell lines. In Vitro Cell Dev. Biol. Anim. 2002, 38, 79–85. [Google Scholar] [CrossRef]
  9. Nikfarjam, L.; Farzaneh, P. Prevention and detection of Mycoplasma contamination in cell culture. Cell J. 2012, 13, 203–212. [Google Scholar]
  10. Pisal, R.V.; Hrebikova, H.; Chvatalova, J.; Kunke, D.; Filip, S.; Mokry, J. Detection of Mycoplasma Contamination Directly from Culture Supernatant Using Polymerase Chain Reaction. Folia Biol. 2016, 62, 203–206. [Google Scholar]
  11. Nübling, C.M.; Baylis, S.A.; Hanschmann, K.M.; Montag-Lessing, T.; Chudy, M.; Kreß, J.; Ulrych, U.; Czurda, S.; Rosengarten, R. World Health Organization International Standard to Harmonize Assays for Detection of Mycoplasma DNA. Appl. Environ. Microbiol. 2015, 81, 5694–5702. [Google Scholar] [CrossRef]
  12. Armstrong, S.E.; Mariano, J.A.; Lundin, D.J. The scope of mycoplasma contamination within the biopharmaceutical industry. Biologicals 2010, 38, 211–213. [Google Scholar] [CrossRef] [PubMed]
  13. Volokhov, D.V.; Norris, T.; Rios, C.; Davidson, M.K.; Messick, J.B.; Gulland, F.M.; Chizhikov, V.E. Novel hemotrophic mycoplasma identified in naturally infected California sea lions (Zalophus californianus). Vet. Microbiol. 2011, 149, 262–268. [Google Scholar] [CrossRef] [PubMed]
  14. WHO (Ed.) Sixty-fourth report. In Expert Committee on Biological Standardization; WHO Tech Rep Ser; WHO: Geneva, Switzerland, 2014. [Google Scholar]
  15. Geraghty, R.J.; Capes-Davis, A.; Davis, J.M.; Downward, J.; Freshney, R.I.; Knezevic, I.; Lovell-Badge, R.; Masters, J.R.; Meredith, J.; Stacey, G.N.; et al. Guidelines for the use of cell lines in biomedical research. Br. J. Cancer 2014, 111, 1021–1046. [Google Scholar] [CrossRef]
  16. Duke, P.S.; Landgraf, W.; Mitamura, A.E.; Demopoulos, H.B. Study of S91 mouse melanomas by electron paramagnetic resonance spectroscopy and tissue culture. I. The effect of cysteine on blue light signals and on growth in vitro. J. Natl. Cancer Inst. 1966, 37, 191–198. [Google Scholar]
  17. Pharmaceuticals and Medical Devices Agency. Japanese Pharmacopoeia, 18th ed.; Pharmaceuticals and Medical Devices Agency: Tokyo, Japan, 2021. [Google Scholar]
  18. Sheppard, S.K.; Dallas, J.F.; MacRae, M.; McCarthy, N.D.; Sproston, E.L.; Gormley, F.J.; Strachan, N.J.; Ogden, I.D.; Maiden, M.C.; Forbes, K.J. Campylobacter genotypes from food animals, environmental sources and clinical disease in Scotland 2005/6. Int. J. Food Microbiol. 2009, 134, 96–103. [Google Scholar] [CrossRef]
  19. Vega-Orellana, O.; Poveda, J.B.; Rosales, R.S.; Bradbury, J.M.; Poveda, C.G.; Mederos-Iriarte, L.E.; Tavio, M.M.; Ramirez, A.S. Comparison of different NAT assays for the detection of microorganisms belonging to the class Mollicutes. BMC Vet. Res. 2017, 13, 195. [Google Scholar] [CrossRef] [PubMed]
  20. Dreolini, L.; Cullen, M.; Yung, E.; Laird, L.; Webb, J.R.; Nelson, B.H.; Hay, K.A.; Balasundaram, M.; Kekre, N.; Holt, R.A. A Rapid and Sensitive Nucleic Acid Amplification Technique for Mycoplasma Screening of Cell Therapy Products. Mol. Ther. Methods Clin. Dev. 2020, 17, 393–399. [Google Scholar] [CrossRef]
  21. Kong, F.; James, G.; Gordon, S.; Zelynski, A.; Gilbert, G.L. Species-specific PCR for identification of common contaminant mollicutes in cell culture. Appl. Environ. Microbiol. 2001, 67, 3195–3200. [Google Scholar] [CrossRef]
  22. Totten, A.H.; Adams, A.J.; Halas, H.K.; Gebo, J.E.T.; East, A.D.; Lau, A.F. Comparison of Five Commercial Molecular Assays for Mycoplasma Testing of Cellular Therapy Products. J. Clin. Microbiol. 2023, 61, e0149822. [Google Scholar] [CrossRef]
  23. Asarnow, D.; Warford, A.; Fernandez, L.; Hom, J.; Sandhu, G.; Candichoy, Z.; Luna, G.; Goldman, M.; Rarich, R. Validation and international regulatory experience for a mycoplasma touchdown PCR assay. Biologicals 2010, 38, 224–231. [Google Scholar] [CrossRef] [PubMed]
  24. Salling, H.K.; Bang-Christensen, S.R. Multi-primer qPCR assay capable of highly efficient and specific detection of the vast majority of all known Mycoplasma. Biologicals 2016, 44, 129–138. [Google Scholar] [CrossRef] [PubMed]
  25. Stormer, M.; Vollmer, T.; Henrich, B.; Kleesiek, K.; Dreier, J. Broad-range real-time PCR assay for the rapid identification of cell-line contaminants and clinically important mollicute species. Int. J. Med. Microbiol. 2009, 299, 291–300. [Google Scholar] [CrossRef] [PubMed]
  26. Zhi, Y.; Mayhew, A.; Seng, N.; Takle, G.B. Validation of a PCR method for the detection of mycoplasmas according to European Pharmacopoeia section 2.6.7. Biologicals 2010, 38, 232–237. [Google Scholar] [CrossRef]
  27. Carrillo-Avila, J.A.; Aguilar-Quesada, R.; Ligero, G.; Panadero-Fajardo, S.; Santos-Pirez, M.V.; Catalina, P. Identification of cell culture contamination by an unusual species of Mycoplasma related to the M. mycoides cluster. Cytotechnology 2023, 75, 135–141. [Google Scholar] [CrossRef]
  28. Molla Kazemiha, V.; Bonakdar, S.; Amanzadeh, A.; Azari, S.; Memarnejadian, A.; Shahbazi, S.; Shokrgozar, M.A.; Mahdian, R. Real-time PCR assay is superior to other methods for the detection of mycoplasma contamination in the cell lines of the National Cell Bank of Iran. Cytotechnology 2016, 68, 1063–1080. [Google Scholar] [CrossRef]
  29. Peredeltchouk, M.; David, S.A.; Bhattacharya, B.; Volokhov, D.V.; Chizhikov, V. Detection of mycoplasma contamination in cell substrates using reverse transcription-PCR assays. J. Appl. Microbiol. 2011, 110, 54–60. [Google Scholar] [CrossRef]
  30. Mathews, S.; Rabani, R.; Rasti, M.; Viswanathan, S. In-house abbreviated qualification of a real-time polymerase chain reaction method and strategies to amplify mycoplasma detection in human mesenchymal stromal cells. Cytotherapy 2021, 23, 1036–1044. [Google Scholar] [CrossRef]
  31. Janetzko, K.; Rink, G.; Hecker, A.; Bieback, K.; Kluter, H.; Bugert, P. A single-tube real-time PCR assay for Mycoplasma detection as a routine quality control of cell therapeutics. Transfus. Med. Hemother 2014, 41, 83–89. [Google Scholar] [CrossRef]
  32. Jean, A.; Tardy, F.; Allatif, O.; Grosjean, I.; Blanquier, B.; Gerlier, D. Assessing mycoplasma contamination of cell cultures by qPCR using a set of universal primer pairs targeting a 1.5 kb fragment of 16S rRNA genes. PLoS ONE 2017, 12, e0172358. [Google Scholar] [CrossRef]
  33. DaMassa, A.J.; Tully, J.G.; Rose, D.L.; Pitcher, D.; Leach, R.H.; Cottew, G.S. Mycoplasma auris sp. nov., Mycoplasma cottewii sp. nov., and Mycoplasma yeatsii sp. nov., new sterol-requiring mollicutes from the external ear canals of goats. Int. J. Syst. Bacteriol. 1994, 44, 479–484. [Google Scholar] [CrossRef] [PubMed]
  34. Boonyayatra, S.; Fox, L.K.; Gay, J.M.; Sawant, A.; Besser, T.E. Discrimination between Mycoplasma and Acholeplasma species of bovine origin using digitonin disc diffusion assay, nisin disc diffusion assay, and conventional polymerase chain reaction. J. Vet. Diagn. Investig. 2012, 24, 7–13. [Google Scholar] [CrossRef] [PubMed]
  35. Jimena, O.N.; Laura, J.M.; Elena, M.M.; Alonso, N.H.; Teresa, Q.M. Association of Raillietia caprae with the presence of Mycoplasmas in the external ear canal of goats. Prev. Vet. Med. 2009, 92, 150–153. [Google Scholar] [CrossRef] [PubMed]
  36. Calcutt, M.J.; Szikriszt, B.; Poti, A.; Molnar, J.; Gervai, J.Z.; Tusnady, G.E.; Foecking, M.F.; Szuts, D. Genome Sequence Analysis of Mycoplasma sp. HU2014, Isolated from Tissue Culture. Genome Announc. 2015, 3, e01086-15. [Google Scholar] [CrossRef] [PubMed]
  37. Del Giudice, R.A. M-CMRL, a new axenic medium to replace indicator cell cultures for the isolation of all strains of Mycoplasma hyorhinis. In Vitro Cell Dev. Biol. Anim. 1998, 34, 88–89. [Google Scholar] [CrossRef] [PubMed]
  38. Huang, L.Y.; Dumontelle, J.L.; Zolodz, M.; Deora, A.; Mozier, N.M.; Golding, B. Use of toll-like receptor assays to detect and identify microbial contaminants in biological products. J. Clin. Microbiol. 2009, 47, 3427–3434. [Google Scholar] [CrossRef] [PubMed]
  39. Boslett, B.; Nag, S.; Resnick, A. Detection and antibiotic treatment of Mycoplasma arginini contamination in a mouse epithelial cell line restore normal cell physiology. BioMed Res. Int. 2014, 2014, 532105. [Google Scholar] [CrossRef]
  40. Section 2.6.7. Mycoplasmas. In European Pharmacopoeia, 10th ed.; 10/2020; Council of Europe: Strasbourg, France, 2020.
Cimb 45 00435 g001
Figure 1. The synthetic DNA fragment used as an internal control. The locations of the primers for the PCR are underlined. The location of the internal probe is shaded.
Figure 1. The synthetic DNA fragment used as an internal control. The locations of the primers for the PCR are underlined. The location of the internal probe is shaded.
Cimb 45 00435 g001
Cimb 45 00435 g002
Figure 2. Amplification curves for Samples 14, 17, and 18 with (a) the Venor®GeM qEP kit and (b) this study’s qPCR. The x-axis indicates the number of RT-PCR cycles. The y-axis indicates the delta ΔRn, defined as the magnitude of the signal generated using the determined set of PCR conditions (the ΔRn value is the Rn value of an experimental reaction minus the Rn value of the baseline signal generated by the instrument).
Figure 2. Amplification curves for Samples 14, 17, and 18 with (a) the Venor®GeM qEP kit and (b) this study’s qPCR. The x-axis indicates the number of RT-PCR cycles. The y-axis indicates the delta ΔRn, defined as the magnitude of the signal generated using the determined set of PCR conditions (the ΔRn value is the Rn value of an experimental reaction minus the Rn value of the baseline signal generated by the instrument).
Cimb 45 00435 g002
Table 1. An overview of the cell lines tested, including the cell origin, passage information, and the results obtained through the present study’s qPCR, Venor®GeM qEP, and Plasmotest. Ct values are indicated in brackets for positives samples. The sequencing results and accession numbers are provided. Observed discrepancies are highlighted in orange.
Table 1. An overview of the cell lines tested, including the cell origin, passage information, and the results obtained through the present study’s qPCR, Venor®GeM qEP, and Plasmotest. Ct values are indicated in brackets for positives samples. The sequencing results and accession numbers are provided. Observed discrepancies are highlighted in orange.
SampleCell LinePassageCell OriginThis Study qPCRVenor®GeM qEPPlasmoTest®Sequencing ResultsAccession Number
1Cell line 15Mesenchymal fat cells
36
47
58
610
2Cell line 24Umbilical cord mesenchymal cells
7Cell line 315Umbilical cord mesenchymal cells
820
9Cell line 410Umbilical cord mesenchymal cells
1012
1115
1217
42Cell line 520iPSCsP (29.19)NegativeP≈M. mycoides clusterOP626186
4321P (31.82)P (31.87)Negative≈M. mycoides clusterOP626187
1727P (28)P (33.02)P≈M. mycoides clusterOP626181
1329
14Cell line 618iPSCsP (27.94)P (29.9)P≈M. mycoides clusterOP626179
1819P (26.84)P (30.61)P≈M. mycoides clusterOP626182
4420P (28)P (28.87)P≈M. mycoides clusterOP626188
4521P (27.8)P (29.51)P≈M. mycoides clusterOP626189
15Cell line 718iPSCsP (33.91)P (34.48)PM. hyorhinisOP626180
1921
16Cell line 87iPSCsP (25.9)P (26.24)P≈M. mycoides clusterOP626183
3212
3713
4014
4115
20Cell line 910HEK-2 cells
21Cell line 1023Colon tumoral cells
22Cell line 1147hESCs
2349
2450
2551
2677
2779
28Cell line 1223Colon tumoral cells
2924
3025
3126
33Cell line 1344iPSCs
3846P (28.81)P (28.53)P≈M. mycoides clusterOP626184
3947P (28.02)P (26.66)P≈M. mycoides clusterOP626185
34Cell line 145Skin fibroblast cells
356
368
Table 2. Primers and probes used in the real-time PCR analysis described in this study.
Table 2. Primers and probes used in the real-time PCR analysis described in this study.
Primer NameSequence (5′→3′)ReferenceUtility
Myco U&D-F1CGCCTGAGTAGTACGTWCGC[8]PCR Forward [8]
Myco U&D-F2TGCCTGRGTAGTACATTCGC[8]
Myco U&D-F3CRCCTGAGTAGTATGCTCGC[8]
Myco U&D-F4CGCCTGGGTAGTACATTCGC[8]
Myco-R5GCTCGTTRCRGGACTTRACCThis studyPCR Reverse
Myco-S1 Probe[6FAM]GGAATTGACGGGRMYCCGCAC[BHQ1]This studyMycoplasma Probe
Myco-IC-S1 Probe[HEX]AGTAGTGTGTGCCCGTCTGT[BHQ1]This studyInternal Control Probe
Table 3. Amplification Cq and Cq standard deviations for standard control detection: A. laidlawii, M. arginini, M. fermentans, M. gallisepticum, M. hyorhinis, M. orale, M. pneumoniae, M. synoviae, S. citri, and an isolation negative control (C-Standard). PCR negative and positive controls are included.
Table 3. Amplification Cq and Cq standard deviations for standard control detection: A. laidlawii, M. arginini, M. fermentans, M. gallisepticum, M. hyorhinis, M. orale, M. pneumoniae, M. synoviae, S. citri, and an isolation negative control (C-Standard). PCR negative and positive controls are included.
SampleCqCq Std. Dev.
A. laidlawii36.18±0.51
M. arginini36.74±1.34
M. fermentans36.16±0.21
M. gallisepticum36.59±0.59
M. hyorhinis36.15±0.47
M. orale35.96±0.97
M. pneumoniae36.74±1.23
M. synoviae36.21±0.07
S. citri29.4±0.21
C-Standard
C−
C+30.06±1.08
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Carrillo-Ávila, J.A.; de la Fuente, A.; Aguilar-Quesada, R.; Ligero, G.; del Río-Ortiz, J.M.; Catalina, P. Development and Evaluation of a New qPCR Assay for the Detection of Mycoplasma in Cell Cultures. Curr. Issues Mol. Biol. 2023, 45, 6903-6915. https://doi.org/10.3390/cimb45080435

AMA Style

Carrillo-Ávila JA, de la Fuente A, Aguilar-Quesada R, Ligero G, del Río-Ortiz JM, Catalina P. Development and Evaluation of a New qPCR Assay for the Detection of Mycoplasma in Cell Cultures. Current Issues in Molecular Biology. 2023; 45(8):6903-6915. https://doi.org/10.3390/cimb45080435

Chicago/Turabian Style

Carrillo-Ávila, José A., Amanda de la Fuente, Rocío Aguilar-Quesada, Gertrudis Ligero, Juan Manuel del Río-Ortiz, and Purificación Catalina. 2023. "Development and Evaluation of a New qPCR Assay for the Detection of Mycoplasma in Cell Cultures" Current Issues in Molecular Biology 45, no. 8: 6903-6915. https://doi.org/10.3390/cimb45080435

Article Metrics

Back to TopTop