q-PCR Methodology for Monitoring the Thermophilic Hydrogen Producers Enriched from Elephant Dung

Abstract

This study aims to create a quantitative polymerase chain reaction (q-PCR) methodology for monitoring the hydrogen-producing mixed cultures enriched from elephant dung using alpha-cellulose as a carbon source through five generations of repetitive sub-culture. The enriched thermophilic mixed cultures from the fifth cultivation cycle gave the highest hydrogen yield of 170.3 mL H₂/g cellulose and were used to generate hydrogen from sawdust. Clostridium sp. and Thermoanaerobacterium sp. were the dominant bacteria in thermophilic mixed cultures with high hydrogen yield, according to polymerase chain reaction-denatured gradient gel electrophoresis (PCR-DGGE). q-PCR primers Chis150F and ClostIR, TherF and TherR, and BacdF and BacdR were developed to amplify the 16S rRNA genes of Clostridium sp., Thermoanaerobacterium sp., and Bacillus sp., respectively, for the quantification of hydrogen-producing bacteria in biohydrogen fermentation. Similar q-PCR analysis of Clostridium sp., Thermoanaerobacterium sp., and Bacillus sp. 16S rRNA gene amplification during hydrogen production from cellulose and sawdust revealed increasing gene copy number with time. The molecular approaches developed in this study can be used to monitor microbial communities in hydrogen fermentation processes efficiently.

1. Introduction

Recent years have seen a greater focus of research efforts on the production and utilization of alternative fuels to reduce dependency on fossil fuels. Hydrogen production via biological processes that utilize organic materials is a sustainable alternative source of renewable energy that is cost-effective [1] and environment-friendly [2]. Biological hydrogen production processes are broadly classified into biophotolysis, photo fermentation, and dark fermentation processes. The latter process produces hydrogen from organic waste and thus has the double advantage of potentially reducing waste disposal problems and decreasing the cost of raw materials [3]. Thus, biological hydrogen production promotes the waste-to-energy concept, rapidly increasing commercial hydrogen applications as biofuels globally [1]. Organic waste materials such as lignocellulosic waste are potential low-cost renewable raw material sources for biological hydrogen production [4]. Lignocellulosic biomass contains a high content of cellulose, hemicellulose, and lignin, which serve as carbon sources for the release of hydrogen by microorganisms. Various lignocellulosic waste has been widely used as feedstock for hydrogen production via dark fermentation. These include barley hulls, rice straw, corn stalks, and oil palm residues with hydrogen yields of 27.8 mL H₂/g_substrate [5], 24.8 mL H₂/g_substrate [6], 142.9 mL H₂/g_substrate [7] and 59.2 mL H₂/g_substrate [8], respectively. However, the recalcitrance of lignocellulosic biomass is a major challenge in its conversion to bio-hydrogen by microorganisms. Consequently, the successful use of lignocellulosic biomass as a substrate for bio-hydrogen production requires the utilization of microorganisms with enhanced digestive abilities. In this study, elephant dung was used as a source of microorganisms capable of utilizing lignocellulosic biomass to produce hydrogen. In general, elephants consume lignocellulosic biomass as their primary diet; thus, the microorganisms in the digestive tract may contain the enzyme for lignocellulosic biomass digestion.

Many microbial species, including Clostridia and Thermoanaerobacterium species, are efficient hydrogen producers under thermophilic conditions via the degradation of various types of carbohydrates. Clostridium sp. is the most researched bacterial genera in dark fermentative hydrogen production [3]. Thermoanaerobacterium sp. has been established as a highly efficient hydrogen producer in thermophilic hydrogen production [9,10,11]. In addition, various studies have reported using mixed microorganism cultures from anaerobic sludge, hot spring sediment, compost, and animal dung as inoculum for fermentative hydrogen production [12,13]. These approaches are more practical than the utilization of pure cultures since they result in more efficient substrate degradation [14]. However, properly comprehending the microbial community and its various functions is essential to improving the efficiency and stability of the hydrogen production process. To this end, numerous approaches, including molecular approaches, have been developed and applied [15].

Several molecular approaches based on 16S rRNA genes, including fluorescence in situ hybridization (FISH) [16], denaturing gradient gel electrophoresis (DGGE) [17], and shotgun sequencing of total DNA metagenomics [18] have been used to study hydrogen producers. Even though these techniques provide information that aids the characterization of microbial communities in mixed cultures, they are time-consuming and labor-intensive, rendering them impractical for high sample throughput and real-time assays [19]. The rapid development of quantitative polymerase chain reaction (q-PCR) has successfully overcome these limitations and may be considered a potential technique to monitor process performance. To our knowledge, the q-PCR methodology for quantifying thermophilic hydrogen producers utilizing lignocellulosic biomass to produce hydrogen is still underdeveloped.

Therefore, the present study aimed to develop a quantification methodology using q-PCR approaches to quantify and monitor thermophilic hydrogen-producing bacteria enriched from the elephant dung. Our findings can be applied to other research studies aiming to produce and develop alternative sources of green fuel, especially biohydrogen.

2. Materials and Methods

2.1. Substrate

Sawdust was used as the substrate for hydrogen production and was collected from a local wood factory in Nongkai province, Thailand, air dried, and stored in a plastic box until further use. The sawdust composition was determined to be 40.06% cellulose, 27.00% hemicelluloses, and 32.95% lignin.

2.2. Inoculum and Culture Enrichment

Hydrogen-producing bacteria were enriched from elephant dung collected from an elephant village in Surin province, Northeastern Thailand. The elephant dung was chopped with a knife and heat-treated in a hot air oven at 105 °C for 2 h to inhibit the activity and growth of methanogens. Subsequently, it was enriched with 5 g/L alpha-cellulose as a carbon source in a basic anaerobic medium (BA) containing in g/L 1.0 NH₄Cl, 0.1 NaCl, 0.1 MgC_l2·6H₂O, 0.05 CaCl₂·2H₂O, 0.4 K₂HPO₄·3H₂O, 2.6 NaHCO₃, 1.0 Yeast extract, 1.0 Peptone, 0.25 Na₂S, and 1 mL/L trace element solution. The trace element solution comprised in g/L 0.002 FeC_l2·4H₂O, 0.00005 H₃BO₃, 0.00005 ZnCl₂, 0.000038 CuCl₂·2H₂O, 0.00005 MnCl₂·4H₂O, 0.00005(NH₄)6Mo₇O₂₄·4H₂O, 0.00005 AlCl₃, 0.00005 CoC_l2·6H₂O, 0.000092 NiCl₂·6H₂O, 0.0005 ethylenediaminetetraacetate, 0.0001 Na₂SeO₃·5H₂O, and 1 mL concentrated HCl [20]. Serum bottles with a total volume of 120 mL and a working volume of 70 mL were used for enrichment. The initial pH of the medium in the serum bottles was adjusted to 7.0 with 2 M HCl or NaOH and flushed with N₂ gas for 5 min to obtain anaerobic conditions, followed by incubation at 55 °C for 4 days. The enriched cultures were diluted at each enrichment cycle to 50% v/v in a fresh BA medium. This process was repeated five times to establish a stable microbial community. Each cycle of enriched cultures was monitored for hydrogen gas generation, and all samples were analyzed for soluble metabolite products (SMPs) and microbial community. The final enrichment cultures (fifth batch cycle) were used further as inoculum for hydrogen production from sawdust.

2.3. Bio-Hydrogen Fermentation from Sawdust

Bio-hydrogen fermentation was performed in serum bottles with a total volume of 80 mL and a working volume of 40 mL, using 12 mL final enrichment cultures as inoculum and 12.5 g/L sawdust as substrate. The initial pH was adjusted to 7.0 with 3 M NaOH and 3 M HCl. All bottles were subsequently purged with nitrogen gas for 5 min to ensure anaerobic conditions. Later, the serum bottles were sealed with a rubber septum and aluminum crimp caps and placed in a 55 °C incubator for 7 days. All treatments were conducted in triplicate. The BA medium without sawdust was used as a control to account for the background production of hydrogen. In addition, the biogas volume and composition were routinely monitored. The hydrogenic effluent was collected and analyzed for SMPs at the end of the fermentation process. Simultaneously, sludge was collected and analyzed for the microbial community responsible for hydrogen production using polymerase chain reaction-denatured gradient gel electrophoresis (PCR-DGGE).

2.4. Analytical Methods

The volume of biogas in the headspace was measured with a wetted glass syringe. The hydrogen content was analyzed with gas chromatography (GC-8APT, Shimadzu, Kyoto, Japan) equipped with a thermal conductivity detector (TCD) and a Shin Carbon column. The GC operational conditions followed were identical to those reported by O-Thong et al. [11]. For the SMPs (ethanol (EtOH), acetic acid (Hac), propionic acid (HPr), butyric acid (HBu), lactic acid (HLa)) analysis, hydrogenic effluent was centrifuged at 10,000 rpm for 5 min, acidified with 0.2 N oxalic acid, and filtered through a 0.2 μm nylon membrane. The resulting filtrate was analyzed on a GC instrument (GC-8APF, Shimadzu, Japan) with a flame ionization detector (FID) and a Unisole F-200 glass column. The GC operation conditions were set as previously reported by O-Thong et al. [11]. The HLa concentration was analyzed by high-performance liquid chromatography (HPLC; LC-10AD, Shimadzu, Kyoto, Japan) with an Aminex HPX-87H column and a UV detector. The HPLC operating conditions were based on those reported in a previous study [21]. Cumulative hydrogen production was calculated using the mass balance equation [22] to measure headspace gas composition and the total volume of biogas produced during each time interval. The hydrogen production yield was calculated as the cumulative hydrogen production divided by the amount of cellulose or sawdust added (mL H₂/g_cellulose or mL H₂/g_sawdust). The hydrogen production rate was calculated as the cumulative hydrogen production divided by the fermentation time (mL H₂/L·d).

2.5. PCR-DGGE Analysis

Triplicate sludge samples were collected from the end of bio-hydrogen fermentation to investigate the microbial community structure. DNA quality was assessed on a 1% agarose gel before PCR-DGGE analysis. The 16S rRNA gene was amplified from genomic DNA of sludge samples using the universal bacterial primers, 518r (5′ ATTACCGAGCTGCTGG 3′) and 357f (5′ CCTACGGGAGGCAGCAG 3′ with 40 bp GC-clamp). [23]. Amplification mixtures for bacteria were TopTaq™ Master Mix Kit (Qiagen, Hilden, Germany) with a final volume of 25 μL. The reaction mixture has a final concentration of TopTaq DNA Polymerase, PCR Buffer, dNTP, and primers of 1.25 units, 1×, 200 µM, and 0.2 µM, respectively. PCR amplification of bacterial DNA began with an initial denaturation of 94 °C for 3 min followed by 34 cycles of three steps: 94 °C for 1 min, 53 °C for 1 min, and 72 °C for 2 min, and final extension at 72 °C for 10 min. PCR products were analyzed by 1.5% agarose gel electrophoresis before DGGE analysis.

The DGGE analysis of PCR products was performed using a vertical Dcode Universal Mutation Detection System (Bio-Rad, Hercules, CA, USA) with 8% (v/v) polyacrylamide gels and a denaturant gradient of 30–60% (100% denaturing solution containing 7 M of urea and 40% formamide). The gel was run at 60 °C in 0.5X tris-acetate EDTA (TAE) buffer at 70 V for 16 h. DGGE gels were stained with SYBR Green for 15 min and analyzed on a GelDoc XR 1708170 system (Bio-Rad Laboratories, Hertfordshire, UK). DGGE profiles were compared using the Quantity One software package (version 4.6.0; Bio-Rad Laboratories). Most bands were excised from the gel and re-amplified with the forward primer 357f without a GC clamp and the reverse primer 518r. After re-amplification, PCR products were purified using Takara SUPRECTM-PCR (Takara Bio, Shiga, Japan). A Sanger sequencing was performed with an automated DNA sequencer using the BigDye Terminator v3.1 cycle sequencing kit. Then Sanger sequencing products were purified by using traditional ethanol precipitation. Subsequently, the closest matches for partial 16S rRNA gene sequences were identified in the GenBank database using the web-based basic local alignment tool (BLAST).

2.6. q-PCR Analysis

The DNA standard for q-PCR was extracted from pure cultures of Thermoanaerobacterium sp., Clostridium sp., and Bacillus sp. Cells were harvested in microcentrifuge tubes by centrifugation at 10,000 rpm for 5 min. The cell pellets were re-suspended in 1 mL of tris-EDTA (TE) buffer. Total genomic DNA was extracted and purified using the QIAamp DNA Stool Mini Kit (QIAgen, Hilden, Germany). Triplicate sludge samples were collected from elephant dung in each repetitive sub-culture (C1-C5) and cell culture of biohydrogen fermentation (3, 6, and 9 days) to quantify the Thermoanaerobacterium sp., Clostridium sp., and Bacillus sp. in it. Specific degenerate primers were designed to amplify a nucleotide sequence of the bacterial 16S rRNA gene from hydrogen-producing bacteria [21]. Specific degenerated primers were designed to amplify a nucleotide sequence of the 16S rRNA gene according to the o nucleotide sequence of Thermoanaerobacterium thermosaccharolyticum (accession number AF247003) and Bacillus licheniformis (accession number AF516176) using NCBI Primer-BLAST Designers (http://www.ncbi.nlm.nih.gov/tools/primer-blast/ accessed on 17 September 2022). Based on the alignment, the primer set was designed to conserve sequences region of genes from the two strains. The pairs of primer gave PCR product range from 70–110 base pair and were selected to perform real-time PCR system. The primer name and sequence were used in this study as shown in

Table 1. Primers targeted to 16S rRNA were used for q-PCR in this study.

Organism Name	Primer Name	Sequence (5′→3′)	Coverage (%)	Specificity (%)	Sequence Length (bp)	References
Clostridium sp.	Chis150F	AAAGGRAGATTAATACCGCATAA	88.6	99.6	540	[25]
	ClostIR	TTCTTCCTAATCTCTACGCA
Thermoanaerobacterium sp.	TherF	GTGGAGAACACGGAGGAAGG	21.3	100	93	This study
	TherR	CCCTCTGTTCAGGCCATTGT
Bacillus licheniformis	BacdF	TGGCTCAGGACGAACGCTG	100	100	82	This study
	BacdR	CCGCTGACCTAAGGGAGCAA

. Primer specificities towards 16S rDNA of Clostridium sp., Thermoanaerobacterium sp., and Bacillus sp. were evaluated using arb-silva (https://www.arb-silva.de/search/testprime/ accessed on 17 September 2022), an in-silico PCR analysis tool which uses 16S/18S rDNA non-redundant reference dataset, SSURef 108 NR [24]. q-PCR was performed using Chromo 4 real-time PCR (Bio-Rad, Hercules, CA, USA) in 96-well PCR plates. Standard curves were constructed with ten-fold dilutions of genomic DNA from 16S rDNA PCR amplification. Stock concentrations (gene copies µ/L) were determined via PicoGreen measurement and freshly prepared ten-fold dilutions were used in order to build the calibration curve. The wells were sealed with optical flat cap strips (Bio-Rad), and each 25 μL q-PCR reaction mixture contained 12.5 μL SYBR Green (IQ, Biorad, Hercules, CA, USA), 0.25 μL each of 0.25 μM forward and reverse primers, 11 μL sterile water, and 1 μL genomic DNA as a template. The q-PCR program began with initial denaturing at 95 °C for 3 min, followed by 39 cycles of denaturation at 95 °C for 45 s, annealing for 1 min at 57 °C for all primers set, and extension at 72 °C for 7 min. The PCR was completed with a melting analysis starting from 60 °C to 99 °C with temperature increments of 0.2 °C and a transition rate of 5 s to check for product specificity and primer dimer formation. The purity of PCR products was also checked by 1% agarose gel, the presence of a single band of the expected 540 (Clostridium sp.), 92 (Thermoanaerobacterium sp.), and 82 (Bacillus sp.) base.

3. Results and Discussion

3.1. Enrichment of Thermophilic Hydrogen-Producing Bacteria

Thermophilic hydrogen-producing bacteria were enriched from elephant dung using alpha-cellulose as a carbon source by repetitive sub-culture for five generations. Hydrogen production was highest during the third cycle. Stable through the third to the fifth cycle (Figure 1). The first and second cultivation cycles (C1 and C2) gave hydrogen yields of 20.2 and 23.5 mL H₂/g cellulose, respectively. In contrast, the third, fourth, and fifth cultivation cycles (C3) yielded 198.3, 169.1, and 170.3 mL H₂/g_cellulose, respectively. These results further suggest that multiple transfers of enriched mixed cultures result in highly reproducible hydrogen production [26]. Furthermore, stable hydrogen production indicates the significance of hydrogen-producing bacteria in enriched mixed cultures [3]. Additionally, these repeated transfers confer an environmental adaptive advantage to microorganisms in the culture, resulting in increased hydrogen yields compared to single batch cultivations [11]. Consequently, the enriched thermophilic mixed cultures from the fifth cultivation cycle were employed for hydrogen production from sawdust.

The SMPs of each cultivation cycle is shown in Figure 2. The generation of HAc and HBu accompanies the formation of hydrogen. The total volatile fatty acid (TVFAs) concentration in the five cultivation cycles (C1–C5) was 4597.39 mg/L. The TVFAs (HAc, HBu, HPr, and HLa) showed an increasing tendency in the fourth cycle (C4) and then declined to 1080 mg/L in the fifth cycle. In contrast, when ethanol production increased, the concentrations of HLa increased (Figure 2). It is well established that carbohydrate fermentation by mixed bacterial cultures can produce ethanol and lactic acid [27]. The type of microorganisms involved in the fermentation process has a major impact on this [28]. HLa is generated by competing strains present in the microbial consortium at the beginning of the process, resulting in the alteration of metabolic pathways [29]. Lactic acid bacteria (LAB) have been shown to compete with hydrogen-producing consortia for substrates, resulting in lower hydrogen yields and lower hydrogen production [30]. The dominance of hydrogen-producing bacteria (Clostridium sp. and Thermoanaerobacterium sp.) in C4 and C5 cultivations indicates that they are highly adapted to the hydrogen production process. Thus, enriched mixed cultures from elephant dung can be expected to enhance hydrogen yield and may be employed as suitable inocula for hydrogen production from sawdust.

3.2. Thermophilic Bio-Hydrogen Production from Sawdust

Figure 3 depicts the cumulative hydrogen production from sawdust under thermophilic conditions to measure the efficiency of enriched cultures derived from elephant dung. Our study observed a maximum cumulative hydrogen production of 179 mL H₂/L, corresponding to a hydrogen yield of 37.1 mL H₂/g_cellulose. In concurrence with the report by Mamimin et al. [8], the major SMPs formed during dark fermentation of lignocellulosic material by mixed cultures were HAc and HBu (Figure 2). There was no significant difference between alpha-cellulose and sawdust in hydrogen production, indicating that mixed cultures of elephant dung contained bacteria capable of converting lignocellulose into hydrogen. This is because elephants predominantly consume lignocellulosic plant materials. Thus, their dung is abundant in cellulolytic bacteria that digest cellulose into glucose and hydrogen-producing bacteria that convert this glucose into hydrogen. Therefore, the utilization of elephant dung as inocula for mixed-culture systems has the dual advantages of cellulose degradation and hydrogen production [14]. However, previous research reported that hydrogen production of unpretreated sawdust is less efficient than that from pretreated sawdust [31], possibly due to lower biodegradability on account of the complex structure of cellulose, hemicellulose, and lignin in plant cell walls [32]. While pretreatment of the substrate increases hydrogen yield, it also raises production costs. On the other hand, enrichment cultures derived from elephant dung can efficiently produce hydrogen from sawdust without pretreatment, providing a low-cost benefit.

3.3. Microbial Community Structure

The microbial community present in enriched mixed cultures from each sub-culture of elephant dung as well as sawdust hydrogen fermentation were analyzed by PCR-DGGE that targeted the 16S rRNA gene (Figure 4). Repetitive sub-culture of elephant dung was shown to affect the diversity of the bacterial community (Figure 4a). These communities from each repetitive sub-culture (C1–C5) were identified as a mixture of Clostridium sp., uncultured bacterium, uncultured rumen bacteria, uncultured Firmicutes bacterium, uncultured Lachnospiraceae bacterium, Bacillus sp., Geobacillus sp., Tissierella sp., Streptomyces sp., uncultured compost bacterium, Clostridium cellulolyticum, and Thermoanaerobacterium sp. Species diversity decreased from the first cycle (C1) to subsequent cultivations (C2–C5), as evident from prominent band patterns. The first cycle (C1) and second cycle (C2) had slight differences in microbial community structure, with uncultured Lachnospiraceae bacterium appearing as strong bands. At the same time, the third transfer (C3) displayed strong bands that indicated Tissierella sp. However, bands corresponding to Clostridium sp., and Thermoanaerobacterium sp. responsible for hydrogen production under thermophilic conditions became most dominant after the third transfer (C3). Thermoanaerobacterium species, a well-established thermophile with optimal growth at 60°C that converts carbohydrates to hydrogen with butyrate as the end soluble product [33], remained the abundant species throughout the repetitive mixed culture. Clostridium sp. and Thermoanaerobacterium sp. have been reported as potential hydrogen producers during the acetogenesis stage of hydrogen production [34], which is in concordance with other studies that report animal dung as a rich source of hydrogen-producing bacteria [26]. From these results, it may be concluded that hydrogen-producing bacteria, such as Clostridium sp. and Thermoanaerobacterium sp., were present in all cultivation cycles and are the major hydrogen-producing species in enriched mixed cultures from elephant dung detected by PCR-DGGE. Additionally, the quantity of Clostridium sp. detected by q-PCR in the C3, C4, and C5 cultivations directly correlated with the high hydrogen yield obtained during these transfers (See Section 3.4).

As shown in the DGGE profile in Figure 4b, microbial communities had similarities in numbers (band density) and diversity (number of the band) in most hydrogen fermentation (SD1, SD2, and SD3). The microbial community structure of sludge from sawdust hydrogen fermentation at different DNA loading of 1.18 ug/uL (SD1), 1.58 ug/uL (SD2) and 2.37 ug/uL (SD3) comprised Clostridium sp., Clostridiales bacterium, uncultured rumen bacteria, Streptomyces sp., Lachnospiraceae sp., uncultured compost bacterium, Thermoanaerobacterium sp., and strong bands of uncultured Lachnospiraceae bacterium. The DGGE profile further showed that the hydrogen-producing bacteria primarily comprised Clostridium sp. and Thermoanaerobacterium sp., which was previously reported as the predominant species in hydrogen reactor sludge [9]. Furthermore, these species have been shown to drive hydrogen production from a wide range of lignocellulosic substances [4,7].

3.4. q-PCR

This study developed a quantitative monitoring protocol for Clostridium sp., Thermoanaerobacterium sp., and Bacillus sp. during the hydrogen fermentation process by q-PCR. The q-PCR technique provides results within a day and has been increasingly used for identifying and quantifying specific microorganisms within complex microbial communities [35,36,37]. The linear detection range was determined using a series of standard dilutions of genomic DNA extracted from Clostridium sp., Thermoanaerobacterium thermosaccharolyticum, and Bacillus sp. Threshold cycles were calculated for each sample based on the threshold value after each q-PCR run, and standard curves for Clostridium sp., Thermoanaerobacterium sp., and Bacillus sp. were generated by plotting the threshold cycle. The slope and y-intercept were evaluated using linear regression analysis, and gene copy numbers were analyzed using the standard curves. The high R-squared values obtained in Standard curves (Thermoanaerobacterium sp. = 0.98; Bacillus sp. = 0.99; Clostridium sp. = 0.98) confirm that the reactions were consistent with an absence of any non-specific product. Both Clostridium sp. and Thermoanaerobacterium sp. were detected by PCR-DGGE and q-PCR in the enriched mixed cultures from each sub-culture of elephant dung (C1–C5). Gene copy numbers from the q-PCR analysis revealed Bacillus sp. (1.5 × 10¹⁶ to 4.39 × 10¹⁴ gene copy number) as the dominant genus in the first cultivation (C1) that demonstrated a decreasing trend in subsequent sub-cultures. In contrast, Clostridium sp. (4.66 × 10¹⁴ to 5.63 × 10¹⁵ gene copy number) and Thermoanaerobacterium sp. (5.03 × 10¹⁴ to 3.62 × 10¹⁵ gene copy number) became dominant genera during repetitive sub-culture, concomitant with a high hydrogen yield in later cycles (Figure 5). A similar correlation between hydrogen yield and 16S rRNA gene copy number of Clostridium sp., Thermoanaerobacterium sp., and Bacillus sp. was obtained during hydrogen production from saw dust (Figure 6), thus suggesting these strains play an important role in the hydrogen fermentation process. These findings also show that heat treatment of elephant dung prior to forming mixed cultures inhibits non-spore-forming bacteria while not affecting hydrogen-producing bacteria [38]. A recent report by Okonkwo et al. supports our findings by demonstrating the use of q-PCR for quantitative monitoring of hydrogen-producing bacteria [39]. As a result of these findings, molecular approaches for monitoring microbial communities and fermentation processes in mixed cultures were developed to improve hydrogen production.

4. Conclusions

Hydrogen-producing mixed cultures were efficiently enriched from heat-treated elephant dung and subsequently selected as inocula for hydrogen production from sawdust. Maximum cumulative hydrogen production of 179 mL H₂/L was observed with HAc (1141.64 mg/L) and HBu (563.63 mg/L) generated as major SMPs. The PCR-DGGE profile identified Clostridium sp. and Thermoanaerobacterium sp. as potential hydrogen producers in the acetogenesis stage of hydrogen production. Quantitative results from the q-PCR analysis provided vital information about the biohydrogen production process in mixed cultures, which will be helpful for further improvement of hydrogen production. The primary hydrogen producer was Clostridium sp. in both the enrichment culture and the hydrogen fermentation process of sawdust.