Next Article in Journal
Vulnerability of the Small-Scale Fishery to Climate Changes in the Northern-Central Adriatic Sea (Mediterranean Sea)
Previous Article in Journal
Effects of Dietary Blend of Algae Extract Supplementation on Growth, Biochemical, Haemato-Immunological Response, and Immune Gene Expression in Labeo rohita with Aeromonas hydrophila Post-Challenges
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 8
Issue 1
10.3390/fishes8010008
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Selection and Verification of Reference Genes for Gene Expression Studies in Different Cell Lines of Golden Pompano (Trachinotus ovatus)

by
Na Zhao
1,2,†,
Han Zhang
1,2,†,
Lin Zhu
1,2,
Yongwei Hou
1,2,
Ying Wu
2,
Zhenjie Cao
1,2 and
Yun Sun
1,2,*
1
State Key Laboratory of Marine Resource Utilization in South China Sea, Hainan University, Haikou 570228, China
2
Collaborative Innovation Center of Marine Science and Technology, Hainan University, Haikou 570228, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Fishes 2023, 8(1), 8; https://doi.org/10.3390/fishes8010008
Submission received: 25 October 2022 / Revised: 19 December 2022 / Accepted: 20 December 2022 / Published: 23 December 2022
(This article belongs to the Section Genetics and Biotechnology)
Browse Figures
Versions Notes

Abstract

:
The golden pompano snout (GPS) and head kidney (GPHK) cell lines have been proven to be meaningful tools for the study on pathogenic infections in vitro. In this study, we aimed to select the most stable reference genes from seven housekeeping genes (Actin, B2M, GAPDH, RPL13, EF1A, 18S and UBCE) applied to two cell lines of golden pompano (GPS and GPHK) under both normal physiological conditions and stimulated conditions of the lipopolysaccharide (LPS) or polyinosinic:polycytidylic acid (Poly I:C) relying on quantitative real-time PCR (qRT-PCR). Additionally, the raw Ct value resulting from the qRT-PCR was analyzed by the geNorm, NormFinder and BestKeeper algorithm, and the results indicated that expression for all candidate genes exhibited some discrepancy under different experimental conditions or cell types. As for the non-stimulated group, 18S and RPL13 were the most appropriate reference genes in GPS and GPHK cells, respectively. Nevertheless, the most suitable reference genes in GPS and GPHK cells, under the stimulation of LPS, were RPL13 and 18S, respectively, whereas after being stimulated with Poly I:C, UBCE and EF1A were recommended as the optimal candidates for GPS and GPHK cells, respectively. To be sure of the reliability of the selected reference genes, immune-related genes (ISG15, BCL2, IRF1 and IRF7) were chosen as target genes to normalize. The study will provide a direction for various golden pompano cell lines to screen appropriate reference genes, and will set the stage for the application of these cell lines in relevant research areas.

Graphical Abstract

1. Introduction

Owing to sensitivity, flexibility, accuracy, dynamic range and high throughput characteristics, quantitative real-time reverse transcription PCR (qRT-PCR), which is a vital powerful technique in target gene expression analysis, has gradually prevailed in the scientific research domain [1,2,3,4]. Moreover, in comparison with other conventional means for gene expression analysis, including northern hybridization, semi-quantitative PCR and RNA-seq, qRT-PCR has the advantages of short detection time, high sensitivity, well repeatability and specificity and simplicity of operator [5,6]. Nevertheless, the results generated by qRT-PCR may be influenced by some diverse elements, such as amplification efficiency, quality and quantity of RNA, enzymatic efficiency for reverse transcription proceedings, various sample amounts and so forth [7,8]. Furthermore, it is a pre-requisite for relative quantification of target gene expression to choose stable reference genes so as to standardize the data [9,10,11]. Despite the stable expression, it has been reported over the recent years that the reference genes will show different expression levels not merely in different types of cells or tissues but also in various physiological stages or diverse stimulating environments [12,13,14,15,16]. It is generally recognized that there has been no single reference gene that is suitable for expression analysis of any target genes under any conditions [17,18]. Thereby, the reliable gene expression analysis results mainly hinge upon selection for appropriate reference genes.
Some conventional reference genes that possess stable expression are usually adopted as internal control. For instance, beta actin (Actin), a highly conserved protein, is related to cell movement, structure and integrality, featuring high transcript abundance and stable expression [19,20,21,22]. β-2-Microglobulin (B2M) is a subunit of major histocompatibility complex (MHC) class I, whose functions are closely linked to the cell immune activation and regulation and tumor immune process [23,24,25,26]. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme that participates in the glycolytic cycle and plays a vital role in adjusting cellular survival, apoptosis and death [27,28,29]. Ribosomal protein L13 (RPL13), one of the segments of constituted ribosomes, takes part in cell proliferation, differentiation, apoptosis, tumorigenesis and progression, immune response and virus replication [30]. Elongation factor-1-α (EF1A) is a conserved and indispensable protein that mainly associates with the extension stage of mRNA translation [31,32]. Moreover, 18S ribosomal RNA (18S) engages in cell growing and breed regulation [33,34,35], and ubiquitin-conjugating enzyme E2 (UBCE) is able to promote apoptosis and regulate the signaling pathway [36,37,38].
Golden pompano (Trachinotus ovatus), a common tropical and subtropical fish with considerable commercial values, is principally cultured in China, Australia, Japan and their vicinity [39,40,41]. The breeding industry of golden pompano has developed rapidly in recent years, but it is grievously threatened by viruses, bacteria and parasites, resulting in heavy economic losses annually [42,43]. Thereby, it is essential that the mechanism of pathogenic infection is elucidated as quickly as possible.
LPS, as a part of most Gram-negative bacteria tunica externa layers, is a sort of pathogen-associated molecule that can be recognized by immune cells, which plays a pivotal role in pathogenesis [44,45]. Moreover, due to the possession of a stimulating function similar to viral dsRNA, Poly I:C, a viral analogue, is frequently used in investigations on virus infection experiments of immune responses [46,47]. Fish cell lines, as a significant research tool in vitro, have been applied for studies on pathogenic mechanisms of infection, immunology, endocrinology and biotechnology [40]. Nonetheless, to date, there are no published studies on the stability of reference genes in cell lines of golden pompano.
In this study, we aimed to sort out the most stable reference genes from seven candidate reference genes (Actin, B2M, GAPDH, RPL13, EF1A, 18S and UBCE) in golden pompano snout (GPS) and head kidney (GPHK) cells under normal physiological and stimulating conditions of the lipopolysaccharide (LPS) or polyinosinic:polycytidylic acid (Poly I:C). The data produced by qRT-PCR was analyzed using three typical algorithms, including geNorm, NormFinder and BestKeeper [7,48,49]. In order to verify the dependability of the appropriate reference genes we selected, the immune-related target genes (ISG15, BCL2, IRF1 and IRF7) were chosen to normalize. The results for this study will set the stage for further qRT-PCR research on cell lines of golden pompano.

2. Materials and Methods

2.1. Cell Culture and Stimulation

Golden pompano snout (GPS) cell lines and head kidney (GPHK) cell lines were a generous gift from the South China Sea Institute of Oceanology [40,50]. GPS and GPHK cells were cultivated at 28 °C in 25-cm2 cell culture flasks, whose composition of culture solution was Leibovitz’s L-15 medium (Gibco, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Waltham, MA, USA), 0.5% of 1M N-2-Hydroxyethylpiperazine-N’-2 ethanesulfonic acid (HEPES, Gibco, Waltham, MA, USA), 4% penicillin/streptomycin (Gibco, Waltham, MA, USA) and 1% sodium chloride. At 90% cell confluence, 1 mL 0.25% trypsin-EDTA solution (Gibco, Waltham, MA, USA) was used for digestion, and then the cells were inoculated into 6-well plates. Subsequently, when the cells reached the confluence of 90%, the cells were washed three times with PBS whose medium was replaced. Then, prior to experiments, all cells were divided into three groups (A, B and C group) for treatment. Every experimental group had three biological repetitions. Then, group A and group B were stimulated with LPS or Poly I:C at concentration of 10 μg/mL, respectively, whereas group C incubated with the same volume of PBS was set as the control group. Subsequently, all cells were collected at 2, 4, 8 and 12 h post treatment for follow-up RNA extraction.

2.2. Total RNA Extraction and cDNA Synthesis

Total RNA was extracted from the cell samples with the FastPure® Cell/Tissue Total RNA Isolation Kit (Vazyme, Nanjing, China) according to the manufacturer’s instructions. The purity and integrity of RNA were measured by 260/280 nm UV absorbance ratio with NanoDrop 2000 (Thermo Fisher, Waltham, MA, USA) and confirmed by 1% agarose gel electrophoresis, separately. Purified RNA was reverse transcribed cDNA immediately with Eastep® RT Master Mix Kit (Promega, Madison, WI, USA) [51].

2.3. Reference Gene Primers Design and Amplification Efficiency

Seven candidate reference genes (Actin, B2M, GAPDH, RPL13, EF1A, 18S and UBCE) were selected and Primer Premier 5.0 software (Premier, Charlotte, NC, USA) was used for designing primers for the qRT-PCR experiments (Table 1). The correlation coefficient (R2) and PCR efficiency (E) were analyzed by the standard curve. The reliable E value should be between 90–110% with a computational formula of: E (%) = (10−1/slope − 1) × 100 [52].

2.4. qRT-PCR and Data Processing

qRT-PCR was executed via the QuantStudio™ 6 Real-Time PCR System (Thermo Fisher, Waltham, MA, USA) using 2×ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China).

2.5. Stability Verification of Internal Reference Genes

As previously reported, ISG15, BCL2, IRF1 and IRF7 play central roles in the innate immune defense system of fish, protecting them from bacterial or viral infection [53,54,55,56]. These four immune-related genes were used to verify the reliability of selected candidate reference genes in GPS and GPHK cells under stimulation of LPS or Poly I:C. Target genes were normalized using combinations in accordance with the following: (1) the most stable expressed reference gene, (2) the second most stable expressed reference genes, (3) the combination of the two most stable expressed reference genes, and (4) the least stable expressed gene. Amplification primers for immune-related genes were listed as Table S1.

3. Results

3.1. qRT-PCR Efficiency and Quality

As shown in Figure S1, total RNA for samples displayed two clear and discernible bands of 28S rRNA and 18S rRNA in agarose gel electrophoresis, whose A260/A280 value was within a reasonable range (2.0 to 2.2), suggesting that the quality and purity of total RNA were in conformity with the follow-up experimental request. In the light of the fact that all amplification products had a sole specific DNA band without obvious non-specific amplification or dimers (Figure S2), the amplification primers for seven candidate reference genes were in accordance with experimental requirements. The E values of seven candidate reference genes were within the range of 96% to 106% and their R2 values ranged from 0.990 to 0.996 (Table 1), manifesting that both the product specificity for each reference gene and amplification efficiency were consistent with the qRT-PCR conditions.

3.2. Threshold Cycle (Ct) Value Analysis

3.2.1. Expression Abundance of Reference Gene Expression among GPS and GPHK Cells under Normal Physiological Conditions

As displayed in Table 2, the Ct values of seven candidate reference genes were from 6.4 to 31.8 in GPS cells under normal physiological conditions. What was noteworthy was that B2M had the highest Ct value (31.8), whereas the minimum Ct value was observed in 18S (6.4). The Ct range of 18S was 6.4 to 6.6, which suggested that 18S had the least changed range in comparison with other reference genes. However, the RPL13 whose Ct range was between 21.3 and 24.3 had the maximum variation. In GPS cells, B2M exhibited the lowest expression level with an average Ct value of 31.2, while the expression level of 18S was the highest with an average Ct value of 6.5.
With regard to GPHK cells, the Ct value of all candidate genes was within the range of 7.7 to 34.4. 18S and GAPDH had the minimum Ct value (7.7) and maximum Ct value (34.4), respectively. It was evident that 18S had the least variation of Ct value while GAPDH displayed the largest Ct value changes of 1.2.

3.2.2. Expression Abundance of Reference Gene Expression among GPS and GPHK Cells under LPS Stimulating Condition

According to the data of the Ct value presented in Table 3, in comparison with the control group, there was clearly different variation in the expression level of the seven candidate reference genes in GPS and GPHK cells at different time points under stimuli of LPS. At 2 h and 4 h after being stimulated with LPS, in GPS cells, Actin showed the least Ct value variation, whereas GAPDH had an obvious variation of expression level. At 8 h, the smallest change of Ct value was B2M (0.7); however, Ct variation in the remaining six candidates ranged from 1.1 to 2, among which GAPDH presented the highest variation of Ct value (2). At 12 h, B2M displayed an inconspicuous variation of the Ct value (0.1), and Actin and 18S were the most unstable candidates with significant change of Ct value (0.8).
In GPHK cells, at 2 h and 4 h after being stimulated with LPS, the expression level of GAPDH possessed maximum fluctuation with Ct value variation while Ct value for both Actin and 18S all showed comparatively small changes. At 8 h and 12 h, the changes for Ct value of all candidates were less than 1.

3.2.3. Expression Abundance of Reference Gene Expression among GPS and GPHK Cells under Poly I:C Stimulating Condition

Likewise, it was noticeable that under stimulation of Poly I:C at diverse time points, expression abundance for all candidate reference genes changed to a certain extent in contrast with the control group. At 2 h, 4 h and 8 h after stimulation with Poly I:C in GPS cells, Actin presented the smallest variation of Ct value while B2M had the most distinct alteration for expression levels at 4 h and 8 h post stimulation of Poly I:C.
With regard to GPHK cells at 2 h after being stimulated with Poly I:C—except for GAPDH, whose Ct value change was 0.8—the Ct value variations of the rest of the six genes were greater than 1, among of which the highest variation (2.1) arose in 18S. Additionally, in 12 h, Actin, RPL13 and EF1A all had the smallest Ct value variation (0.1), whereas GAPDH showed the highest variation in expression level (1.1).

3.3. geNorm, NormFinder and BestKeeper Analysis

3.3.1. Stability of Reference Gene Expression in GPS and GPHK Cells under Normal Physiological Conditions

For the purpose of selecting the most stable reference genes in GPS and GPHK cells under normal physiological conditions, the expression stability for candidate reference genes was analyzed via three software, namely geNorm, NormFinder and BestKeeper [7,48,49]. geNorm is a Visual Basic application tool for Microsoft Excel and is able to assess the stability of reference genes based on the principle of keeping the expression ratio of two candidate reference genes in a constant state throughout the different experimental conditions [57]. When the M value is lowest, the candidate is considered the steadiest reference gene and vice versa. Moreover, geNorm is capable of screening the most suitable number of candidate references necessitating the normalization of target gene expression levels through calculation of pairwise variations between one examined gene and the rest of candidate genes. Unlike geNorm, NormFinder can generate the stability value (SV) of reference gene expression relying on the experimental data, producing the most reliable reference gene. Invariably, the candidate reference gene is the most reliable when the SV is the lowest. Apart from that, BestKeeper is able to single out the most reliable reference genes in light of standard deviation (SD) and the coefficient of variation (CV) of Ct values, and the reference gene is more reliable when the SD and CV values are smaller. Consequently, the most stable candidate reference gene is obtained from the combination of the results generated from the three different software above, as previously reported [58].
According to analysis of geNorm, 18S and GAPDH were the most stable reference genes the in GPS cells (Figure 1). As shown in Figure 2, V2/3 values for GPS cells under normal conditions were less than 0.15 in light of the pairwise variations analysis, revealing that accurate normalization necessitate two pairs of the most stable reference genes. The rankings of expression stability from high to low, on the basis of results handled by NormFinder, was 18S = GAPDH (0.026) > UBCE (0.039) > Actin (0.154) > EF1A (0.228) > B2M (0.492) > RPL13 (1.095) (Table 4). Moreover, the results of BestKeeper shown in Table 5 manifested that the most reliable gene was 18S, with a minimum standard deviation (SD) of 0.11, followed by GAPDH, Actin, UBCE, EF1A, B2M and RPL13. To summarize, analysis results based on three softwares suggested that the rankings of candidates from the most stable to the most unstable were as follow: 18S > GAPDH > UBCE > Actin > EF1A > B2M > RPL13 (Table 6).
Similarly, based on geNorm (version 1.0), NormFinder (version 1.0) and BestKeeper (version 1.0) softwares, the stable reference genes in GPHK cells under normal physiological conditions are presented in Figure 1 and Figure 2 and Table 4 and Table 5. Through comprehensive analysis, the ranking of optimal candidate reference genes was: RPL13 > 18S > EF1A > UBCE > Actin > B2M > GAPDH (Table 6).

3.3.2. Stability of Reference Gene Expression in GPS and GPHK Cells under LPS Stimulating Condition

Through geNorm analysis on all the Ct values of candidates in GPS cells under the stimulating condition of LPS, RPL13/Actin, RPL13/18S, RPL13/Actin and RPL13/B2M were screened as the most suitable reference genes for GPS cells at 2, 4, 8 and 12 h after being stimulated with LPS, respectively (Figure 3). As shown in Figure 4, considering that all the V2/3 value were less than 0.15, two pairs of reference genes sufficed to normalize accurately. In view of the analysis of NormFinder, the most appropriate candidates were RPL13/Actin, RPL13, RPL13/Actin and GAPDH at 2, 4, 8 and 12 h post stimulation of LPS in GPS cells, respectively (Table 7). Additionally, the results of BestKeeper indicated that RPL13 (SD = 0.36), EF1A (SD = 0.20), B2M (SD = 0.41) and RPL13 (SD = 0.19) were the most appropriate reference genes in GPS cells stimulated with LPS for 2, 4, 8 and 12 h, respectively (Table 8). In sumary, the most reliable reference genes in GPS cells after being stimulated for 2, 4, 8 and 12 h, in view of comprehensive analysis, were all RPL13 (Table 9).
In GPHK cells, after being stimulated with LPS, the optimal candidate gene was determined by virtue of the analysis of geNorm (Figure 5 and Figure 6), NormFinder (Table 7) and BestKeeper (Table 8). To summarize, it was conspicuous that 18S was the most appropriate reference gene in GPHK cells stimulated with LPS for 2, 4, 8 and 12 h, respectively (Table 9).

3.3.3. Stability of Reference Gene Expression in GPS and GPHK Cells under Poly I:C Stimulating Condition

At 2, 4, 8 and 12 h after being stimulated with Poly I:C, seven reference gene candidates in GPS cells presented relatively stable expression level on account of their M and V2/3 values all being less than 1.5 and 0.15, respectively. Moreover, in light of the analysis by geNorm, UBCE/Actin, UBCE/Actin, UBCE/18S and UBCE/EF1A were considered as the most appropriate reference genes for GPS cells, respectively (Figure 7 and Figure 8). On the basis of NormFinder, the most stable reference genes in GPS cells stimulated with Poly I:C for 2, 4, 8 and 12 h were UBCE/Actin, UBCE/Actin, Actin and UBCE/EF1A, respectively (Table 7), which was consistent with the results analyzed by geNorm. Moreover, with the aid of the BestKeeper algorithm, 18S, UBCE, UBCE and 18S, all of which had the lowest SD value, were deemed the most suitable reference genes for GPS cells at 2, 4, 8 and 12 h post stimulation of Poly I:C (Table 8).
Comprehensive analysis indicated that at 2, 4, 8 and 12 h after being stimulated with Poly I:C, the most reliable candidates in GPS cells were UBCE (Table 9). Combined with three softwares, geNorm (Figure 9 and Figure 10), NormFinder (Table 7) and BestKeeper (Table 8), the most suitable reference genes were EF1A, EF1A, EF1A and RPL13 after being stimulated with Poly I:C in GPHK cells at 2, 4, 8 and 12 h, respectively (Table 9).

3.4. Verification of Screened Reference Genes

In the light of the pairwise variation results analyzed by geNorm, two pairs of the most stable reference genes sufficed to normalize accurately for gene expression analysis because all V2/3 values were less than 0.15. Thereby, in a bid to further verify the reliability of screened suitable reference genes, two pairs of the most stable genes and one pair of the most unstable gene were selected to standardize the expression of target genes.
As shown in Figure 11, there was considerable discrepancy between the expression profile of target genes when the difference for expression stability of selected reference genes was relatively great. Under stimulation with LPS, RPL13/Actin and 18S/Actin were the most stable genes in GPS and GPHK cells, respectively, whereas GAPDH was the least stable gene in two cell lines. After being stimulated with Poly I:C, the most appropriate reference genes in GPS and GPHK cells were UBCE/Actin and EF1A/Actin, respectively, while B2M and GAPDH were identified as the most unstable candidates in GPS and GPHK cells, respectively.
For instance, in GPS cells stimulated with Poly I:C, when UBCE or Actin or a combination of them was selected as reference genes, the expression level of BCL2 was up-regulated gradually along with the increase of stimulation time and peaked at 8 h; however, when using the least stable reference gene B2M, the expression pattern for BCL2 was fundamentally different and was down-regulated at all four time points (Figure 11B). After being stimulated with LPS, in GPS cells, using the stable candidates or their combination as internal controls, the expression profile for ISG15 was that its expression was elevated drastically at 2 h and then maintained a lower level with small fluctuation at 4, 8 and 12 h; when adopting GAPDH as the reference gene, the change for target gene expression at 2, 4 and 8 h was similar to the above results, but at 12 h the expression level was remarkably increased to 5.5-fold (Figure 11C). As expected, under stimulating condition of LPS or Poly I:C, expression levels of immune-related genes in GPHK cells changed abnormally when adopting the unstable candidate, which was similar to the results in GPS cells (Figure 11E–H).
To summarize, if the stable reference genes or a combination of them were adopted, the expression pattern of target genes was normal and had a striking similarity to each other; in contrast, if the unstable candidates were selected for standardization of gene expression, target gene expression profiles would be greatly distinct from the counterpart that was using stable candidates or their combination as internal controls, and its expression would manifest great fluctuation.

4. Discussion

An ideal reference gene should display excellent expression stability among most tissues or cell types that have not been appreciably affected by endogenous or exogenous factors [59,60]. It has been reported in many studies that in teleost, several common reference genes exhibited preferable expression stability either across different tissues or under various conditions [61,62,63,64]. As for goldfish, EF1A and ACTB were recommended as the optimal reference genes both in healthy and CyHV-2 infected fish, whereas 18S presented great expression stability under healthy conditions but was the least stable candidate under infection with CyHV-2 [64]. Moreover, in the half-smooth tongue sole, the most appropriate genes in samples for eighteen developmental phases was B2M and GAPDH [62]; for Japanese flounder, UBCE and ACTB with minimum expression variation were deemed as the most stable candidates across eight tissues under healthy states [61]. Regarding humpback grouper, RPL13 was evaluated as the most suitable reference gene across five immune tissues under healthy states [63]. However, when it comes to the selection of reference genes for cell lines in fish, its relevant research was relatively rare and not systemic. Thereby, in this study, we evaluated and detected expression stability of seven candidate reference genes (Actin, B2M, GAPDH, RPL13, EF1A, 18S and UBCE) in GPS and GPHK cells under normal physiological conditions or stimulated conditions of LPS or Poly I:C in order to screen appropriate reference genes applied to different cell lines of golden pompano.
Conventional methods that are used to evaluate expression stability for reference genes include: geNorm [7], REST [65], BestKeeper [49], NormFinder [48] and the comparative delta-Ct method [66]. As previously reported, the rankings of the most stable reference genes assessed via different software manifested similarity to a certain extent, but slight discrepancies due to adopting of various algorithms also occurred [62]. For example, in the pituitary of turbot, the results of geNorm demonstrated that actb and ctsd were the most suitable reference genes, and the optimal candidates assessed by Normfinder were actb and b2m, whereas in accordance BestKeeper analysis, 18S was the most appropriate reference gene [67]. Consistently, in this study, the three software all proposed 18S as the most suitable candidate in GPS cells under normal physiological conditions; regarding GPHK cells, in the light of results generated by BestKeeper or geNorm, the optimal reference genes were RPL13 and RPL13/18S, respectively, whereas UBCE was evaluated as the most stable reference gene according to NormFinder. Hence, in this research, the final results were produced by the combination of ranking order for the most stable candidates evaluated by the three software. In light of comprehensive analysis, 18S and RPL13 separately were the most appropriate reference genes in GPS and GPHK cells under normal physiological conditions. Similarly, it has been reported in previous research that after being infected with ISAV, 18S was recommended as the most appropriate reference gene in the kidney cells of Atlantic salmon [68].
Previous studies have demonstrated that reference gene expression levels fluctuated with the variation of experimental conditions, developmental phase or tissue or cell types [69,70,71]. For instance, in the peripheral blood mononuclear cells of porcine, geNorm results revealed that in the non-stimulated group, the most appropriate reference genes were PPIA, BLM and GAPDH while PPIA, B2M and RPL4 were identified as the most suitable candidates in the LPS-stimulated group [72]. In this study, under stimulation of LPS or Poly I:C at four time points, the most reliable candidates were RPL13 and UBCE in GPS cells, respectively. Similarly, it has been reported that RPL4, belonging to the ribosomal protein family, was evaluated as the most stable candidate in porcine peripheral blood mononuclear cells after being stimulated with LTA [72]. Apart from that, UBE2D2, in light of expression stability and suitability, was assessed as the optimal candidate reference gene in human T-cells as well as in peripheral blood mononuclear cells [73].
Moreover, in GPHK cells after being stimulated with LPS or Poly I:C, 18S and EF1A were recommended as the most appropriate reference genes based on comprehensive analysis, respectively. In line with our results, for grass carp, EF1a ranked as the most stable reference gene in kidney cells stimulated with Poly I:C [74]; moreover, under stimulation of west nile virus (WNV) antigen, the optimal candidate reference gene was identified as 18S in peripheral blood mononuclear cells [75].
Four immune-related genes, ISG15, BCL2, IRF1 and IRF7, were selected to verify the reliability of selected stable reference genew in GPHK and GPS cells under stimulation with LPS or Poly I:C. In two cell lines under different stimulating conditions, when adopting the unstable candidates, the expression pattern for all target genes would be abnormal and their expression would fluctuate to some degree, whereas the results were contrary when using the stable candidates or combination as internal control. The above results were consistent with similar observations in other studies, revealing that mistaken and inaccurate conclusions would occur if unreliable reference genes were screened for normalization [76,77]. Thereby, our results will provide a firm basis for gene expression analysis in golden pompano cell lines in vitro.

5. Conclusions

In this study, using geNorm, Normfinder and BestKeeper, we analyzed and evaluated the expression stability of seven candidate reference genes in GPS and GPHK cells under different conditions. For GPS and GPHK cells under normal physiological conditions, the most stable reference genes were 18S and RPL13, respectively. Contrarily, RPL13 and 18S were proposed as the optimal candidates in GPS and GPHK cells under stimuli with LPS. After being stimulated with Poly I:C, UBCE and EF1A were the most reliable reference genes in GPS and GPHK cells, respectively. The results were further validated by normalization analysis on four immune genes (ISG15, BCL2, IRF1 and IRF7). In conclusion, expression stability for all candidate genes exhibited some discrepancies under different experimental conditions or cell types, and our results will provide a firm basis for gene expression analysis in golden pompano cell lines in vitro.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes8010008/s1, Figure S1: Analysis of agarose gel of total RNA extracted from different cell lines of golden pompano under normal physiological condition (A) and stimulation of LPS (B) or Poly I:C (C); Figure S2: The amplification of qRT-PCR of the seven housekeeping genes of golden pompano. Table S1: Primers for immune genes used for validation experiment.

Author Contributions

N.Z. and H.Z.: conceptualization, data curation, formal analysis, writing—original draft; L.Z. and Y.H.: methodology; Y.W. and Z.C.: supervision, writing—review and editing; Y.S.: conceptualization, funding acquisition, supervision, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 42066007, 32173009), and the Nanhai Famous Youth Project.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The authors declare that all data supporting the findings of this study is available within the article.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Walker, N.J. A Technique Whose Time Has Come. Science 2002, 296, 557–559. [Google Scholar] [CrossRef] [PubMed]
  2. Gachon, C.; Mingam, A.; Charrier, B. Real-time PCR: What Relevance to Plant Studies? J. Exp. Bot. 2004, 55, 1445–1454. [Google Scholar] [CrossRef] [Green Version]
  3. Bustin, S.A.; Benes, V.; Nolan, T.; Pfaffl, M.W. Quantitative Real-Time RT-PCR—A Perspective. J. Mol. Endocrinol. 2005, 34, 597–601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Chi, C.; Shen, Y.; Yin, L.; Ke, X.; Han, D.; Zuo, Y. Selection and Validation of Reference Genes for Gene Expression Analysis in Vigna angularis Using Quantitative Real-Time RT-PCR. PLoS ONE 2016, 11, e0168479. [Google Scholar] [CrossRef] [Green Version]
  5. Heid, C.A.; Stevens, J.; Livak, K.J.; Williams, P.M. Real Time Quantitative PCR. Genome Res. 1996, 6, 986–994. [Google Scholar] [CrossRef] [Green Version]
  6. Yoo, W.G.; Kim, T.I.; Li, S.; Kwon, O.S.; Cho, P.Y.; Kim, T.S.; Kim, K.; Hong, S.J. Reference Genes for Quantitative Analysis on Clonorchis Sinensis Gene Expression by Real-Time PCR. Parasitol. Res. 2009, 104, 321–328. [Google Scholar] [CrossRef] [PubMed]
  7. Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002, 3, research0034. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Park, S.J.; Huh, J.W.; Kim, Y.H.; Lee, S.R.; Kim, S.H.; Kim, S.U.; Kim, H.S.; Kim, M.K.; Chang, K.T. Selection of Internal Reference Genes for Normalization of Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) Analysis in the Canine Brain and Other Organs. Mol. Biotechnol. 2013, 54, 47–57. [Google Scholar] [CrossRef] [PubMed]
  9. Bustin, S.A. Absolute Quantification of mRNA Using Real-Time Reverse Transcription Polymerase Chain Reaction Assays. J. Mol. Endocrinol. 2000, 25, 169–193. [Google Scholar] [CrossRef] [Green Version]
  10. Le Bail, A.; Dittami, S.M.; de Franco, P.O.; Rousvoal, S.; Cock, M.J.; Tonon, T.; Charrier, B. Normalisation Genes for Expression Analyses in the Brown Alga Model Ectocarpus siliculosus. BMC Mol. Biol. 2008, 9, 75. [Google Scholar] [CrossRef]
  11. Szczygieł, J.; Kamińska-Gibas, T.; Petit, J.; Jurecka, P.; Wiegertjes, G.; Irnazarow, I. Re-evaluation of Common Carp (Cyprinus carpio L.) Housekeeping Genes for Gene Expression Studies—Considering Duplicated Genes. Fish Shellfish Immunol. 2021, 115, 58–69. [Google Scholar] [CrossRef] [PubMed]
  12. Thellin, O.; Zorzi, W.; Lakaye, B.; De Borman, B.; Coumans, B.; Hennen, G.; Grisar, T.; Igout, A.; Heinen, E. Housekeeping Genes as Internal Standards: Use and Limits. J. Biotechnol. 1999, 75, 291–295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Nolan, T.; Hands, R.E.; Bustin, S.A. Quantification of mRNA Using Real-Time RT-PCR. Nat. Protoc. 2006, 1, 1559–1582. [Google Scholar] [CrossRef]
  14. González-Verdejo, C.I.; Die, J.V.; Nadal, S.; Jiménez-Marín, A.; Moreno, M.T.; Román, B. Selection of Housekeeping Genes for Normalization by Real-Time RT–PCR: Analysis of Or-MYB1 Gene Expression in Orobanche Ramosa Development. Anal Biochem. 2008, 379, 176–181. [Google Scholar] [CrossRef] [PubMed]
  15. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. De Spiegelaere, W.; Cornillie, P.; Van Poucke, M.; Peelman, L.; Burvenich, C.; Van den Broeck, W. Quantitative mRNA Expression Analysis in Kidney Glomeruli Using Microdissection Techniques. Histol Histopathol. 2011, 26, 267–275. [Google Scholar] [CrossRef] [PubMed]
  17. Peters, I.R.; Peeters, D.; Helps, C.R.; Day, M.J. Development and Application of Multiple Internal Reference (Housekeeper) Gene Assays for Accurate Normalisation of Canine Gene Expression Studies. Vet. Immunol. Immunopathol. 2007, 117, 55–66. [Google Scholar] [CrossRef]
  18. Thiel, C.S.; Hauschild, S.; Tauber, S.; Paulsen, K.; Raig, C.; Raem, A.; Biskup, J.; Gutewort, A.; Hürlimann, E.; Unverdorben, F.; et al. Identification of Reference Genes in Human Myelomonocytic Cells for Gene Expression Studies in Altered Gravity. BioMed Res. Int. 2015, 2015, 363575. [Google Scholar] [CrossRef] [Green Version]
  19. Goodson, H.V.; Hawse, W.F. Molecular Evolution of the Actin Family. J. Cell Sci. 2002, 115, 2619–2622. [Google Scholar] [CrossRef]
  20. Dominguez, R.; Holmes, K.C. Actin Structure and Function. Annu. Rev. Biophys. 2011, 40, 169–186. [Google Scholar] [CrossRef]
  21. Lin, J.; Redies, C. Histological Evidence: Housekeeping Genes Beta-actin and GAPDH are of Limited Value for Normalization of Gene Expression. Dev. Genes Evol. 2012, 222, 369–376. [Google Scholar] [CrossRef] [PubMed]
  22. Kashina, A.S. Regulation of Actin Isoforms in Cellular and Developmental Processes. Semin. Cell Dev. Biol. 2020, 102, 113–121. [Google Scholar] [CrossRef] [PubMed]
  23. Ploegh, H.L.; Orr, H.T.; Strominger, J.L. Major Histocompatibility Antigens: The Human (HLA-A, -B, -C) and Murine (H-2K, H-2D) Class I Molecules. Cell 1981, 24, 287–299. [Google Scholar] [CrossRef]
  24. Saper, M.A.; Bjorkman, P.J.; Wiley, D.C. Refined Structure of The Human Histocompatibility Antigen HLA-A2 at 2.6 A Resolution. J. Mol. Biol. 1991, 219, 277–319. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, C.; Wang, Z.; Yao, T.; Zhou, J.; Wang, Z. The Immune-related Role of Beta-2-microglobulin in Melanoma. Front. Oncol. 2022, 12, 944722. [Google Scholar] [CrossRef] [PubMed]
  26. Chen, H.; Kshirsagar, S.; Jensen, I.; Lau, K.; Simonson, C.; Schluter, S.F. Characterization of Arrangement and Expression of the Beta-2 microglobulin Locus in the Sandbar and Nurse Shark. Dev. Comp. Immunol. 2010, 34, 189–195. [Google Scholar] [CrossRef]
  27. Zhang, X.H.; Rao, X.L.; Shi, H.T.; Li, R.J.; Lu, Y.T. Overexpression of a Cytosolic Glyceraldehyde-3-Phosphate Dehydrogenase Gene OsGAPC3 Confers Salt Tolerance in Rice. Plant Cell Tissue Organ Cult. 2011, 107, 1. [Google Scholar] [CrossRef]
  28. Kubo, H. Cloning and Expression Analysis of Putative Glyceraldehyde-3-Phosphate Dehydrogenase Genes in Pilobolus crystallinus. Mycoscience 2011, 52, 99–106. [Google Scholar] [CrossRef]
  29. Nicholls, C.; Li, H.; Liu, J.P. GAPDH: A Common Enzyme with Uncommon Functions. Clin. Exp. Pharmacol. Physiol. 2012, 39, 674–679. [Google Scholar] [CrossRef]
  30. Guan, J.; Han, S.; Wu, J.; Zhang, Y.; Bai, M.; Abdullah, S.W.; Sun, S.; Guo, H. Ribosomal Protein L13 Participates in Innate Immune Response Induced by Foot-and-Mouth Disease Virus. Front. Immunol. 2021, 12, 616402. [Google Scholar] [CrossRef]
  31. Mateyak, M.K.; Kinzy, T.G. eEF1A: Thinking Outside the Ribosome. J. Biol. Chem. 2010, 285, 21209–21213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Abbas, W.; Kumar, A.; Herbein, G. The eEF1A Proteins: At the Crossroads of Oncogenesis, Apoptosis, and Viral Infections. Front. Oncol. 2015, 5, 75. [Google Scholar] [CrossRef] [Green Version]
  33. Martin, F.; Ménétret, J.F.; Simonetti, A.; Myasnikov, A.G.; Vicens, Q.; Prongidi-Fix, L.; Natchiar, S.K.; Klaholz, B.P.; Eriani, G. Ribosomal 18S rRNA Base Pairs with mRNA during Eukaryotic Translation Initiation. Nat. Commun. 2016, 7, 12622. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Zhang, Y.; Lin, X.; Li, T.; Li, H.; Lin, L.; Luo, H.; Li, L.; Ji, N.; Lin, S. High Throughput Sequencing of 18S rRNA and its Gene to Characterize a Prorocentrum Shikokuense (Dinophyceae) bloom. Harmful Algae 2020, 94, 101809. [Google Scholar] [CrossRef] [PubMed]
  35. Wang, Y.; Zhang, S. EF1α is a Useful Internal Reference for Studies of Gene Expression Regulation in Amphioxus Branchiostoma japonicum. Fish Shellfish Immunol. 2012, 32, 1068–1073. [Google Scholar] [CrossRef] [PubMed]
  36. Chen, Z.; Pickart, C.M. A 25-Kilodalton Ubiquitin Carrier Protein (E2) Catalyzes Multi-ubiquitin Chain Synthesis via Lysine 48 of Ubiquitin. J. Biol. Chem. 1990, 265, 21835–21842. [Google Scholar] [CrossRef] [PubMed]
  37. Djajawi, T.M.; Liu, L.; Gong, J.; Huang, A.S.; Luo, M.; Xu, Z.; Okamoto, T.; Call, M.J.; Huang, D.; van Delft, M.F. MARCH5 Requires MTCH2 to Coordinate Proteasomal Turnover of the MCL1: NOXA Complex. Cell Death Differ. 2020, 27, 2484–2499. [Google Scholar] [CrossRef] [Green Version]
  38. Li, Y.; Zhou, Z.; Shen, M.; Ge, L.; Liu, F. Ubiquitin-Conjugating Enzyme E2 E Inhibits the Accumulation of Rice Stripe Virus in Laodelphax striatellus (Fallén). Viruses 2020, 12, 908. [Google Scholar] [CrossRef]
  39. Wang, R.; Feng, J.; Su, Y.; Ye, L.; Wang, J. Studies on the Isolation of Photobacterium damselae Subsp. piscicida from Diseased Golden Pompano (Trachinotus ovatus Linnaeus) and Antibacterial Agents Sensitivity. Vet. Microbiol. 2013, 162, 957–963. [Google Scholar] [CrossRef]
  40. Li, P.; Zhou, L.; Wei, S.; Yang, M.; Ni, S.; Yu, Y.; Cai, J.; Qin, Q. Establishment and Characterization of a Cell Line from the Head Kidney of Golden Pompano Trachinotus ovatus and Its Application in Toxicology and Virus Susceptibility. J. Fish Biol. 2017, 90, 1944–1959. [Google Scholar] [CrossRef]
  41. Wu, M.; Guo, L.; Zhu, K.C.; Guo, H.Y.; Liu, B.; Jiang, S.G.; Zhang, D.C. Genomic Structure and Molecular Characterization of Toll-like Receptors 1 and 2 from Golden Pompano Trachinotus ovatus (Linnaeus, 1758) and their Expression Response to three Types of Pathogen-associated Molecular Patterns. Dev. Comp. Immunol. 2018, 86, 34–40. [Google Scholar] [CrossRef] [PubMed]
  42. Zhou, C.; Lin, H.; Huang, Z.; Wang, J.; Wang, Y.; Yu, W. Cloning and Expression Analysis of C-type Lysozyme Gene in Golden Pompano, Trachinotus ovatus. Fish Shellfish Immunol. 2016, 54, 580–585. [Google Scholar] [CrossRef] [PubMed]
  43. Wu, Y.; Zhou, Y.; Cao, Z.; Sun, Y.; Chen, Y.; Xiang, Y.; Wang, L.; Zhang, S.; Guo, W. Comparative Analysis of the Expression Patterns of IL-1β, IL-11, and IL-34 in Golden Pompano (Trachinotus ovatus) Following different Pathogens Challenge. Fish Shellfish Immunol. 2019, 93, 863–870. [Google Scholar] [CrossRef]
  44. Wang, X.; Quinn, P.J. Lipopolysaccharide: Biosynthetic pathway and structure modification. Prog. Lipid Res. 2010, 49, 97–107. [Google Scholar] [CrossRef] [PubMed]
  45. Whitfield, C.; Trent, M.S. Biosynthesis and export of bacterial lipopolysaccharides. Annu. Rev. Biochem. 2014, 83, 99–128. [Google Scholar] [CrossRef]
  46. Alexopoulou, L.; Holt, A.C. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 2001, 413, 732–738. [Google Scholar] [CrossRef]
  47. Doyle, S.; Vaidya, S.; O’Connell, R.; Dadgostar, H.; Dempsey, P.; Wu, T.; Rao, G.; Sun, R.; Haberland, M.; Modlin, R.; et al. IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity 2002, 17, 251–263. [Google Scholar] [CrossRef] [Green Version]
  48. Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [Green Version]
  49. Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of Stable Housekeeping Genes, Differentially Regulated Target Genes and Sample Integrity: BestKeeper—Excel-Based Tool Using Pair-Wise Correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
  50. Yu, Y.; Wei, S.; Wang, Z.; Huang, X.; Huang, Y.; Cai, J.; Li, C.; Qin, Q. Establishment of a New Cell Line from the Snout Tissue of Golden Pompano Trachinotus ovatus, and Its Application in Virus Susceptibility. J. Fish Biol. 2016, 88, 2251–2262. [Google Scholar] [CrossRef]
  51. Liu, C.S.; Sun, Y.; Zhang, M.; Sun, L. Identification and Analysis of a Sciaenops Ocellatus ISG15 Homologue that Is Involved in Host Immune Defense against Bacterial Infection. Fish Shellfish. Immunol. 2010, 29, 167–174. [Google Scholar] [CrossRef] [PubMed]
  52. Kubista, M.; Andrade, J.M.; Bengtsson, M.; Forootan, A.; Jonák, J.; Lind, K.; Sindelka, R.; Sjöback, R.; Sjögreen, B.; Strömbom, L.; et al. The Real-time Polymerase Chain Reaction. Mol. Asp. Med. 2006, 27, 95–125. [Google Scholar] [CrossRef] [PubMed]
  53. Zhang, Y.B.; Gui, J.F. Molecular Regulation of Interferon Antiviral Response in Fish. Dev. Comp. Immunol. 2012, 38, 193–202. [Google Scholar] [CrossRef] [PubMed]
  54. Langevin, C.; van der Aa, L.M.; Houel, A.; Torhy, C.; Briolat, V.; Lunazzi, A.; Harmache, A.; Bremont, M.; Levraud, J.P.; Boudinot, P. Zebrafish ISG15 Exerts a Strong Antiviral Activity against RNA and DNA Viruses and Regulates the Interferon Response. J. Virol. 2013, 87, 10025–10036. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Chen, X.; Guan, Y.; Li, K.; Luo, T.; Mu, Y.; Chen, X. IRF1 and IRF2 Act as Positive Regulators in Antiviral Response of Large Yellow Croaker (Larimichthys crocea) by Induction of Distinct Subgroups of Type I IFNs. Dev. Comp. Immunol. 2021, 118, 103996. [Google Scholar] [CrossRef]
  56. Yuan, Z.; Liu, S.; Yao, J.; Zeng, Q.; Tan, S.; Liu, Z. Expression of Bcl-2 Genes in Channel Catfish after Bacterial Infection and Hypoxia Stress. Dev. Comp. Immunol. 2016, 65, 79–90. [Google Scholar] [CrossRef] [Green Version]
  57. Tong, Z.; Gao, Z.; Wang, F.; Zhou, J.; Zhang, Z. Selection of Reliable Reference Genes for Gene Expression Studies in Peach Using Real-Time PCR. BMC Mol. Biol. 2009, 10, 71. [Google Scholar] [CrossRef] [Green Version]
  58. Wang, Q.; Ishikawa, T.; Michiue, T.; Zhu, B.L.; Guan, D.W.; Maeda, H. Stability of Endogenous Reference Genes in Postmortem Human Brains for Normalization of Quantitative Real-Time PCR Data: Comprehensive Evaluation Using GeNorm, NormFinder, and BestKeeper. Int. J. Leg. Med. 2012, 126, 943–952. [Google Scholar] [CrossRef]
  59. Schmid, H.; Cohen, C.D.; Henger, A.; Irrgang, S.; Schlöndorff, D.; Kretzler, M. Validation of Endogenous Controls for Gene Expression Analysis in Microdissected Human Renal Biopsies. Kidney Int. 2003, 64, 356–360. [Google Scholar] [CrossRef] [Green Version]
  60. Liu, Y.; Wu, S.; Jiang, N.; Liu, W.; Zhou, Y.; Zeng, L.; Zhong, Q.; Li, Z.; Fan, Y. Characterization of Reference Genes for qRT-PCR Normalization in Rice-Field Eel (Monopterus albus) to Assess Differences in Embryonic Developmental Stages, the Early Development of Immune Organs, and Cells Infected with Rhabdovirus. Fish Shellfish Immunol. 2022, 120, 92–101. [Google Scholar] [CrossRef]
  61. Zheng, W.J.; Sun, L. Evaluation of Housekeeping Genes as References for Quantitative Real Time RT-PCR Analysis of Gene Expression in Japanese Flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2011, 30, 638–645. [Google Scholar] [CrossRef] [PubMed]
  62. Liu, C.; Xin, N.; Zhai, Y.; Jiang, L.; Zhai, J.; Zhang, Q.; Qi, J. Reference Gene Selection for Quantitative Real-Time RT-PCR Normalization in the Half-Smooth Tongue Sole (Cynoglossus semilaevis) at Different Developmental Stages, in Various Tissue Types and on Exposure to Chemicals. PLoS ONE 2014, 9, e91715. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Chen, X.; Sun, Y.; Zhang, P.; Li, J.; Li, H.; Wei, C.; Cao, Z.; Zhou, Y. Screening of Stable Internal Reference Genes by Quantitative Real-Time PCR in Humpback Grouper Cromileptes altivelis. J. Oceanol. Limnol. 2021, 39, 1985–1999. [Google Scholar] [CrossRef]
  64. Dharmaratnam, A.; Sudhagar, A.; Nithianantham, S.R.; Das, S.; Swaminathan, T.R. Evaluation of Candidate Reference Genes for Quantitative RTqPCR Analysis in Goldfish (Carassius auratus L.) in Healthy and CyHV-2 Infected Fish. Vet. Immunol. Immunopathol. 2021, 237, 110270. [Google Scholar] [CrossRef] [PubMed]
  65. Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative Expression Software Tool (REST) for Group-wise Comparison and Statistical Analysis of Relative Expression Results in Real-time PCR. Nucleic Acids Res. 2002, 30, e36. [Google Scholar] [CrossRef]
  66. Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of Housekeeping Genes for Gene Expression Studies in Human Reticulocytes Using Real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [Green Version]
  67. Gao, Y.; Gao, Y.; Huang, B.; Meng, Z.; Jia, Y. Reference Gene Validation for Quantification of Gene Expression during Ovarian Development of Turbot (Scophthalmus maximus). Sci. Rep. 2020, 10, 823. [Google Scholar] [CrossRef] [Green Version]
  68. Jorgensen, S.M.; Kleveland, E.J.; Grimholt, U.; Gjoen, T. Validation of Reference Genes for Real-Time Polymerase Chain Reaction Studies in Atlantic Salmon. Mar. Biotechnol. 2006, 8, 398–408. [Google Scholar] [CrossRef]
  69. Huggett, J.; Dheda, K.; Bustin, S.; Zumla, A. Real-Time RT-PCR Normalisation; Strategies and Considerations. Genes Immun. 2005, 6, 279–284. [Google Scholar] [CrossRef] [Green Version]
  70. Infante, C.; Matsuoka, M.P.; Asensio, E.; Cañavate, J.P.; Reith, M.; Manchado, M. Selection of Housekeeping Genes for Gene Expression Studies in Larvae from Flatfish Using Real-Time PCR. BMC Mol. Biol. 2008, 9, 28. [Google Scholar] [CrossRef]
  71. Chechi, K.; Gelinas, Y.; Mathieu, P.; Deshaies, Y.; Richard, D. Validation of Reference Genes for the Relative Quantification of Gene Expression in Human Epicardial Adipose Tissue. PLoS ONE 2012, 7, e32265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Cinar, M.U.; Islam, M.A.; Pröll, M.; Kocamis, H.; Tholen, E.; Tesfaye, D.; Looft, C.; Schellander, K.; Uddin, M.J. Evaluation of Suitable Reference Genes for Gene Expression Studies in Porcine PBMCs in Response to LPS and LTA. BMC Res. Notes 2013, 6, 56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  73. Roy, J.G.; McElhaney, J.E.; Verschoor, C.P. Reliable Reference Genes for the Quantification of mRNA in Human T-Cells and PBMCs Stimulated with Live Influenza Virus. BMC Immunol. 2020, 21, 4. [Google Scholar] [CrossRef] [PubMed]
  74. Su, J.; Zhang, R.; Dong, J.; Yang, C. Evaluation of Internal Control Genes for qRT-PCR Normalization in Tissues and Cell Culture for Antiviral Studies of Grass Carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2011, 30, 830–835. [Google Scholar] [CrossRef]
  75. Zhang, Y.W.; Davis, E.G.; Bai, J. Determination of Internal Control for Gene Expression Studies in Equine Tissues and Cell Culture Using Quantitative RT-PCR. Vet. Immunol. Immunopathol. 2009, 130, 114–119. [Google Scholar] [CrossRef]
  76. Chen, Y.; Tan, Z.; Hu, B.; Yang, Z.; Xu, B.; Zhuang, L.; Huang, B. Selection and Validation of Reference Genes for Target Gene Analysis with Quantitative RT-PCR in Leaves and Roots of Bermudagrass under Four Different Abiotic Stresses. Physiol. Plant. 2015, 155, 138–148. [Google Scholar] [CrossRef] [PubMed]
  77. Wang, H.L.; Chen, J.; Tian, Q.; Wang, S.; Xia, X.; Yin, W. Identification and Validation of Reference Genes for Populus euphratica Gene Expression Analysis during Abiotic Stresses by Quantitative Real-time PCR. Physiol. Plant. 2014, 152, 529–545. [Google Scholar] [CrossRef]
Fishes 08 00008 g001 550
Figure 1. The expression stability of housekeeping gene candidates in GPS (A) and GPHK cells (B) under normal conditions assessed by geNorm. Based on the Ct value from qRT-PCR, geNorm software was used to analyze the stability of reference genes (M). The most stable reference genes are those who possessed the smallest M value.
Figure 1. The expression stability of housekeeping gene candidates in GPS (A) and GPHK cells (B) under normal conditions assessed by geNorm. Based on the Ct value from qRT-PCR, geNorm software was used to analyze the stability of reference genes (M). The most stable reference genes are those who possessed the smallest M value.
Fishes 08 00008 g001
Fishes 08 00008 g002 550
Figure 2. Optimum pairs of housekeeping gene candidates necessitated for normalization in GPS (A) and GPHK cells (B) under normal conditions according to geNorm analysis. Pairwise variations (v) between normalization factors of the internal reference gene based on geNorm analysis were evaluated.
Figure 2. Optimum pairs of housekeeping gene candidates necessitated for normalization in GPS (A) and GPHK cells (B) under normal conditions according to geNorm analysis. Pairwise variations (v) between normalization factors of the internal reference gene based on geNorm analysis were evaluated.
Fishes 08 00008 g002
Fishes 08 00008 g003 550
Figure 3. The expression stability of housekeeping gene candidates in GPS cells under stimulation with LPS for 2 (A), 4 (B), 8 (C) and 12 h (D) assessed by geNorm. According to the Ct values presented by seven housekeeping gene candidate stimulations with LPS or PBS, the average expression stability of housekeeping gene candidates can be evaluated as M by geNorm; not only can the M value not be more than 1.5, but the most reliable housekeeping genes have the most minimal M value as well.
Figure 3. The expression stability of housekeeping gene candidates in GPS cells under stimulation with LPS for 2 (A), 4 (B), 8 (C) and 12 h (D) assessed by geNorm. According to the Ct values presented by seven housekeeping gene candidate stimulations with LPS or PBS, the average expression stability of housekeeping gene candidates can be evaluated as M by geNorm; not only can the M value not be more than 1.5, but the most reliable housekeeping genes have the most minimal M value as well.
Fishes 08 00008 g003
Fishes 08 00008 g004 550
Figure 4. Optimum pairs of housekeeping gene candidates necessitated for normalization in GPS cells under stimulation with LPS for 2 (A), 4 (B), 8 (C) and 12 h (D) according to geNorm analysis. The optimal number of the reference gene depends on Vn/n+1 value via geNorm analysis. Moreover, the value is popularly less than 0.15.
Figure 4. Optimum pairs of housekeeping gene candidates necessitated for normalization in GPS cells under stimulation with LPS for 2 (A), 4 (B), 8 (C) and 12 h (D) according to geNorm analysis. The optimal number of the reference gene depends on Vn/n+1 value via geNorm analysis. Moreover, the value is popularly less than 0.15.
Fishes 08 00008 g004
Fishes 08 00008 g005 550
Figure 5. The expression stability of housekeeping gene candidates in GPHK cells under stimulation with LPS for 2 (A), 4 (B), 8 (C) and 12 h (D), assessed by geNorm. According to the Ct values presented by the seven housekeeping gene candidate stimulations with LPS or PBS, the average expression of stability for housekeeping gene candidates can be evaluated as M by geNorm; not only can the M value not be more than 1.5, but the most reliable housekeeping genes have the most minimal M value as well.
Figure 5. The expression stability of housekeeping gene candidates in GPHK cells under stimulation with LPS for 2 (A), 4 (B), 8 (C) and 12 h (D), assessed by geNorm. According to the Ct values presented by the seven housekeeping gene candidate stimulations with LPS or PBS, the average expression of stability for housekeeping gene candidates can be evaluated as M by geNorm; not only can the M value not be more than 1.5, but the most reliable housekeeping genes have the most minimal M value as well.
Fishes 08 00008 g005
Fishes 08 00008 g006 550
Figure 6. Optimum pairs of housekeeping gene candidates necessitated for normalization in GPHK cells under stimulation with LPS for 2 (A), 4 (B), 8 (C) and 12 h (D) according to geNorm analysis. The optimal number of reference genes depends on the Vn/n+1 value via geNorm analysis; moreover, the value is popularly less than 0.15.
Figure 6. Optimum pairs of housekeeping gene candidates necessitated for normalization in GPHK cells under stimulation with LPS for 2 (A), 4 (B), 8 (C) and 12 h (D) according to geNorm analysis. The optimal number of reference genes depends on the Vn/n+1 value via geNorm analysis; moreover, the value is popularly less than 0.15.
Fishes 08 00008 g006
Fishes 08 00008 g007 550
Figure 7. The expression stability of housekeeping gene candidates in GPS cells under stimulation with Poly I:C for 2 (A), 4 (B), 8 (C) and 12 h (D) assessed by geNorm. According to the Ct values presented by seven housekeeping gene candidate stimulations with Poly I:C or PBS, the average expression stability of housekeeping gene candidates can be evaluated M by geNorm, and not only can the M value not be more than 1.5, but the most reliable housekeeping genes have the most minimal M value as well.
Figure 7. The expression stability of housekeeping gene candidates in GPS cells under stimulation with Poly I:C for 2 (A), 4 (B), 8 (C) and 12 h (D) assessed by geNorm. According to the Ct values presented by seven housekeeping gene candidate stimulations with Poly I:C or PBS, the average expression stability of housekeeping gene candidates can be evaluated M by geNorm, and not only can the M value not be more than 1.5, but the most reliable housekeeping genes have the most minimal M value as well.
Fishes 08 00008 g007
Fishes 08 00008 g008 550
Figure 8. Optimum pairs of housekeeping gene candidates necessitated for normalization in GPS cells under stimulation with Poly I:C for 2 (A), 4 (B), 8 (C) and 12 h (D) according to geNorm analysis. The optimal number of reference genes depends on the Vn/n+1 value via geNorm analysis; moreover, the value is popularly less than 0.15.
Figure 8. Optimum pairs of housekeeping gene candidates necessitated for normalization in GPS cells under stimulation with Poly I:C for 2 (A), 4 (B), 8 (C) and 12 h (D) according to geNorm analysis. The optimal number of reference genes depends on the Vn/n+1 value via geNorm analysis; moreover, the value is popularly less than 0.15.
Fishes 08 00008 g008
Fishes 08 00008 g009 550
Figure 9. The expression stability of housekeeping gene candidates in GPHK cells under stimulation with Poly I:C for 2 (A), 4 (B), 8 (C) and 12 h (D) assessed by geNorm. According to the Ct values presented by seven housekeeping gene candidate stimulations with Poly I:C or PBS, the average expression stability of housekeeping gene candidates can be evaluated M by geNorm, and not only can the M value not be more than 1.5, but the most reliable housekeeping genes have the most minimal M value as well.
Figure 9. The expression stability of housekeeping gene candidates in GPHK cells under stimulation with Poly I:C for 2 (A), 4 (B), 8 (C) and 12 h (D) assessed by geNorm. According to the Ct values presented by seven housekeeping gene candidate stimulations with Poly I:C or PBS, the average expression stability of housekeeping gene candidates can be evaluated M by geNorm, and not only can the M value not be more than 1.5, but the most reliable housekeeping genes have the most minimal M value as well.
Fishes 08 00008 g009
Fishes 08 00008 g010 550
Figure 10. Optimum pairs of housekeeping gene candidates necessitated for normalization in GPHK cells under stimulation with Poly I:C for 2 (A), 4 (B), 8 (C) and 12 h (D) according to geNorm analysis. The optimal number of reference genes depends on the Vn/n+1 value via geNorm analysis; moreover, the value is popularly less than 0.15.
Figure 10. Optimum pairs of housekeeping gene candidates necessitated for normalization in GPHK cells under stimulation with Poly I:C for 2 (A), 4 (B), 8 (C) and 12 h (D) according to geNorm analysis. The optimal number of reference genes depends on the Vn/n+1 value via geNorm analysis; moreover, the value is popularly less than 0.15.
Fishes 08 00008 g010
Fishes 08 00008 g011 550
Figure 11. Expression profile for target genes in GPS and GPHK cells under stimulation with LPS or Poly I:C by virtue of screened reference genes. (A,C) show the relative expression levels of BCL2 and ISG15 in GPS cells after being stimulated with LPS. (B,D) show the relative expression levels of BCL2 and ISG15 in GPS cells after being stimulated with Poly I:C. Relative expression levels of IRF1 and IRF7 in GPHK cells after being stimulated with LPS were shown in (E,G), respectively. Relative expression levels of IRF1 and IRF7 in GPHK cells after being stimulated with Poly I:C were shown in (F,H), respectively. The bars represent standard error (n = 3). Different letters manifest statistically significant differences in each condition (p < 0.05).
Figure 11. Expression profile for target genes in GPS and GPHK cells under stimulation with LPS or Poly I:C by virtue of screened reference genes. (A,C) show the relative expression levels of BCL2 and ISG15 in GPS cells after being stimulated with LPS. (B,D) show the relative expression levels of BCL2 and ISG15 in GPS cells after being stimulated with Poly I:C. Relative expression levels of IRF1 and IRF7 in GPHK cells after being stimulated with LPS were shown in (E,G), respectively. Relative expression levels of IRF1 and IRF7 in GPHK cells after being stimulated with Poly I:C were shown in (F,H), respectively. The bars represent standard error (n = 3). Different letters manifest statistically significant differences in each condition (p < 0.05).
Fishes 08 00008 g011
Table
Table 1. Information for primers of housekeeping genes and their amplification efficiency in this research.
Table 1. Information for primers of housekeeping genes and their amplification efficiency in this research.
GeneFunctionGenBank Accession
Number		Primer Sequence (5′→3′)Product
Size (bp)		PCR
Efficiency
(%)		Determination Coefficient (R²)
ActinCytoskeletal proteinKX987228.1F:CGTGCGTGACATCAAGGAGAA
R:AAGGAAGGAAGGCTGGAAGAGG		17899%0.992
B2MMajor histocompatibility complexKX987233.1F:CCCTGATGCCAAACAGACAGA
R:TGGTTGACCCATGAGTGACCTT		125100%0.991
GAPDHGlycolysis enzymeKY006114.1F:AGTCCGTCTGGAGAAACCTGC
R:GACACGGTTGCTGTAGCCGAACTCA		235106%0.993
RPL13Ribosome ProteinKX987230.1F:TGAAGGAGTACCGCTCCAAACT
R:GCACGGATGCCAAATAGACG		238104%0.990
EF1ATranslationKX987227.1F:GTCCGTCAAGGAAATCCGTCG
R:TTGAACTTGCAGGCAATGTGAG		174100%0.996
18SRibosome subunitKY014076.1F:GCATTCGTATTGTGCCGCTA
R:AGTTGGCATCGTTTATGGTCG		16098%0.990
UBCEProtein degradationKX987232.1F:CACGATGTCCAGCGAAGTACA
R:GACCTCCACTCGTAGATGTTGTC		27096%0.991
Table
Table 2. Expression abundance of seven housekeeping genes among GPS and GPHK cells under normal conditions for 2, 4, 8 and 12 h. Values are shown as means ± SD (n = 3).
Table 2. Expression abundance of seven housekeeping genes among GPS and GPHK cells under normal conditions for 2, 4, 8 and 12 h. Values are shown as means ± SD (n = 3).
Cell LinesTimeActinB2MGAPDHRPL13EF1A18SUBCE
GPS2 h12.2 ± 0.330.7 ± 0.526.8 ± 0.324.3 ± 0.312.3 ± 0.26.4 ± 0.121.7 ± 0.3
4 h12.4 ± 0.230.6 ± 0.627.0 ± 0.223.9 ± 0.212.8 ± 0.46.4 ± 0.021.9 ± 0.0
8 h12.9 ± 0.131.8 ± 0.827.1 ± 0.021.3 ± 0.313.1 ± 0.46.5 ± 0.121.8 ± 0.7
12 h12.5 ± 0.331.7 ± 0.727.1 ± 0.122.5 ± 0.312.4 ± 0.46.6 ± 0.222.0 ± 0.7
GPHK2 h14.8 ± 0.120.3 ± 0.233.2 ± 0.117.2 ± 0.114.9 ± 0.27.9 ± 0.123.0 ± 0.2
4 h15.2 ± 0.120.6 ± 0.133.5 ± 0.317.1 ± 0.115.0 ± 0.07.7 ± 0.522.9 ± 0.3
8 h15.7 ± 0.621.0 ± 0.234.4 ± 0.217.4 ± 0.315.3 ± 0.27.9 ± 0.223.6 ± 0.4
12 h15.4 ± 0.420.3 ± 0.233.8 ± 0.517.2 ± 0.115.4 ± 0.47.9 ± 0.023.4 ± 0.3
Table
Table 3. Expression abundance of seven housekeeping genes among GPS and GPHK cells under stimulation of LPS or Poly I:C for 2, 4, 8 and 12 h. Values are shown as means ± SD (n = 3).
Table 3. Expression abundance of seven housekeeping genes among GPS and GPHK cells under stimulation of LPS or Poly I:C for 2, 4, 8 and 12 h. Values are shown as means ± SD (n = 3).
Reference GeneTreatmentsGPSGPHK
2 h4 h8 h12 h2 h4 h8 h12 h
ActinPBS14.3 ± 0.515.7 ± 0.315.3 ± 0.214.4 ± 0.414.3 ± 0.314.1 ± 0.215.0 ± 0.213.9 ± 0.4
LPS14.6 ± 0.615.8 ± 0.514.2 ± 1.015.2 ± 0.314.1 ± 0.113.8 ± 0.414.6 ± 0.313.6 ± 0.5
Poly I:C14.4 ± 0.915.5 ± 0.415.5 ± 0.616.3 ± 0.712.9 ± 1.015.2 ± 0.615.5 ± 0.414.0 ± 0.5
B2MPBS26.9 ± 1.127.3 ± 0.828.2 ± 0.527.0 ± 0.719.6 ± 0.319.4 ± 0.120.7 ± 0.518.9 ± 0.3
LPS27.7 ± 0.628.4 ± 0.227.5 ± 0.327.1 ± 0.819.1 ± 0.518.7 ± 0.421.3 ± 0.218.5 ± 0.4
Poly I:C26.1 ± 0.626.0 ± 0.526.4 ± 0.125.7 ± 0.518.1 ± 0.518.4 ± 0.518.4 ± 0.118.0 ± 0.4
GAPDHPBS25.0 ± 0.326.0 ± 0.428.4 ± 0.726.4 ± 0.730.4 ± 0.530.6 ± 0.632.2 ± 0.931.8 ± 0.6
LPS23.7 ± 0.327.3 ± 0.326.4 ± 0.425.7 ± 0.731.5 ± 0.332.3 ± 0.332.7 ± 0.132.5 ± 0.9
Poly I:C26.6 ± 0.027.1 ± 0.227.5 ± 0.425.8 ± 0.829.6 ± 1.532.1 ± 0.133.0 ± 0.330.7 ± 0.2
RPL13PBS23.7 ± 0.424.2 ± 0.225.9 ± 0.824.3 ± 0.116.8 ± 0.115.9 ± 0.317.1 ± 0.216.3 ± 0.4
LPS24.0 ± 0.524.4 ± 0.424.8 ± 0.223.9 ± 0.116.5 ± 0.415.1 ± 0.116.4 ± 0.416.5 ± 0.2
Poly I:C24.2 ± 1.124.9 ± 0.726.5 ± 0.523.2 ± 0.415.1 ± 1.316.8 ± 0.717.5 ± 0.816.4 ± 0.6
EF1APBS13.2 ± 0.515.3 ± 0.114.7 ± 0.312.3 ± 0.115.0 ± 0.813.9 ± 0.314.4 ± 0.114.2 ± 0.3
LPS12.5 ± 0.415.5 ± 0.513.4 ± 0.412.9 ± 0.815.4 ± 0.414.2 ± 0.714.5 ± 0.914.5 ± 0.3
Poly I:C13.0 ± 0.714.6 ± 0.415.2 ± 0.413.9 ± 0.713.7 ± 0.114.8 ± 0.514.8 ± 0.314.3 ± 0.9
18SPBS8.3 ± 0.38.1 ± 0.08.1 ± 0.08.8 ± 0.99.5 ± 0.37.5 ± 0.17.8 ± 0.17.8 ± 0.2
LPS8.8 ± 1.08.3 ± 0.79.5 ± 0.98.0 ± 0.29.3 ± 0.17.2 ± 0.17.5 ± 0.48.1 ± 0.1
Poly I:C7.6 ± 0.58.5 ± 0.08.5 ± 0.58.7 ± 0.27.4 ± 0.07.4 ± 0.07.8 ± 0.18.1 ± 1.1
UBCEPBS24.0 ± 0.827.4 ± 0.226.1 ± 0.424.6 ± 0.522.7 ± 0.221.7 ± 0.122.4 ± 0.323.4 ± 0.6
LPS24.7 ± 0.328.5 ± 0.224.6 ± 0.425.3 ± 0.321.9 ± 0.621.1 ± 0.522.1 ± 0.623.7 ± 0.7
Poly I:C24.2 ± 0.327.2 ± 0.326.5 ± 0.026.7 ± 0.621.6 ± 0.223.2 ± 0.623.2 ± 0.123.8 ± 1.0
Table
Table 4. The expression stability of housekeeping gene candidates in GPS and GPHK cells under normal conditions assessed by NormFinder.
Table 4. The expression stability of housekeeping gene candidates in GPS and GPHK cells under normal conditions assessed by NormFinder.
Cell LinesRanking Order1234567
GPSGene18SGAPDHUBCEActinEF1AB2MRPL13
Stability0.0260.0260.0390.1540.2280.4921.095
GPHKGeneUBCEActinRPL13EF1AB2M18SGAPDH
Stability0.0750.1010.1030.1140.1540.1880.206
Table
Table 5. The expression stability of housekeeping gene candidates in GPS and GPHK cells under normal conditions assessed by BestKeeper analysis.
Table 5. The expression stability of housekeeping gene candidates in GPS and GPHK cells under normal conditions assessed by BestKeeper analysis.
Cell LinesGenesStandard Deviation (SD)Correlation Coefficient (r)Coefficient
of Variation (CV)		p-ValueRanking Order
GPS18S0.110.6741.640.0161
GAPDH0.160.2800.590.3792
Actin0.280.3692.250.2363
UBCE0.310.6101.440.0354
EF1A0.360.6262.860.0295
B2M0.610.1741.950.5886
RPL131.09−0.2274.760.4767
GPHKRPL130.120.8110.710.0011
18S0.160.3862.080.2162
EF1A0.240.5241.590.0803
B2M0.250.6911.210.0134
Actin0.300.8581.980.0015
UBCE0.320.7721.360.0036
GAPDH0.450.7421.330.0067
Table
Table 6. The recommended comprehensive ranking of housekeeping genes based on three algorithm analyses in GPS and GPHK cells under normal conditions.
Table 6. The recommended comprehensive ranking of housekeeping genes based on three algorithm analyses in GPS and GPHK cells under normal conditions.
Cell LinesRanking OrdergeNormNormFinderBestKeeperRecommended Comprehensive Ranking
GPS118S/GAPDH18S/GAPDH18S18S
2 GAPDHGAPDH
3UBCEUBCEActinUBCE
4ActinActinUBCEActin
5EF1AEF1AEF1AEF1A
6B2MB2MB2MB2M
7RPL13RPL13RPL13RPL13
GPHK1RPL13/18SUBCERPL13RPL13
2 Actin18S18S
3EF1ARPL13EF1AEF1A
4UBCEEF1AB2MUBCE
5ActinB2MActinActin
6B2M18SUBCEB2M
7GAPDHGAPDHGAPDHGAPDH
Table
Table 7. The expression stability of housekeeping gene candidates in GPS and GPHK cells under stimulation with LPS or Poly I:C for 2, 4, 8 and 12 h, as assessed by NormFinder.
Table 7. The expression stability of housekeeping gene candidates in GPS and GPHK cells under stimulation with LPS or Poly I:C for 2, 4, 8 and 12 h, as assessed by NormFinder.
Cell LinesStimuliRanking Order1 2 3 4 5 6 7
GPSLPS2 hRPL13/Actin(0.002) 18S(0.211)UBCE(0.327)B2M(0.377)EF1A(0.393)GAPDH(0.820)
4 hRPL13(0.207)18S(0.209)EF1A(0.224)Actin(0.259)UBCE(0.264)B2M(0.306)GAPDH(0.384)
8 hRPL13/Actin(0.007) EF1A(0.047)B2M(0.075)UBCE(0.307)GAPDH(0.588)18S(1.299)
12 hGAPDH(0.114)B2M(0.203)RPL13(0.228)EF1A(0.273)Actin(0.345)UBCE(0.562)18S(0.725)
Poly I:C2 hUBCE/Actin(0.026) EF1A(0.066)RPL13(0.130)18S(0.385)B2M(0.508)GAPDH(0.848)
4 hUBCE/Actiin(0.010) 18S(0.164)EF1A(0.387)RPL13(0.412)GAPDH(0.605)B2M(0.662)
8 hActin(0.055)18S(0.207)UBCE(0.213)EF1A(0.299)RPL13(0.324)GAPDH(0.435)B2M(0.985)
12 hUBCE/EF1A(0.362) 18S(0.413)Actin(0.443)RPL13(0.508)GAPDH(0.535)B2M(0.634)
GPHKLPS2 h18S/Actin(0.003) RPL13(0.029)EF1A(0.210)B2M(0.228)UBCE(0.417)GAPDH(0.673)
4 h18S/Actin(0.002) EF1A(0.137)UBCE(0.223)B2M(0.256)RPL13(0.360)GAPDH(1.001)
8 hEF1A(0.030)UBCE(0.140)18S(0.142)RPL13(0.196)Actin(0.198)GAPDH(0.305)B2M(0.348)
12 hEF1A(0.001)18S(0.007)RPL13(0.020)UBCE(0.055)Actin(0.254)GAPDH(0.295)B2M(0.339)
Poly I:C2 hEF1A/Actin(0.001) B2M(0.040)UBCE(0.153)RPL13(0.154)GAPDH(0.354)18S(0.392)
4 hEF1A/RPL13(0.013) Actin(0.135)UBCE(0.374)18S(0.384)GAPDH(0.430)B2M(0.963)
8 hEF1A(0.010)RPL13(0.016)Actin(0.031)18S(0.114)UBCE(0.285)GAPDH(0.399)B2M(1.383)
12 hRPL13(0.052)EF1A(0.062)Actin(0.109)18S(0.199)UBCE(0.281)B2M(0.426)GAPDH(0.552)
Table
Table 8. The expression stability of housekeeping gene candidates in GPS and GPHK cells under stimulation with LPS or Poly I:C for 2, 4, 8 and 12 h, as assessed by BestKeeper analysis.
Table 8. The expression stability of housekeeping gene candidates in GPS and GPHK cells under stimulation with LPS or Poly I:C for 2, 4, 8 and 12 h, as assessed by BestKeeper analysis.
Cell LinesStimuliRanking
Order		GenesStandard Deviation (SD)Correlation Coefficient (r)Coefficient of Variation (CV)p-Value
GPS 2 h4 h8 h12 h2 h4 h8 h12 h2 h4 h8 h12 h2 h4 h8 h12 h2 h4 h8 h12 h
LPS1RPL13EF1AB2MRPL130.360.200.410.190.7680.6070.7670.4761.491.331.480.770.0740.2010.0750.341
2ActinRPL13EF1AB2M0.400.230.630.430.9680.4540.7570.7382.760.934.491.600.0020.3650.0810.094
3EF1A18SRPL1318S0.480.260.640.480.5940.7540.6740.0213.773.192.525.600.2130.0830.1430.970
418SActinActinGAPDH0.520.290.670.550.9230.7650.9140.8836.141.814.532.050.0090.0760.0110.020
5UBCEUBCEUBCEEF1A0.540.530.780.580.5440.6280.8070.7192.211.883.094.520.2630.1830.0520.107
6GAPDHB2M18SActin0.690.570.810.67−0.0220.619−0.1660.7122.832.059.174.460.9700.1890.7510.112
7B2MGAPDHGAPDHUBCE0.760.621.000.81−0.0590.7050.7790.6622.802.333.633.180.9100.1170.0670.151
Poly I:C118SUBCEUBCE18S0.390.170.260.290.7680.7370.4970.0614.930.640.993.430.0740.0950.3140.910
2UBCE18SActinUBCE0.460.180.270.320.5760.0120.7560.3681.922.211.731.190.2310.9850.0820.474
3EF1AActin18SEF1A0.480.250.300.350.9270.8410.7740.4883.691.573.642.590.0080.0360.0710.325
4ActinEF1AEF1AActin0.500.430.350.450.9720.3250.5860.5713.442.852.312.800.0010.5280.2210.237
5B2MRPL13GAPDHRPL130.580.430.460.590.0050.3180.3480.3382.201.741.642.460.9930.5400.5000.511
6RPL13GAPDHRPL13B2M0.590.520.560.690.7980.3650.8240.4142.471.952.132.600.0570.4790.0440.414
7GAPDHB2MB2MGAPDH0.790.690.910.700.0030.235−0.0790.6653.072.603.322.630.9930.6560.8810.150
GPHKLPS118S18S18S18S0.140.160.220.160.4960.7810.8380.3671.502.142.821.970.3180.0670.0370.474
2ActinActinActinEF1A0.150.210.260.220.7950.7930.8350.4901.071.491.731.540.0590.0600.0390.325
3RPL13B2MUBCERPL130.200.330.330.250.2850.567−0.1470.3221.201.721.461.550.5870.2400.7790.534
4B2MEF1AEF1AActin0.370.340.360.340.6260.1290.6630.5101.912.392.482.450.1830.8080.1510.300
5UBCEUBCERPL13B2M0.480.400.380.350.3090.5620.6490.0112.141.872.291.880.5510.2450.1620.985
6EF1ARPL13B2MUBCE0.480.400.390.500.4390.9070.0690.3373.152.601.852.110.3830.0130.8950.511
7GAPDHGAPDHGAPDHGAPDH0.560.820.490.66−0.083−0.5750.2070.7841.832.621.512.050.8730.2310.6960.065
Poly I:C1UBCE18S18SActin0.550.040.080.390.883−0.611−0.1060.3412.470.471.072.760.0200.1980.8440.506
2EF1AEF1AEF1ARPL130.690.480.250.400.8530.9780.4020.7294.803.331.702.450.0310.0010.4290.100
3ActinB2MActinEF1A0.690.530.290.430.913−0.3410.6090.9045.062.791.943.010.0110.5060.1980.013
4GAPDHActinUBCE18S0.700.550.360.440.6570.9910.4260.9492.353.761.575.570.1570.0010.4000.004
5B2MRPL13RPL13B2M0.750.570.370.460.9870.9530.4820.2573.953.482.162.480.0010.0030.3330.624
6RPL13UBCEGAPDHGAPDH0.990.710.610.590.9210.9590.672−0.1386.223.161.871.870.0090.0020.1430.793
718SGAPDHB2MUBCE1.050.751.180.600.9290.7220.055−0.56312.492.406.012.530.0070.1050.9180.245
Table
Table 9. The recommended comprehensive ranking of housekeeping genes based on three algorithm analyses in GPS and GPHK cells under stimulation with LPS and Poly I:C for 2, 4, 8 and 12 h.
Table 9. The recommended comprehensive ranking of housekeeping genes based on three algorithm analyses in GPS and GPHK cells under stimulation with LPS and Poly I:C for 2, 4, 8 and 12 h.
Cell LinesStimuliRanking OrdergeNormNormFinderBestKeeperRecommended Comprehensive Ranking
2 h4 h8 h12 h2 h4 h8 h12 h2 h4 h8 h12 h2 h4 h8 h12 h
GPSLPS1RPL13/ActinRPL13/18SRPL13/ActinRPL13/B2MRPL13/ActinRPL13RPL13/ActinGAPDHRPL13EF1AB2MRPL13RPL13RPL13RPL13RPL13
2 18S B2MActinRPL13EF1AB2MActin18SActinB2M
318sEF1AEF1AGAPDH18SEF1AEF1ARPL13EF1A18SRPL1318S18SEF1AEF1AGAPDH
4UBCEActinB2MEF1AUBCEActinB2MEF1A18SActinActinGAPDHUBCEActinB2MEF1A
5B2MUBCEUBCEActinB2MUBCEUBCEActinUBCEUBCEUBCEEF1AEF1AUBCEUBCEActin
6EF1AB2MGAPDHUBCEEF1AB2MGAPDHUBCEGAPDHB2M18SActinB2MB2MGAPDHUBCE
7GAPDHGAPDH18S18SGAPDHGAPDH18S18SB2MGAPDHGAPDHUBCEGAPDHGAPDH18S18S
Poly I:C1UBCE/ActinUBCE/ActinUBCE/18SUBCE/EF1AUBCE/ActinUBCE/ActinActinUBCE/EF1A18SUBCEUBCE18SUBCEUBCEUBCEUBCE
2 18S UBCE18SActinUBCEActinActin18SEF1A
3EF1A18SEF1A18SEF1A18SUBCE18SEF1AActin18SEF1AEF1A18SActin18S
4RPL13RPL13RPL13ActinRPL13EF1AEF1AActinActinEF1AEF1AActin18SEF1AEF1AActin
518SGAPDHActinRPL1318SRPL13RPL13RPL13B2MRPL13GAPDHRPL13RPL13RPL13RPL13RPL13
6B2MEF1AGAPDHGAPDHB2MGAPDHGAPDHGAPDHRPL13GAPDHRPL13B2MB2MGAPDHGAPDHGAPDH
7GAPDHB2MB2MB2MGAPDHB2MB2MB2MGAPDHB2MB2MGAPDHGAPDHB2MB2MB2M
GPHKLPS118S/Actin18S/Actin18S/UBCE18S/EF1A18S/Actin18S/ActinEF1AEF1A18S18S18S18S18S18S18S18S
2 UBCE18SActinActinActinEF1AActinActinUBCEEF1A
3RPL13UBCERPL13UBCERPL13EF1A18SRPL13RPL13B2MUBCERPL13RPL13UBCEEF1ARPL13
4B2MB2MActinRPL13EF1AUBCERPL13UBCEB2MEF1AEF1AActinB2MB2MActinUBCE
5UBCERPL13EF1AGAPDHB2MB2MActinActinUBCEUBCERPL13B2MUBCEEF1ARPL13Actin
6EF1AEF1AGAPDHActinUBCERPL13GAPDHGAPDHEF1ARPL13B2MUBCEEF1ARPL13GAPDHGAPDH
7GAPDHGAPDHB2MB2MGAPDHGAPDHB2MB2MGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHB2MB2M
Poly I:C1EFIA/ActinEF1A/RPL13EF1A/ActinEF1A/RPL13EF1A/ActinEF1A/RPL13EF1ARPL13UBCE18S18SActinEF1AEF1AEF1ARPL13
2 RPL13EF1AEF1AEF1AEF1ARPL13ActinRPL13ActinEF1A
3B2MActinRPL13ActinB2MActinActinActinActinB2MActinEF1AUBCEActinRPL13Actin
4UBCEUBCEUBCE18SUBCEUBCE18S18SGAPDHActinUBCE18SB2M18S18S18S
5RPL13GAPDHGAPDHUBCERPL1318SUBCEUBCEB2MRPL13RPL13B2MRPL13UBCEUBCEUBCE
6GAPDH18S18SB2MGAPDHGAPDHGAPDHB2MRPL13UBCEGAPDHGAPDHGAPDHB2MGAPDHB2M
718SB2MB2MGAPDH18SB2MB2MGAPDH18SGAPDHB2MUBCE18SGAPDHB2MGAPDH
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, N.; Zhang, H.; Zhu, L.; Hou, Y.; Wu, Y.; Cao, Z.; Sun, Y. Selection and Verification of Reference Genes for Gene Expression Studies in Different Cell Lines of Golden Pompano (Trachinotus ovatus). Fishes 2023, 8, 8. https://doi.org/10.3390/fishes8010008

AMA Style

Zhao N, Zhang H, Zhu L, Hou Y, Wu Y, Cao Z, Sun Y. Selection and Verification of Reference Genes for Gene Expression Studies in Different Cell Lines of Golden Pompano (Trachinotus ovatus). Fishes. 2023; 8(1):8. https://doi.org/10.3390/fishes8010008

Chicago/Turabian Style

Zhao, Na, Han Zhang, Lin Zhu, Yongwei Hou, Ying Wu, Zhenjie Cao, and Yun Sun. 2023. "Selection and Verification of Reference Genes for Gene Expression Studies in Different Cell Lines of Golden Pompano (Trachinotus ovatus)" Fishes 8, no. 1: 8. https://doi.org/10.3390/fishes8010008

Article Metrics

Back to TopTop