Next Article in Journal
Effects of Ozone Treatment on Postharvest Mucor Rot of Codonopsis pilosula Caused by Actinomucor elegans
Previous Article in Journal
Duration of Steam Distillation Affects Essential Oil Fractions in Immortelle (Helichrysum italicum)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 2
10.3390/horticulturae10020184
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Screening of Apple Cultivars for Scab Resistance in Kazakhstan

by
Aigul Madenova
1,2,
Zhankeldy Aitymbet
1,
Munira Bolat
2,
Dinara Kaldybayeva
1,
Kanat Galymbek
3,
Angsagan Kuan
2,
Balnur Kabylbekova
4,
Azhargul Irkitbay
1,
Tynyshbek Yeszhanov
5,
Serik Bakirov
3 and
Zagipa Sapakhova
6,*
1
Laboratory of Plant Microclonal Propagation, Kazakh National Agrarian Research University, Almaty 050010, Kazakhstan
2
Department of Biotechnology, Faculty of Biology and Biotechnology, Al-Farabi Kazakh National University, Almaty 050040, Kazakhstan
3
Institute of Natural Sciences and Geography, Abai Kazakh National Pedagogical University, Almaty 050010, Kazakhstan
4
Kazakh Fruit and Vegetable Research Institute, Almaty 050060, Kazakhstan
5
Kazakh Research Institute of Plant Protection and Quarantine Named by Zh. Zhiembayev, Almaty 050070, Kazakhstan
6
Institute of Plant Biology and Biotechnology, Almaty 050040, Kazakhstan
*
Author to whom correspondence should be addressed.
Horticulturae 2024, 10(2), 184; https://doi.org/10.3390/horticulturae10020184
Submission received: 19 December 2023 / Revised: 13 February 2024 / Accepted: 15 February 2024 / Published: 17 February 2024
(This article belongs to the Section Plant Pathology and Disease Management (PPDM))
Browse Figure
Versions Notes

Abstract

:
Scab, caused by Venturia inaequalis, is the most destructive fungal disease of apple worldwide. Apple scab incidence was studied in apple orchards in the south and southeast of Kazakhstan, including the Almaty, Zhambyl, and Turkestan regions, during 2022 and 2023. Disease incidence was higher in the Zhambyl region than in the Turkestan and Almaty regions in both years. The field evaluation suggested that 19 genotypes showed resistance to apple scab. Molecular screening was carried out using eight gene-specific molecular markers (AM19, CH05e03, OPL19, Hi07f02, AL07, K08, HB09, and CH02f06). The results of the molecular screening revealed that in 38 of the 45 studied cultivars, which included 11 Kazakh cultivars and 34 foreign cultivars, the Rvi (Rvi2, Rvi4, Rvi5, Rvi6, Rvi8, Rvi9, Rvi11, Rvi14, and Rvi15) resistance genes were amplified. Resistance genes such as Rvi2, Rvi4, Rvi6, and Rvi9 are still useful for breeding, but their use is recommended only in extended pyramids of multiple resistance genes. Several cultivars will be strong candidates for further breeding programs against apple scab and for the pyramiding of scab resistance genes in new cultivars.

1. Introduction

Apples (Malus domestica L.) are among the most important fruit crops grown worldwide. The apple cultivation area in Kazakhstan is 35.7 thousand hectares, or 75% of the total field area used for the production of stone and pome fruit crops [1]. The southern and southeastern regions of Kazakhstan have the most favorable climatic conditions for growing fruit crops, in particular apple trees. To enhance the economic efficiency of apple cultivation, a critical factor is the expansion of resistant cultivars. Resistant apple cultivars fulfill requirements such as productivity, fruit quality, and resistance to diseases for sustainable agriculture production [2].
In many regions of Kazakhstan, apple scab, caused by the ascomycete fungus Venturia inaequalis, is the most serious disease of apple [3]. Temperate regions with humid climates are highly favorable to this disease. In cases of severe infection, production losses of up to 70% have been reported [4,5]. Most of the commercial apple cultivars are susceptible to this disease, and growers must spray fungicides several times within a season [6,7,8,9]. Applying so many treatments raises ecological problems and consumer health concerns, in addition to the direct financial costs for growers. Pathogen resistance to fungicides has become a challenging problem in the control of diseases and has threatened the performance of some commercial fungicides [9]. Although some fungicides can still be effective against their target pathogens [10,11], the application of additional disease control strategies, such as sanitary measures in orchards, is essential. For example, leaf litter management [12,13,14,15] helps reduce disease severity and the risk of fungicide degradation. Furthermore, planting scab-resistant cultivars provides scab resistance in the long term to facilitate more sustainable apple production.
Knowledge of the pathogenicity and virulence factors needed for fungal infection is important because it represents the targets that will allow researchers to identify and deploy resistance genes against these microorganisms [16]. Phenotypically, the effects of resistance genes against V. inaequalis (Rvi) have been shown to cover a continuum from complete immunity to near-susceptibility depending on the genetic background, pathogen, and environment [17]. Currently, identifying the cultivars of apple crops that are resistant to the scab pathogen is a priority task [18].
Developing and cultivating a new apple cultivar takes a long time and involves many steps because of the biology of fruit plants. Apple trees take up to 8–10 years to fully mature, even when using early-fruiting initial forms. This limits the study of the source material using traditional genetic methods, which require not only the first seed hybrid generation but also the second and third [19,20]. A cultivated species with resistance against diseases provides an excellent opportunity to identify resistant genotypes and to use biodiversity to counter existing problems in fruit production.
Advances in technology have greatly improved the efficiency and accuracy of molecular markers, making them essential tools in plant breeding programs. Their origin, location in the genome, and the determined degree of resistance to the disease have been established [21]. Molecular markers have been developed for the most common resistance genes, which allows the identification of genotypes with target genes, their deployment in new plants, and targeted selection [22,23].
Twenty non-allelic genes that determine resistance to various scab races have been identified in apple trees, and highly informative DNA markers have been developed for most of them [24]. Molecular markers make it possible to evaluate hybrid families of seedlings for resistance in the very initial stages of plant development, significantly reducing the time needed to assess this important breeding trait.
According to a new nomenclature proposed by Bus et al. [17,25], apple scab resistance genes are named Rvik (R refers to the resistance gene, vi refers to Venturia inaequalis, and k refers to the differential host), and the corresponding Avr genes of the pathogen are named avrRvik.
Currently, 20 scab resistance genes have been identified [17,26]. The new and old names of the apple resistance genes, along with their differential hosts, are listed as Rvi1 (Vg), Rvi2 (Vh2) [21], Rvi3 (Vh3.1) [27], Rvi4 (Vh4/Vr1) [21], Rvi5 (Vm) [28], Rvi6 (Vf) [21], Rvi7 (Vfh) [29], Rvi8 (Vh8) [21], Rvi9 (Vdg) [27], Rvi10 (Va), Rvi11 (Vbj), Rvi12 (Vb), Rvi13 (Vd) [21], Rvi14 [30], Rvi15 (Vr2), Rvi16 (Vmis), Rvi17 (Va1) [17], and Vd3 [31].
Major genes such as Rvi2 [32,33,34], Rvi4 [34,35,36], and Rvi9 [21] have also been identified from different cultivars. The Rvi2 and Rvi4 genes have been mapped in the same linkage group (LG-2) at the distal end [21]. Molecular markers such as SSRs and SNPs have been identified and reported in several studies to detect these resistance genes [17,18,27,30,32,33,34]. The Rvi5 gene was shown to be responsible for resistance in Malus micromalus and Malus atrosanguinea 804 by Dayton and Williams [37]. Patocchi et al. [38] used a genome scanning approach (GSA) for the identification of the molecular markers associated with this gene. They developed the SSR marker Hi07h02, which is closely linked with Rvi5 on LG-17 at the distal end [28]. Recently, with the use of the apple genome as a reference, a 228 kb region likely containing the Rvi5 gene was identified [39]. Rvi6 was the first scab resistance gene identified from a wild relative (M. floribunda) of apples. This gene remains the most widely studied and characterized scab resistance gene in apples. It generally conditions a chlorotic reaction in resistant segregants. The molecular marker Al07 linked with this gene is positioned at 1.1 cM [40,41] and is closely linked on LG-1 [21]. The SCAR marker AL07 is located 0.2 cM from the gene [42]. The allele Rvi6 is determined by the presence of a 466 bp expected amplification product, while susceptible cultivars form a 724 bp product. The presence of both fragments indicates a heterozygous state for this gene [43]. Later, AM19 was found closer to a resistance gene than AL07 and was used for chromosome walking of the BAC library of ‘Florina’. The resistance conferred by this gene is influenced by the gene environment [44]. A new Rvi8 gene was discovered in M. sieversii accession W193B by Bus et al. [33]. It is closely linked with the Rvi2 gene on LG-2 at the lower end [21]. It was further observed that Rvi8 is overcome by race 8 of the V. inaequalis isolate NZ188B.2. In another study [27], the marker OPL19 SCAR was found to be closely related to both genes. OPL19-SCAR was initially used to identify the Rvi2 gene in the apple genome [32]. However, a separate scab resistance factor, Rvi8, was subsequently identified in the vicinity of the Rvi2 gene. It was found that the target product of the marker OPL19-SCAR—a 433 bp fragment—is amplified in carriers of the genes Rvi2 and Rvi8, demonstrating different degrees of resistance against artificial infection by individual scab races. According to the data, the two resistance genes (Rvi8 and Rvi2) are not dependent on one another [33]. The Rvi11 gene was identified in M. baccata by Dayton and Williams [45] and was mapped to the same LG (LG-2) [21]. Gygax et al. [46] developed the first molecular marker linked to this gene. Three SSR markers, namely CH02c06, CH05e03, and CH03d01, were developed. The Rvi11 gene has been mapped at about 0.6 cM [46]. Rvi15 was identified from the accession GMAL 1473, a clone of R12740-7A (Russian seedling) [47,48]. It was mapped on LG-2 (at the proximal end) [21] using the progeny of a cross between ‘Idared’ and GMAL 2473. Two closely associated markers were identified: CH02c02a and CH02f06 [36,47]. This is the most promising resistance gene that can be incorporated relatively quickly into a new cultivar in combination with other scab resistance genes for durable resistance [49]. It should be noted that depending on the parent forms, some seedlings that do not carry known resistance genes may be resistant to the pathogen due to the presence of other genetic determinants of resistance. As a result, three putative toll interleukin1 receptor–NBS-LRR resistance genes, namely, Rvi15-A, Rvi15-B, and Rvi15-C, were identified in this region.
Nowadays, virulent isolates have been shown to exist for most of the scab resistance genes used in apple breeding, including some carrying multiple virulence factors [17,50,51]. These findings highlight the need to breed for durable resistance. One way to achieve durable resistance is to pyramid multiple scab resistance genes in a cultivar, and it is desirable to combine several genetic factors that control immunity in one genotype [17].
This study presents the results of a molecular genetic analysis of apple cultivars to identify Rvi2, Rvi4, Rvi5, Rvi6, Rvi8, Rvi9, Rvi11, and Rvi15 genes that are promising for further breeding, determining their resistance to scab and the incidence of apple scab in the most important apple growing areas of Kazakhstan.

2. Materials and Methods

2.1. Disease Monitoring

Eight apple orchards in the Almaty, Turkestan, and Zhambyl regions (Table 1) were monitored for the incidence of apple scab through phytopathological studies in 2022 and 2023. A total of 45 apple cultivars, which included 11 Kazakh cultivars and 34 foreign cultivars, were investigated in the current study.

2.2. Field Evaluation

The phytopathological assessment was conducted from 10 June to 30 August in 2022 and 2023 to study the incidence of apple scab. The number of trees per cultivar for disease evaluation is presented in Table 1. The susceptible cultivars ‘Golden Delicious’ and ‘Idared’ served as positive controls. Scab incidence was defined as the percentage of infected leaves (infected leaves/all leaves). A leaf was considered infected if there were matte, olive green-to-black-colored lesions on it, indicating active sporulation [52].

2.3. Collection of Plant Materials, DNA Extraction, and Detection of Rvi Genes with Molecular Markers

Three leaf samples from each of three trees per cultivar were collected from apple orchards located in the Almaty, Zhambyl, and Turkestan regions and from the pomological garden of the Kazakh Fruit and Vegetable Research Institute. DNA was isolated from fresh leaves of apple cultivars. For the identification of the scab resistance genes Rvi2/Rvi8, Rvi2/Rvi4/Rvi9/Rvi11, Rvi5, Rvi11, Rvi14, and Rvi15, the following markers were applied: OPL19, CH05e03, Hi07h02, K08, HB09, and CH02f06, respectively. AL07 and AM19 SCAR markers were used to identify Rvi6 [17,18,27,30,43,46,53,54].
Extraction was conducted using the method of Doyle et al. [55] with a modification that included an additional purification of the samples. A modified CTAB method was used by introducing an additional component, polyvinylpyrrolidone (1%), into the composition of the lysis buffer, which provided a DNA yield of sufficient purity for PCR amplification.
The negative control for the studied loci was the cultivar ‘Golden Delicious’. Primer sequences and their sizes are shown in Table 2. The primers used in this study were synthesized by Sigma–Aldrich (Darmstadt, Germany). A 15 µL PCR reaction mixture contained 20 ng of genomic DNA, 1.5 µL of dNTPs, 2.5 µL of MgCL2, 10 µL of each primer, 1 µL of Taq polymerase, and 2.5 µL of 10x Taq buffer (+(NH4)2SO4, -KCL). All PCR components were manufactured by Thermo Fisher Scientific, Waltham, MA, USA. Amplification was carried out in a thermal cycler according to the following programs: marker CH05e03: 1 cycle, 2 min 30 s 94 °C, 33 cycles (30 s 94 °C, 30 s 55 °C, 1 min 72 °C), 5 min 72 °C; marker AL07-SCAR: 1 cycle 10 min 95 °C, 35 cycles (30 s 95 °C, 1 min 59 °C, 2 min 72), 10 min 72 °C; marker K08-SCAR: 1 cycle 5 min 94 °C, 35 cycles (40 s 94 °C, 1 min 64 °C, 2 min 72 °C), 10 min 72 °C; marker OPL19-SCAR: 1 cycle 2 min 45 s, 40 cycles (55 s 94 °C, 55 s 55 °C, 1 min 39 s 72 °C), 10 min 72 °C; marker Hi07f02-SSR: 1 cycle 2 min 30 s 94 °C, 30 cycles (30 s 94 °C, 45 s 56 °C, 1 min 72 °C),10 min 72 °C; marker AM19 SCAR: 1 cycle 5 min 94 °C, 35 cycles (1 min 94 °C, 1 min 58 °C, 2 min 72 °C), 7 min 72 °C; marker HB09-SSR: 1 cycle 5 min 94 °C, 35 cycles (40 s 94 °C, 1 min 64 °C, 1 min 72 °C), 10 min 72 °C; marker CH02f06-SSR: 1 cycle 3 min 94 °C, 39 cycles (30 s 94 °C, 1 min 55 °C, 1 min 72 °C), 10 min 72 °C. Agarose gel (2%) electrophoresis was used to separate DNA fragments. The Gene Ruler family of 100 bp DNA ladders (Thermo Fisher Scientific) was used to estimate the sizes of DNA samples.

2.4. Data analysis

Data analysis was performed based on the results of molecular analysis. The visualization of PCR products was achieved through electrophoresis. The banding pattern of each amplified PCR product was scored as “+”, indicating the presence of resistance, or “−”, indicating the absence of the resistance gene. Genetic distance was evaluated through Popgen software (version 1.32, Yeh et al., 2000 [56]) by calculating the Dice coefficient [57]. This calculated index was used to develop the Unweighted Pair Group Method with Arithmetic Mean (UPGMA). The dendrogram was drawn in Molecular Evolutionary Genetics Analysis (MEGA software, version 11, Tamura et al., 2021 [58]).

3. Results

3.1. Field Evaluation of Apple Cultivars for Scab Resistance

Apple scab did not develop in many of the orchard–year combinations included in this study (Table 3, Table 4 and Table 5). Specifically, the susceptible control ‘Idared’ developed disease only in 3 of 14 orchard–year combinations that included this cultivar. Similarly, the other susceptible control ‘Golden Delicious’ developed disease only in 10 of 16 orchard–year combinations. Based on the limited disease development, conclusions about phenotypic host resistance in the test cultivars must be interpreted with caution. Among the test cultivars, ‘Maksat’, ‘Kamila’, ‘Diana’, ‘Saltanat’, ‘Korey’, ‘Mutsu’, ‘Talgarskoye’, ‘Tulpan’, ‘Williams Pride’, ‘Piros’, ‘Honeycrisp’, ‘SuperChief’, SQ159 (Natyra), ‘Modi’, ‘Golden Resistant’, and ‘Prima’ did not develop scab in our trials. However, among these cultivars, only ‘Korey’ was tested in more than two orchard–year combinations. Several other cultivars developed low levels of disease incidence (5% or less), with the caveat of low disease pressure across most trials as explained above.

3.2. Molecular Screening of Apple Cultivars for Scab Resistance

As a result of the molecular screening of the 45 Kazakh and foreign cultivars, it was found that 38 apple cultivars contained Rvi resistance genes. To identify carriers of the Rvi2 + Rvi8 gene, PCR analysis of apple genotypes was carried out using the SCAR marker OPL19 (Table 6), which had an expected PCR product size of 433 bp. The presence of the OPL19-SCAR marker in the genomes of the cultivars ‘Prima’ and ‘Modi’ was previously confirmed by other researchers [21,22,49,50]. We showed that 24 apple cultivars are carriers of this gene: ‘Ainur’, ‘Aigul’, ‘Kamila’, ‘Diana’, ‘Saltanat’, ‘Korey’, ‘Mutsu’, ‘Landsberger Renette’, ‘Star Crimson’, ‘Stark’s Earliest’, ‘Talgarskoye’, ‘Williams Pride’, ‘Gala’, ‘Idared’, ‘Pink Lady’, ‘Braeburn’, ‘Jeromine’, ‘SuperChief’, SQ159 (Natyra), ‘Fuji’, ‘Pinova’, ‘Modi’, ‘Voskhod’, and ‘Prima’.
The SSR molecular marker CH05e03 was developed for Rvi11 by Gygax et al. [46]. This marker has been mapped to LG-2 of the apple genome [39]. To identify the Rvi2 + Rvi4 + Rvi9 + Rvi11 gene, the expected amplification fragment sizes of CH05e03 were 163, 172, 169, and 160 bp, respectively. A 163 bp PCR product is characteristic of Rvi2 gene carriers [27,46]. Seven apple cultivars, i.e., ‘Ainur’, ‘Aigul’, ‘Kandil Sinap’, ‘Stark’s Earliest’, ‘Fuji’, ‘Pinova’, and ‘Prima’, were found to be carriers of Rvi2. Rvi4 was detected in 14 apple cultivars, i.e., ‘Zaman’, ‘Saltanat’, ‘Kandil Sinap’, ‘Granny Smith’, ‘Stark’s Earliest’, ‘Gala’, ‘Pink Lady’, ‘Braeburn’, ‘Honeycrisp’, ‘Jeromine’, ‘SuperChief’, ‘Fuji’, ‘Pinova’, and ‘Modi’, forming a band measuring 172 bp. For Rvi9 gene carriers, the amplification fragment measured 169 bp, and this fragment was detected in 13 apple cultivars: ‘Zaman’, ‘Saltanat’, ‘Granny Smith’, ‘Star Crimson’, ‘Stark’s Earliest’, ‘Pestrushka’, ‘Pink Lady’, ‘Piros’, ‘Braeburn’, ‘Honeycrisp’, ‘Fuji’, ‘Modi’, and ‘Quinte’. The Rvi11 gene was only detected in the ‘Modi’ cultivar, and the expected amplification fragment was 160 bp.
The molecular marker Hi07h02 was designed for Rvi5 by Patocchi et al. in 2009 [27]. The expected size of the amplification fragments was 220 bp. Nine apple cultivars were classified as carriers of this gene: ‘Diana’, ‘Danalyk’, ‘Saltanat’, ‘Stark’s Earliest’, ‘Williams Pride’, ‘Idared’, ‘Jeromine’, ‘SuperChief’, and ‘Deljonca’.
The primer AL07 is codominant, AM19 is dominant, and both are specific to the Rvi6 gene. The AL07 primer amplifies 466 bp (resistant) and 724 bp products linked to pathogen susceptibility, while the AM19 primer amplifies a 526 bp fragment associated with resistance. The resistance gene Rvi6 was detected in six cultivars (‘Danalyk’, ‘Williams Pride’, SQ159 (Natyra), ‘Santana’, ‘Modi’, and ‘Prima’) using the AL07 and AM19 markers.
PCR amplification using the SCAR primer K08 was performed to identify carriers of the Rvi11 gene. The expected size of the amplification fragment was 743 bp. The Rvi11 resistance gene was detected in 20 cultivars: ‘Kamila’, ‘Diana’, ‘Saltanat’, ‘Kandil Sinap’, ‘Granny Smith’, ‘Korey’, ‘Mutsu’, ‘Star Crimson’, ‘Stark’s Earliest’, ‘Talgarskoye’, ‘Williams Pride’, ‘Pestrushka’, ‘Idared’, ‘Jeromine’, ‘SuperChief’, ‘Red Topaz’, SQ159 (Natyra), ‘Pinova’, ‘Voskhod’, and ‘Red Delicious’.
PCR amplification using the SSR primer HB09 was performed to identify carriers of the Rvi14 gene. The expected size of the amplification fragment was 210 bp. The Rvi14 resistance gene was detected in 14 cultivars, i.e., ‘Aigul’, ‘Zaman’, ‘Kamila’, ‘Korey’, ‘Stark’s Earliest’, ‘Talgarskoye’, ‘Williams Pride’, ‘Pestrushka’, ‘Idared’, ‘Pink Lady’, ‘Piros’, ‘Jeromine’, ‘SuperChief’, and ‘Red Topaz’.
To identify carriers of the Rvi15 gene, PCR amplification was performed using the SSR primer CH02f06. The expected size of the amplification fragment was 158 bp. The Rvi15 resistance gene was detected in 14 cultivars, i.e., ‘Ainur’, ‘Maksat’, ‘Kamila’, ‘Kandil Sinap’, ‘Stark’s Earliest’, ‘Talgarskoye’, ‘Gala’, ‘Piros’, ‘Braeburn’, ‘Wilton’s Star’, ‘Red Topaz’, SQ159 (Natyra), ‘Deljonca’, and ‘Pinova’.
UPGMA cluster analysis based on the presence or absence of resistance genes revealed that SQ159 (Natyra) and ‘Williams Pride’ formed a distinct cluster. The remaining 43 cultivars formed two large subclusters, one with 20 cultivars and the other with 23 cultivars. Several genotypes clustered together closely, including Malus sieversiii and ‘Golden Delicious’ (Figure 1).

4. Discussion

Progress in fruit breeding strongly depends on the availability of a rich diversity of genetic resources [3].
Many resistance genes have been identified from apple germplasm and are effective against only a few isolates V. inaequalis [59]. Hence, such resistance genes may not be suitable for apple breeding against scab. Because the Rvi2 gene and the Rvi4 gene give resistance that has been overcome by race 2 [32,34] and isolate 1797-9 [34,35,36], respectively, highly informative SNPs for Rvi2 (FBsnRvi2-7 and FBsnRvi2-8) and Rvi4 (FBsnRvi4-1, ARGH37, and TNL1) have been developed.
Up to now, V. inaequalis isolates have commonly been used in genetic experiments for their known specific ability to overcome one of the apple scab resistance genes represented in the differential host set [17]. The identification of differential hosts with monogenic resistances will assist in the monitoring of pathogen populations to determine the potential of specific Rvi genes, currently the main sources of resistance in apple breeding. The Rvi9 gene generally conditions a chlorotic reaction in resistant segregants. Caffier et al. reported that Rvi9 gene resistance has been overcome by V. inaequalis isolate 1639 [50]. However, isolate 1639 has not spread and therefore has a limited presence in apple growing areas [27]. Bus et al. showed that isolate 1639 has also overcome the Rvi2 gene [17]. Rvi9 as well as Rvi2 and Rvi8 map to the same genomic region of apple and condition very similar stellate necrotic resistance reactions [17,33,58]. The study by Luby et al. in the Silk Road apple collection of Malus sieversii from Central Asia demonstrated that Rvi8 is prevalent in the Kazakh accessions sampled [60]. In our study, this gene was found in six Kazakh local cultivars (‘Ainur’, ‘Aigul’, ‘Kamila’, ‘Saltanat’, ‘Talgarskoe’, and Voskhod’). The Rvi15 gene provides full resistance to apple scab [48], and there are no reports yet on the breaking of this resistance. In the present study, this gene was identified in four Kazakh local cultivars (‘Ainur’, ‘Maksat’, ‘Kamila’, and ‘Talgarskoe’).
‘Aport’ is the most used cultivar in Kazakh apple breeding as a donor of the taste qualities of fruits and frost resistance, and ‘Aport’ has the scab resistance genes Rvi2 + Rvi8 and Rvi11 [61]. The results of our previous research on ‘Aport’ x M. sieversii scion–rootstock combinations showed resistance to powdery mildew and scab at the beginning of fruiting over 3 years [62].
Based on foliar resistance reactions, apple R genes can be grouped into three predominant resistance classes exhibiting distinctive resistance responses: the classical hypersensitive response (HR), in which fungal growth is normally terminated very rapidly on penetration, e.g., conditioned by Rvi4, Rvi5 [63], Rvi7, Rvi10, Rvi15 [17,64], and Rvi16 [17]; responses involving limited subcuticular growth inducing stellate necrosis, e.g., conditioned by Rvi2, Rvi3, Rvi8 [17,33], Rvi9, Rvi11 (stellate necrosis/chlorosis), and Rvi13 [17]; and chlorosis, often accompanied by limited sporulation and therefore providing only partial resistance, e.g., conditioned by Rvi6, Rvi12, Rvi14, and Rvi17 [17]. Rvi1 is considered ineffective as a resistance gene because the complementary race (1) is predominant in the European V. inaequalis population [65], which explains the highly susceptible status of cv. ‘Golden Delicious’. On the other hand, resistance genes in our study such as Rvi2, Rvi4, Rvi6, and Rvi9 are still useful for breeding, but their use is recommended only in extended pyramids of ≥3 resistance genes [66].
Our molecular studies suggest that most cultivars in the three study regions possess resistance genes, including ‘Maksat’ (Rvi15), ‘Kamila’ (Rvi2/Rvi8, Rvi11, Rvi14, Rvi15), ‘Diana’ (Rvi2/Rvi8, Rvi5, Rvi11), ‘Saltanat’ (Rvi2/Rvi8, Rvi4, Rvi9, Rvi5, Rvi11), ‘Korey’ (Rvi2/Rvi8, Rvi11, Rvi14), ‘Mutsu’ (Rvi2/Rvi8, Rvi11), ‘Talgarskoye’ (Rvi2/Rvi8, Rvi11, Rvi14, Rvi15), ‘Williams Pride’ (Rvi2/Rvi8, Rvi5, Rvi6, Rvi11, Rvi14), ‘Piros’ (Rvi9, Rvi14, Rvi15), ‘Honeycrisp’ (Rvi4, Rvi9), ‘SuperChief’ (Rvi2/Rvi8, Rvi4, Rvi5, Rvi11, Rvi14), SQ159 (Natyra) (Rvi2/Rvi8, Rvi6, Rvi11, Rvi15), ‘Modi’ (Rvi2/Rvi8, Rvi4, Rvi6, Rvi9, Rvi11), and ‘Prima’ (Rvi2/Rvi8, Rvi2, Rvi6). Only in Malus sieversii, ‘Golden Delicious’, ‘Tulpan’, ‘Nikola’, ‘Jonagold’, ‘Babuskino’, and ‘Golden Resistant’ were we not able to identify any previously studied resistance gene. These genotypes may have another unstudied resistance gene.
Many breeding programs worldwide are aiming at breeding for durable disease resistance against apple scab [67]. Until now, most of the scab-resistant cultivars that have been released carry only Rvi6 [66]. However, the value of the resistance mediated by Rvi6 is weakened by the occurrence of the avrRvi6 races of the pathogen in Europe [65] and the US [10], which can break the resistance of Rvi6. Therefore, the use of single R genes of durable resistance is not effective in the long term, which suggests a combination of different R genes for new cultivars, as carried out in pyramidization breeding programs [3]. Several Rvi genes described to date, including Rvi5, Rvi11, Rvi12, Rvi14, and Rvi15, confer durable resistance to scab; therefore, they are of special interest for resistance breeding [66]. The obtained data are important for identifying new donors for optimizing key stages of the breeding process for long-term resistance to the pathogen by pyramiding target genes.

5. Conclusions

This study monitored the incidence of apple scab in three regions in the south and southeast of Kazakhstan. Using field evaluation and molecular analysis, this study sought to identify the apple genotypes most resistant to scab among Kazakh and foreign cultivars. The promising gene sources Rvi2/Rvi8, Rvi2/Rvi4/Rvi9/Rvi11, Rvi5, Rvi11, Rvi14, and Rvi15 were identified for molecular screening.
It has been established that 24 apple cultivars are carriers of the Rvi2/Rvi8 gene, i.e., ‘Ainur’, ‘Aigul’, ‘Kamila’, ‘Diana’, ‘Saltanat’, ‘Korey’, ‘Mutsu’, ‘Landsberger Renette’, ‘Star Crimson’, ‘Stark’s Earliest’, ‘Talgarskoye’, ‘Williams Pride’, ‘Gala’, ‘Idared’, ‘Pink Lady’, ‘Braeburn’, ‘Jeromine’, ‘SuperChief’, SQ159 (Natyra), ‘Fuji’, ‘Pinova’, ‘Modi’, ‘Voskhod’, and ‘Prima’. Apple cultivars such as ‘Ainur’, ‘Aigul’, ‘Kandil Sinap’, ‘Stark’s Earliest’, ‘Fuji’, ‘Pinova’, and ‘Prima’ were found to be carriers of the Rvi2 gene using the marker CH05e03. Rvi4 gene carriers were detected in 14 apple cultivars: ‘Zaman’, ‘Saltanat’, ‘Kandil Sinap’, ‘Granny Smith’, ‘Stark’s Earliest’, ‘Gala’, ‘Pink Lady’, ‘Braeburn’, ‘Honeycrisp’, ‘Jeromine’, ‘SuperChief’, ‘Fuji’, ‘Pinova’, and ‘Modi’. Thirteen apple cultivars were found to be Rvi9 gene carriers, i.e., ‘Zaman’, ‘Saltanat’, ‘Granny Smith’, ‘Star Crimson’, ‘Stark’s Earliest’, ‘Pestrushka’, ‘Pink Lady’, ‘Piros’, ‘Braeburn’, ‘Honeycrisp’, ‘Fuji’, ‘Modi’, and ‘Quinte’. However, the Rvi11 gene was detected only in the ‘Modi’ cultivar. The Rvi5 gene was found in ‘Diana’, ‘Danalyk’, ‘Saltanat’, ‘Stark’s Earliest’, ‘Williams Pride’, ‘Idared’, ‘Jeromine’, ‘SuperChief’, and ‘Deljonca’. The resistance gene Rvi6 was detected in six cultivars, i.e., ‘Danalyk’, ‘Williams Pride’, SQ159 (Natyra), ‘Santana’, ‘Modi’, and ‘Prima’, using the AL07 and AM19 markers. The Rvi11 resistance gene was detected in 20 cultivars: ‘Kamila’, ‘Diana’, ‘Saltanat’, ‘Kandil Sinap’, ‘Granny Smith’, ‘Korey’, ‘Mutsu’, ‘Star Crimson’, ‘Stark’s Earliest’, ‘Talgarskoye’, ‘Williams Pride’, ‘Pestrushka’, ‘Idared’, ‘Jeromine’, ‘SuperChief’, ‘Red Topaz’, SQ159 (Natyra), ‘Pinova’, ‘Voskhod’, and ‘Red Delicious’. The Rvi14 resistance gene was detected in 14 cultivars, i.e., ‘Aigul’, ‘Zaman’, ‘Kamila’, ‘Korey’, ‘Stark’s Earliest’, ‘Talgarskoye’, ‘Williams Pride’, ‘Pestrushka’, ‘Idared’, ‘Pink Lady’, ‘Piros’, ‘Jeromine’, ‘SuperChief’, and ‘Red Topaz’. The Rvi15 resistance gene was detected in 14 cultivars, i.e., ‘Ainur’, ‘Maksat’, ‘Kamila’, ‘Kandil Sinap’, ‘Stark’s Earliest’, ‘Talgarskoye’, ‘Gala’, ‘Piros’, ‘Braeburn’, ‘Wilton’s Star’, ‘Red Topaz’, SQ159 (Natyra), ‘Deljonca’, and ‘Pinova’.

Author Contributions

Writing—Original Draft Preparation, A.M.; Investigation, Z.A., M.B. and A.I.; Investigation and Formal Analysis, D.K.; Project Administration and Funding Acquisition, K.G.; Software, A.K.; Methodology and Resources, B.K.; Data Curation, S.B.; Resources and Data Curation, T.Y.; Conceptualization and Writing—Review and Editing, Z.S. All authors reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Project of the Ministry of Science and Higher Education of the Republic of Kazakhstan by Grant AP13068068 “Molecular screening and selection of resistant varieties of apple tree to fungal diseases using DNA-marker technology” (2022–2024).

Data Availability Statement

The data presented in this study are available on request from the first author (Aigul Madenova) or the corresponding author (Zagipa Sapakhova). The data are not publicly available due to ethical reasons.

Acknowledgments

The authors would like to thank the Laboratory of Plant Microclonal Propagation of Kazakh National Agrarian Research University and the Laboratory of Fruit Genetic Resources of Kazakh Fruit and Vegetable Research Institute for assistance in conducting this study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kairova, G.; Daulet, N.; Solomadin, M.; Sandybayev, N.; Orkara, S.; Beloussov, V.; Kerimbek, N.; Gritsenko, D.; Sapakhova, Z. Identification of Apple Cultivars Resistant to Fire Blight (Erwinia amylovora) Using Molecular Markers. Horticulturae 2023, 9, 1000. [Google Scholar] [CrossRef]
  2. Kairova, G.; Pozharskiy, A.; Daulet, N.; Solomadin, M.; Sandybayev, N.; Khusnitdinova, M.; Nizamdinova, G.; Sapakhova, Z.; Gritsenko, D. Evaluation of Fire Blight Resistance of Eleven Apple Rootstocks Grown in Kazakhstani Fields. Appl. Sci. 2023, 13, 11530. [Google Scholar] [CrossRef]
  3. Höfer, M.; Flachowsky, H.; Schröpfer, S.; Peil, A. Evaluation of Scab and Mildew Resistance in the Gene Bank Collection of Apples in Dresden-Pillnitz. Plants 2021, 10, 1227. [Google Scholar] [CrossRef]
  4. MacHardy, W. Inheritance of resistance to Venturia inaequalis. In Apple Scab, Biology, Epidemiology and Management; APS: St. Paul, MN, USA, 1996; pp. 61–103. [Google Scholar]
  5. Schubert, K.; Anja, R.; Uwe, B. A monograph of Fusicladium s. lat. (hyphomycetes). Schlechtendalia 2003, 9, 1–132. [Google Scholar]
  6. Beresford, R.; Wright, P.; Wood, P.; Park, N. Sensitivity of Venturia inaequalis to myclobutanil penconazole and dodine in relation to fungicide use in hawkes bay apple orchards. N. Z. Plant Prot. 2012, 65, 106–113. [Google Scholar] [CrossRef]
  7. Chapman, K.S.; Sundin, G.W.; Beckerman, J.L. Identification of resistance to multiple fungicides in field populations of Venturia inaequalis. Plant Dis. 2011, 95, 921–926. [Google Scholar] [CrossRef]
  8. Frederick, Z.A.; Villani, S.M.; Cooley, D.R.; Biggs, A.R.; Raes, J.J.; Cox, K.D. Prevalence and stability of qualitative QoI resistance in populations of Venturia inaequalis in the northeastern United States. Plant Dis. 2014, 98, 1122–1130. [Google Scholar] [CrossRef]
  9. Ayer, K.M.; Villani, S.M.; Choi, M.W.; Cox, K.D. Characterization of the VisdhC and VisdhD genes in Venturia inaequalis, and sensitivity to fluxapyroxad, pydiflumetofen, inpyrfluxam, and benzovindiflupyr. Plant Dis. 2019, 103, 1092–1100. [Google Scholar] [CrossRef]
  10. Beckerman, J.; Chatfield, J.; Draper, E. A 33-year Evaluation of Resistance and Pathogenicity in the Apple Scab–crabapples Pathosystem. HortSci. Horts 2009, 44, 599–608. [Google Scholar] [CrossRef]
  11. van den Bosch, F.; Blake, J.; Gosling, P.; Helps, J.C.; Paveley, N. Identifying when it is financially beneficial to increase or decrease fungicide dose as resistance develops: An evaluation from long-term field experiments. Plant Pathol. 2020, 69, 631–641. [Google Scholar] [CrossRef]
  12. Holb, I.J. Effect of six sanitation treatments on leaf litter density, ascospore production of Venturia inaequalis and scab incidence in integrated and organic apple orchards. Eur. J. Plant Pathol. 2006, 115, 293–307. [Google Scholar] [CrossRef]
  13. Holb, I.J. Effect of four non-chemical sanitation treatments on leaf infection by Venturia inaequalis in organic apple orchards. Eur. J. Hortic. Sci. 2007, 72, 60. [Google Scholar]
  14. tSaoir, S.M.A.; Cooke, L.R. The effects of leaf litter treatments, post-harvest urea and omission of early season fungicide sprays on the overwintering of apple scab on Bramley’s Seedling grown in a maritime environment. Ir. J. Agric. Food Res. 2010, 49, 55–66. [Google Scholar]
  15. Porsche, F.M.; Pfeiffer, B.; Kollar, A. A New Phytosanitary Method to Reduce the Ascospore Potential of Venturia inaequalis. Plant Dis. 2017, 101, 414–420. [Google Scholar] [CrossRef]
  16. Acero, F.J.; Carbú, M.; El-Akhal, M.R.; Garrido, C.; González-Rodríguez, V.E.; Cantoral, J.M. Development of proteomics-based fungicides: New strategies for environmentally friendly control of fungal plant diseases. Int. J. Mol. Sci. 2011, 12, 12795–12816. [Google Scholar] [CrossRef]
  17. Bus, V.G.M.; Rikkerink, E.H.; Caffier, V.; Durel, C.-E.; Plummer, K.M. Revision of the nomenclature of the differential host-Pathogen interactions of Venturia inaequalis and Malus. Annu. Rev. Phytopathol. 2011, 49, 391–413. [Google Scholar] [CrossRef]
  18. Gross, B.L.; Kellogg, E.A.; Miller, A.J. Speaking of food: Connecting basic and applied plant science. Am. J. Bot. 2014, 101, 1597–1600. [Google Scholar] [CrossRef]
  19. Peace, C.P.; Luby, J.J.; van de Weg, W.E.; Bink, M.C.A.M.; Iezzoni, A.F. A strategy for developing representative germplasm sets for systematic QTL validation, demonstrated for apple, peach, and sweet cherry. Tree Gen. Genom. 2014, 10, 1679–1694. [Google Scholar] [CrossRef]
  20. Kabylbekova, B.; Kovalchuk, I.; Mukhitdinova, Z.; Turdiyev, T.; Kairova, G.; Madiyeva, G.; Reed, B.M. Reduced major minerals and increased minor nutrients improve micropropagation in three apple cultivars. In Vitr. Cell. Dev. Biol.-Plant 2020, 56, 335–349. [Google Scholar] [CrossRef]
  21. Gessler, C.; Patocchi, A.; Sansavini, S.; Tartarini, S.; Gianfranceschi, L. Venturia inaequalis resistance in apple. Crit. Rev. Plant Sci. 2006, 25, 473–503. [Google Scholar] [CrossRef]
  22. Liang, W.; Dondini, L.; De Franceschi, P.; Paris, R.; Silviero, S.; Tartarini, S. Genetic diversity, population structure and construction of a core collection of apple cultivars from Italian germplasm. Plant Mol. Biol. Rep. 2015, 33, 458–473. [Google Scholar] [CrossRef]
  23. Baumgartner, I.O.; Kellerhals, M.; Costa, F.; Dondini, L.; Pagliarani, G.; Gregori, R.; Tartarini, S.; Leumann, L.; Laurens, F.; Patocchi, A. Development of SNP-based assays for disease resistance and fruit quality traits in apple (Malus × domestica Borkh.) and validation in breeding pilot studies. Tree Genet. Genomes 2016, 12, 35. [Google Scholar] [CrossRef]
  24. Khajuria, Y.P.; Kaul, S.; Wani, A.A.; Dhar, M.K. Genetics of resistance in apple against Venturia inaequalis (Wint) Cke. Tree Genet. Genomes 2018, 14, 1–20. [Google Scholar] [CrossRef]
  25. Bus, V.; Rikkerink, E.; Aldwinckle, H.S.; Caffier, V.; Durel, C.E.; Gardiner, S.; Gessler, C.; Groenwold, R.; Laurens, F.; Cam, B.L.; et al. A proposal for the nomenclature of Venturia inaequalis races. Acta Hortic. 2009, 814, 739–746. [Google Scholar] [CrossRef]
  26. Soriano, J.M.; Madduri, M.; Schaart, J.G.; Burgh, A.; Kaauwen, M.V.; Tomić, L.; Groenwold, R.; Velasco, R.; Weg, E.V.; Schouten, H.J. Fine mapping of the gene Rvi18 (V25) for broad-spectrum resistance to apple scab, and development of a linked SSR marker suitable for marker-assisted breeding. Mol. Breed. 2014, 34, 2021–2032. [Google Scholar] [CrossRef]
  27. Patocchi, A.; Frei, A.; Frey, J.E.; Kellerhals, M. Towards improvement of marker assisted selection of apple scab resistant cultivars: Venturia inaequalis virulence surveys and standardization of molecular marker alleles associated with resistance genes. Mol. Breed. 2009, 24, 337–347. [Google Scholar] [CrossRef]
  28. Cheng, F.S.; Weeden, N.F.; Brown, S.K.; Aldwinckle, H.S.; Gardiner, S.E.; Bus, V.G. Development of a DNA marker for Vm, a gene conferring resistance to apple scab. Genome 1998, 41, 208–214. [Google Scholar] [CrossRef]
  29. Durel, C.E.; Freslon, V.; Denancé, C.; Laurens, F.; Lespinasse, Y.; Rat, E.; Parisi, L.; Bus, V.; Dapena de la Fuente, E.; Miñarro, M.; et al. Genetic localisation of new major and minor pest and disease factors in the apple genome. In Proceedings of the 3rd Rosaceae Genomics Conference, Napier, New Zealand, 19–22 March 2006. [Google Scholar]
  30. Soufflet-Freslon, V.; Gianfranceschi, L.; Patocchi, A.; Durel, C.-E. Inheritance studies of apple scab resistance and identification of Rvi14, a new major gene that acts together with other broad-spectrum QTL. Genome 2008, 51, 657–667. [Google Scholar] [CrossRef]
  31. Soriano, J.M.; Joshi, S.G.; van Kaauwen, M.; Noordijk, Y.; Groenwold, R.; Henken, B.; van de Weg, W.E.; Schouten, H.J. Identification and mapping of the novel apple scab resistance gene Vd3. Tree Genet. Genomes 2009, 5, 475–482. [Google Scholar] [CrossRef]
  32. Bus VGMRikkerink, E.H.A.; EW van de Weg Rusholme, R.L.; Gardiner, S.E.; Bassett, H.C.M.; Kodde, L.P.; Parisi, L.; Laurens, F.N.D.; Meulenbroek, E.; Plummer, K.M. The Vh2 and Vh4 scab resistance genes in two differential hosts derived from Russian apple R12740-7A map to the same linkage group of apple. Mol. Breed. 2005, 15, 103–116. [Google Scholar] [CrossRef]
  33. Bus, V.G.M.; Laurens, F.N.D.; van de Weg, W.E.; Rusholme, R.L.; Rikkerink, E.H.A.; Gardiner, S.E.; Bassett, H.C.M.; Kodde, L.P.; Plummer, K.M. The Vh8 locus of a new gene for gene interaction between Venturia inaequalis and the wild apple Malus sieversii is closely linked to the Vh2 locus in Malus pumila R12740-7A. New Phytol. 2005, 166, 1035–1049. [Google Scholar] [CrossRef]
  34. Jansch, M.; Broggini, G.A.; Weger, J.; Bus, V.G.; Gardiner, S.E.; Bassett, H.; Patocchi, A. Identification of SNPs linked to eight apple disease resistance loci. Mol. Breed. 2015, 35, 45. [Google Scholar] [CrossRef]
  35. Baldi, P.; Patocchi, A.; Zini, E.; Toller, C.; Velasco, R.; Komjanc, M. Cloning and linkage mapping of resistance gene homologues in apple. Theor. Appl. Genet. 2004, 109, 231–239. [Google Scholar] [CrossRef]
  36. Galli, P.; Broggini, G.A.L.; Kellerhals, M.; Gessler, C.; Potachi, A. High resolution genetic map of the Rvi15 (Vr2) apple scab resistance locus. Mol. Breed. 2010, 26, 561–572. [Google Scholar] [CrossRef]
  37. Dayton, D.F.; Williams, E.B. Additional allelic genes in Malus for scab resistance of two reaction types. J. Am. Soc. Hortic. Sci. 1970, 95, 735–736. [Google Scholar] [CrossRef]
  38. Patocchi, A.; Walser, M.; Tartarini, S.; Broggini, G.A.L.; Gennari, F.; Sansavini, S.; Gessler, C. Identification by genome scanning approach (GSA) of a microsatellite tightly associated with the apple scab resistance gene Vm. Genome 2005, 48, 630–636. [Google Scholar] [CrossRef]
  39. Bandara, N.L.; Cova, V.; Tartarini, S.; Gessler, C.; Patocchi, A.; Cestaro, A.; Troggio, M.; Velasco, R.; Komjanc, M. Isolation of Rvi5 (vm) locus from Malus × domestica ‘Murray’. Acta Hortic. 2015, 1100, 21–24. [Google Scholar] [CrossRef]
  40. Vinatzer, B.A.; Zhang, H.B.; Sansavini, S. Construction and characterization of a bacterial artificial chromosome library of apple. Theor. Appl. Genet. 1998, 97, 1183–1190. [Google Scholar] [CrossRef]
  41. Patocchi, A.; Gianfranceschi, L.; Gessler, C. Towards the map-based cloning of Vf: Fine and physical mapping of the Vf region. Theor. Appl. Genet. 1999, 99, 1012–1017. [Google Scholar] [CrossRef]
  42. Xu, M.L.; Korban, S.S. Saturation mapping of the apple scab resistance gene Vf using AFLP markers. Theor. Appl. Genet. 2000, 101, 844–851. [Google Scholar] [CrossRef]
  43. Patrascu, B.; Pamfil, D.; Sestras, R.E.; Botez, C.; Gaboreanu, I.; Barbos, A.; Qin, C.; Rusu, R.A.; Bondrea, I.; Dirle, E. Marker assisted selection for response attack of Venturia inaequalis in different apple genotypes. Not. Bot. Hort. Agrobot. Cluj-Napoca 2006, 34, 121–132. [Google Scholar]
  44. Chizzali, C.; Gusberti, M.; Schouten, H.J.; Gessler, C.; Broggini, G.A. Cisgenic Rvi6 scab-resistant apple lines show no differences in Rvi6 transcription when compared with conventionally bred cultivars. Planta 2016, 243, 635–644. [Google Scholar] [CrossRef]
  45. Dayton, D.F.; Williams, E.B. Independent genes in Malus for resistance to Venturia inaequalis. Proc. Am. Soc. Hortic. Sci. 1968, 92, 89–94. [Google Scholar]
  46. Gygax, M.; Gianfranceschi, L.; Liebhard, R.; Kellerhals, M.; Gessler, C.; Patocchi, A. Molecular markers linked to the apple scab resistance gene Vbj derived from Malus baccata jackii. Theor. Appl. Genet. 2004, 109, 1702–1709. [Google Scholar] [CrossRef]
  47. Patocchi, A.; Bigler, B.; Liebhard, R.; Koller, B.; Gessler, C. Mapping of Vr 2, a third apple scab resistance gene of Russian seedling (R12740-7A). Plant Anim. Genomes XI Conf. Poster 2003, 540. [Google Scholar]
  48. Patocchi, A.; Bigler, B.; Koller, B.; Kellerhals, M.; Gessler, C. A new apple scab resistance gene. Theor. Appl. Genet. 2004, 109, 1087–1092. [Google Scholar] [CrossRef]
  49. Peil, A.; Howard, N.P.; Bühlmann-Schütz, S.; Hiller, I.; Schouten, H.; Flachowsky, H.; Patocchi, A. Rvi4 and Rvi15 are the same apple scab resistance genes. Mol. Breed. 2023, 43, 74. [Google Scholar] [CrossRef]
  50. Caffier, V.; Patocchi, A.; Expert, P.; Bellanger, M.N.; Durel, C.E.; Hilber-Bodmer, M.; Broggini, G.A.L.; Groenwold, R.; Bus, V.G. Virulence characterization of Venturia inaequlis reference isolates on the differential set of Malus hosts. Plant Dis. 2015, 99, 370–375. [Google Scholar] [CrossRef]
  51. Peil, A.; Patocchi, A.; Hanke, M.; Bus, V.G. Apple cultivar Regia possessing both Rvi2 and Rvi4 resistance genes is the source of a new race of Venturia inaequalis. Eur. J. Plant Pathol. 2018, 151, 533–539. [Google Scholar] [CrossRef]
  52. Papp, D.; Gangadharappa Harigondra, S.; Paredes, C.; Karacs-Végh, A.; Penksza, K.; T.-Járdi, I.; Papp, V. Strong genetic differentiation between generalist populations of Venturia inaequalis and populations from partially resistant apple cultivars carrying Rvi3 or Rvi5. Diversity 2022, 14, 1050. [Google Scholar] [CrossRef]
  53. Silfverberg-Dilworth, E.; Matasci, C.L.; Van de Weg, W.E.; Van Kaauwen, M.P.W.; Walser, M.; Kodde, L.P.; Soglio, V.; Gian-franceschi, L.; Durel, C.E.; Costa, F.; et al. Microsatellite markers spanning the apple (Malus domestica Borkh.) genome. Tree Genet. Genomes 2006, 2, 202–224. [Google Scholar] [CrossRef]
  54. Tartarini, S.; Gianfranceschi, L.; Sansavini, S.; Gessler, C. Development of reliable PCR markers for the selection of the Vf gene conferring scab resistance in apple. Plant Breed. 1999, 118, 183–186. [Google Scholar] [CrossRef]
  55. Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
  56. Yeh, F.C.; Yang, R.; Boyle, T.J.; Ye, Z.; Xiyan, J.M. PopGene32, Microsoft Windows-Based Freeware for Population Genetic Analysis, Version 1.32; Molecular Biology and Biotechnology Centre, University of Alberta: Edmonton, AB, Canada, 2000. [Google Scholar]
  57. Dice, I.R. Measures of the amount of ecologic association between species. Ecology 1945, 26, 297–302. [Google Scholar] [CrossRef]
  58. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  59. Broggini, G.A.L.; Bus, V.G.; Parravicini, G.; Kumar, S.; Groenwold, R.; Gessler, C. Mapping of 14 avirulence genes in an EU-B04 × 1639 progeny of Venturia inaequalis. Fungal Genet. Biol. 2011, 48, 166–176. [Google Scholar] [CrossRef]
  60. Luby, J.J.; Forsline, P.; Aldwinckle, H.; Bus, V.; Geibel, M. Silk road apples collection, evaluation, and utilization of Malus sieversii from Central Asia. HortScience 2001, 36, 225–231. [Google Scholar] [CrossRef]
  61. Omasheva, M.Y.; Pozharskiy, A.S.; Maulenbay, A.D.; Ryabushkina, N.A.; Galiakparov, N.N. SSR genotyping of Kazakhstan apple cultivars: Identification of alleles associated with resistance to highly destructive pathogens. Biot. Theory Pract. 2016, 2, 46–58. [Google Scholar] [CrossRef]
  62. Sagi, S.; Svetlana, D.; Moldir, Z.; Aigul, M.; Zhanna, I.; Balnur, K. Physiological and phytopathological assessment scion-rootstock combinations for apple cv. Aport and M. sieversii. Res. Crop. 2022, 23, 795–800. [Google Scholar] [CrossRef]
  63. Win, J.; Greenwood, D.R.; Plummer, K.M. Characterisation of a protein from Venturia inaequalis that induces necrosis in Malus carrying the Vm resistance gene. Physiol. Mol. Plant Pathol. 2003, 62, 193–202. [Google Scholar] [CrossRef]
  64. Galli, P.; Broggini, G.A.L.; Gessler, C.; Patocchi, A. Phenotypic characterization of the Rvi15 (Vr2) apple scab resistance. Plant Pathol. 2010, 92, 219–226. [Google Scholar]
  65. Parisi, L.; Fouillet, V.; Schouten, H.J.; Groenwold, R.; Laurens, F.; Didelot, F.; Evans, K.; Fischer, C.; Gennari, F.; Kemp, H.; et al. Variability of the pathogenicity of Venturia inaequalis in Europe. Acta Hortic. 2004, 663, 107–113. [Google Scholar] [CrossRef]
  66. Patocchi, A.; Wehrli, A.; Dubuis, P.-H.; Auwerkerken, A.; Leida, C.; Cipriani, G.; Passey, T.; Staples, M.; Didelot, F.; Philion, V.; et al. Ten years of VINQUEST: First insight for breeding new apple cultivars with durable apple scab resistance. Plant Dis. 2020, 104, 2074–2081. [Google Scholar] [CrossRef] [PubMed]
  67. Peil, A.; Kellerhals, M.; Höfer, M.; Flachowsky, H. Apple breeding from the origin to genetic engineering. Agric. Food Sci. Biol. Environ. Sci. 2011, 5, 118–138. [Google Scholar]
Horticulturae 10 00184 g001
Figure 1. UPGMA (Unweighted Pair–Cluster Method using Arithmetic Averages) dendrogram based on the presence or absence of apple scab resistance genes in 45 apple cultivars or accessions assessed in southern and southeastern Kazakhstan.
Figure 1. UPGMA (Unweighted Pair–Cluster Method using Arithmetic Averages) dendrogram based on the presence or absence of apple scab resistance genes in 45 apple cultivars or accessions assessed in southern and southeastern Kazakhstan.
Horticulturae 10 00184 g001
Table 1. Experimental sites included in this study.
Table 1. Experimental sites included in this study.
Breeding ProgramGeographical Site *CoordinatesPrecipitation
May–August (mm)		Number of Trees for Sampling **
Kazygurt district, Kyzylkiyan rural district, “Akniyet Agro Orchard” LLPTurkestan regionN 41°36′8.594″
E 69°21′58.013″		926.88
Saryagash district, Zhemisti rural areas, Regional Branch, “Saryagash” LLC, “Kazakh Fruit and Vegetable Research Institute” (KazF&VRI)Turkestan regionN 41°32′2.545″
E 69°21′36.069″		902.88
Tulkubas district, Shakpak Baba rural areas, “Koktal” Peasant FarmTurkestan regionN 41°29′2.69″
E 70°31′11.46″		945.38
Merke district, Merke rural areas, “Merke experimental farm” LLPZhambyl regionN 42°48′.584″
E 73°10′.387″		925.23
Yenbekshikazakh district, Baidibek bi rural areas, “Akkazy” Peasant FarmAlmaty regionN 43°39′.930″
E 77°86′.171″		902.88
Yenbekshikazakh district, Baidibek bi rural areas, “Ermek” Peasant FarmAlmaty regionN 43°32′49.344″
E 77° 52′ 3.468″		906.98
Yenbekshikazakh district, Koram rural areas, “Zhetysu Trade”Almaty regionN 43°31′48.31″
E 78°11′48.09″		908.99
Talgar District, Regional Branch, “Talgar” of KazF&VRI (Pomological Garden)Almaty regionN 43°17′27″
E 77°12′15″		90.3645
* Site names are used in the following tables and text to identify the respective breeding programs. ** Number of trees used for disease assessment.
Table 2. Characteristics of molecular markers for apple scab resistance genes.
Table 2. Characteristics of molecular markers for apple scab resistance genes.
Resistance GenesMarker NameMarker TypeSize of Allele (bp)Primer Sequence (5′→3′)References
Rvi6 (Vf) AM19SCAR526F: CGTAGAACGGAATTTGACAGTG
R: GACAAGGGCTTAAGTGCTCC		Bus et al. [17,18]
Rvi2,
Rvi4,
Rvi9,
Rvi11		CH05e03SSR172F: CGAATATTTTCACTCTGACTGGG
R: CAAGTTGTTGTACTGCTCCGAC		Gygax et al. [46]
Patocci et al. [27]
Rvi2,
Rvi8		OPL19SCAR433F: ACCTGCACTACAATCTTCACTAATC
R: GACTCGTTTCCACTGAGGATATTTG		Bus et al. [17]
Patocci et al. [27]
Rvi5Hi07f02SSR226F: ATTTGGGGTTTCAACAATGG
R: GTTTCGGACATCAAACAAATGTGC		Silfverberg-Dilworth et al. [53]
Rvi6AL07SCAR466F: TGGAAGAGAGATCCAGAAAGTG
R: CATCCCTCCACAAATGCC		Tartarini et al. [54]
Rvi11K08SCAR743F: GAACACTGGGCAAAGGAAAC
R: TAAAAGCCACGTTCTCTCGC		Gygax et al. [46]
Rvi14HB09SSR210F: GCTCAAAATACTGAAGCCTTGC
R: GGGGAAGCAGGATGGTTACT		Soufflet et al. [30]
Patocchi et al. [27]
Rvi15CH02f06SSR147F: CCCTCTTCAGACCTGCATATG
R: ACTGTTTCCAAGCGCTCAGG		Patocci et al. [48]
Patocci et al. [27]
Table 3. Results of monitoring apple genotypes for scab disease incidence (%) in the Turkestan region.
Table 3. Results of monitoring apple genotypes for scab disease incidence (%) in the Turkestan region.
Turkestan Region
Akniyet Agro Orchards, Kazygurt DistrictSaryagash, Saryagash DistrictKoktal, Tulkubas District
202220232022202320222023
Star Crimson8.75018.759.3700
Idared20.8800000
Gala5.6200000
Fuji000000
Golden Delicious0021.259.2200
Pink Lady000000
Landsberger Renette0020.6519.3600
Table 4. Results of monitoring apple genotypes for scab disease incidence (%) in the Almaty region.
Table 4. Results of monitoring apple genotypes for scab disease incidence (%) in the Almaty region.
Almaty Region
Akkazy, Yenbekshikazakh District Ermek, Yenbekshikazakh DistrictZhetysu Trade, Yenbekshikazakh DistrictTalgar, Talgar District
20222023202220232022202320222023
Ainur-*-----4.980
Aigul------4.690
Maksat------00
Zaman------5.060
Kamila------00
Diana------00
Malus sieversii------10.634.29
Danalyk------5.030
Saltanat------00
Kandil Sinap------4.385.63
Golden Delicious21.8810.63009.364.3848.7528.75
Granny Smith------10.089.63
Korey00000000
Mutsu------00
Landsberger Renette------4.685.06
Star Crimson19.484.38000009.68
Stark’s Earliest----9.799.885.069.38
Talgarskoye------00
Tulpan------00
Williams Pride------00
Gala00009.365.054.9827.90
Pestrushka------4.380
Idared0000005.039.65
Pink Lady------4.890
Piros------00
Braeburn------5.030
Honeycrisp------00
Jeromine------4.830
SuperChief------00
Wilton’s Star------4.780
Red Topaz------54.970
SQ159 (Natyra)------00
Santana------4.780
Deljonca------4.380
Fuji0000004.789.48
Pinova------5.03
Nicola------18.7019.86
Modi (Rvi6 control)------00
Quinte00009.894.894.780
Jonagold------20.054.38
Voskhod------4.980
Babuskino------21.384.38
Red Delicious00004.684.4849.500
Golden Resistant------00
Prima (Rvi6 control)------00
* “-” means that these genotypes were not grown in the Almaty region.
Table 5. Results of monitoring apple genotypes for scab disease incidence (%) in the Zhambyl region.
Table 5. Results of monitoring apple genotypes for scab disease incidence (%) in the Zhambyl region.
Zhambyl Region
Merke Experimental Farm, Merke District
20222023
Red Delicious29.754.63
Star Crimson19.659.63
Golden Delicious19.864.38
Table 6. Results of the identification of scab resistance genes of apple genotypes.
Table 6. Results of the identification of scab resistance genes of apple genotypes.
CultivarOrigin *Rvi2/Rvi8Rvi2Rvi4Rvi9Rvi11Rvi5Rvi6Rvi11Rvi14Rvi15
OPL19CH05e03Hi07f02AL07AM19K08HB09CH02f06
433 bp163 bp172 bp169 bp160 bp220 bp466 bp526 bp743 bp210 bp135–158 bp
AinurKZ+ **+− **−−−−−−−+
AigulKZ++−−−−−−−+−
MaksatKZ−−−−−−−−−−+
ZamanKZ−−++−−−−−+−
KamilaKZ+−−−−−−−+++
DianaRU+−−−−+−−+−−
Malus sieversiiKZ−−−−−−−−−−−
DanalykKZ−−−−−+++−−−
SaltanatKZ+−++−+−−+−−
Kandil SinapUA−++−−−−−+−+
Golden DeliciousUS−−−−−−−−−−−
Granny SmithAU−−++−−−−+−−
KoreyJP+−−−−−−−++−
MutsuJP+−−−−−−−+−−
Landsberger RenetteDE+−−−−−−−−−−
Star CrimsonUS+−−+−−−−+−−
Stark’s EarliestUS++++−+−−+++
TalgarskoyeKZ+−−−−−−−+++
TulpanKZ−−−−−−−−−−−
Williams PrideUS+−−−−+++++−
GalaNZ+−+−−−−−−−+
PestrushkaRU−−−+−−−−++−
IdaredUS+−−−−+−−++−
Pink LadyAU+−++−−−−−+−
PirosDE−−−+−−−−−++
BraeburnNZ+−++−−−−−−+
HoneycrispUS−−++−−−−−−−
JeromineUS+−+−−+−−++−
SuperChiefUS+−+−−+−−++−
Wilton’s StarNL−−−−−−−−−−+
Red TopazCZ−−−−−−−−+++
SQ159 (Natyra)DE+−−−−−+++−+
SantanaNL−−−−−−++−−−
DeljoncaDE−−−−−+−−−−+
FujiJP++++−−−−−−−
PinovaDE+++−−−−−+−+
NicolaCA−−−−−−−−−−−
Modi (Rvi6 control)IT+−+++−++−−−
QuinteCA−−−+−−−−−−−
JonagoldUS−−−−−−−−−−−
VoskhodKZ+−−−−−−−+−−
BabuskinoRU−−−−−−−−−−−
Red DeliciousUS−−−−−−−−+−−
Golden ResistantUS−−−−−−−−−−−
Prima (Rvi6 control)US++−−−−++−−−
* KZ—Kazakhstan; RU—Russia; UA—Ukraine; US—United States; AU—Australia; JP—Japan; DE—Germany; NZ—New Zealand; NL—the Netherlands; CZ—Czech Republic; IT—Italy; CA—Canada. ** “+”—amplification; “−”—no amplification.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Madenova, A.; Aitymbet, Z.; Bolat, M.; Kaldybayeva, D.; Galymbek, K.; Kuan, A.; Kabylbekova, B.; Irkitbay, A.; Yeszhanov, T.; Bakirov, S.; et al. Screening of Apple Cultivars for Scab Resistance in Kazakhstan. Horticulturae 2024, 10, 184. https://doi.org/10.3390/horticulturae10020184

AMA Style

Madenova A, Aitymbet Z, Bolat M, Kaldybayeva D, Galymbek K, Kuan A, Kabylbekova B, Irkitbay A, Yeszhanov T, Bakirov S, et al. Screening of Apple Cultivars for Scab Resistance in Kazakhstan. Horticulturae. 2024; 10(2):184. https://doi.org/10.3390/horticulturae10020184

Chicago/Turabian Style

Madenova, Aigul, Zhankeldy Aitymbet, Munira Bolat, Dinara Kaldybayeva, Kanat Galymbek, Angsagan Kuan, Balnur Kabylbekova, Azhargul Irkitbay, Tynyshbek Yeszhanov, Serik Bakirov, and et al. 2024. "Screening of Apple Cultivars for Scab Resistance in Kazakhstan" Horticulturae 10, no. 2: 184. https://doi.org/10.3390/horticulturae10020184

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop