Next Article in Journal
Phenotypic Analysis of Fourier-Transform Infrared Milk Spectra in Dairy Goats
Next Article in Special Issue
Effects of Four Strains of Actinomycetes on the Content of Terpenoids in Baijiu
Previous Article in Journal
A Comparative Study on the Meat Quality, Taste and Aroma Related Compounds between Korean Hanwoo and Chikso Cattle
Previous Article in Special Issue
Microbiological Quality and Safety of Traditional Raw Milk Cheeses Manufactured on a Small Scale by Polish Dairy Farms
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 12
Issue 4
10.3390/foods12040806
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Role of PI3K-AKT Pathway in Ultraviolet Ray and Hydrogen Peroxide-Induced Oxidative Damage and Its Repair by Grain Ferments

by
Wenjing Cheng
1,2,
Xiuqin Shi
1,2,
Jiachan Zhang
1,2,*,
Luyao Li
1,2,
Feiqian Di
1,2,
Meng Li
1,2,
Changtao Wang
1,2,
Quan An
3 and
Dan Zhao
1,2
1
Beijing Key Laboratory of Plant Resource Research and Development, College of Chemistry and Materials Engineering, Beijing Technology and Business University, Beijing 100048, China
2
Institute of Cosmetic Regulatory Science, Beijing Technology and Business University, Beijing 100048, China
3
Yunnan Baiyao Group Co., Ltd., Kunming 650000, China
*
Author to whom correspondence should be addressed.
Foods 2023, 12(4), 806; https://doi.org/10.3390/foods12040806
Submission received: 11 December 2022 / Revised: 4 February 2023 / Accepted: 6 February 2023 / Published: 13 February 2023
(This article belongs to the Special Issue Microbiological Safety and Quality of Fermented Products)
Browse Figures
Review Reports Versions Notes

Abstract

:
UV and external environmental stimuli can cause oxidative damage to skin cells. However, the molecular mechanisms involved in cell damage have not been systematically and clearly elucidated. In our study, an RNA-seq technique was used to determine the differentially expressed genes (DEGs) of the UVA/H2O2-induced model. Gene Oncology (GO) clustering and the Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway analysis were performed to determine the core DEGs and key signaling pathway. The PI3K-AKT signaling pathway was selected as playing a part in the oxidative process and was verified by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). We selected three kinds of Schizophyllum commune fermented actives to evaluate whether the PI3K-AKT signaling pathway also plays a role in the resistance of active substances to oxidative damage. Results indicated that DEGs were mainly enriched in five categories: external stimulus response, oxidative stress, immunity, inflammation, and skin barrier regulation. S. commune-grain ferments can effectively reduce cellular oxidative damage through the PI3K-AKT pathway at both the cellular and molecular levels. Some typical mRNAs (COL1A1, COL1A2, COL4A5, FN1, IGF2, NR4A1, and PIK3R1) were detected, and the results obtained were consistent with those of RNA-seq. These results may give us a common set of standards or criteria for the screen of anti-oxidative actives in the future.

Graphical Abstract

1. Introduction

Oxidative damage to the skin can lead to skin aging, which has always been a focus of attention. Excessive reactive oxygen species (ROS) are considered to be the main factor that induces cell damage and apoptosis [1]. A large amount of research has been conducted to identify compounds that can protect against oxidative stress damage. These compounds can be derived from plants, animals, and microorganisms, as well as chemical compounds [2,3,4,5]. Cell model-based screening and mechanism exploration are common research approaches. In these studies, a large proportion of studies are based on UVA induction [6,7,8] and hydrogen peroxide induction [2,6,9,10].
As for research regarding dermatology, cosmetics, and functional foods, human skin fibroblast cells (HSFs) oxidative stress damaged models that are stimulated by either UVA or H2O2 are widely used [6]. Scholars have some common knowledge both of these models, including that they can break the balance between oxidants and antioxidants and cause oxidative stress damage by increasing the oxides content [6,7,8,9,10]. There may be differences in the internal mechanism of these two models in terms of how they induce free radicals. In spite of this, we still generally believe that the effective ingredients obtained by screening have potential application value. Based on this, if certain criteria can be found that provide a method for raw material screening, future work will experience unprecedented convenience. However, there has been limited information on the similarities and differences in the molecular mechanisms between the models at the RNA or protein levels.
Transcriptomics is the field of studies that evaluates gene expression at the RNA level and is used to study gene transcription and regulation in cells. RNA-seq can be used for to construct a new and complete library [11,12], and its results show repeatability and have low cost [13,14]. The screening of drug targets or the establishment of disease modules using RNA-seq have been used widely in pharmacological research, such as those exerted to analyze the gene pathways involved in the anti-breast cancer effect [15].
In our study, RNA-seq technology was used to analyze the in-depth mechanisms involved in these two oxidative damage models to identify common changes. The core differentially expressed genes (DEGs) were chosen and verified by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) for consistency between high-throughput analysis and RT-qPCR results. Furthermore, several actives were selected to determine if these findings held true.
Schizophyllum commune (S. commune) is a kind of fungi that exerts excellent antioxidant [16], anti-tumor [17], and anti-aging properties [18]. The β-glucan rich schizophyllum can effectively modify the intestinal microbiota, regulate intestinal metabolic disorders, and relieve diseases such as obesity, diabetes, and inflammatory bowel disease [19]. Our previous laboratory study has indicated the anti-oxidative effects of the polysaccharides from S. commune (typical data shown in Supplementary material). In addition, the most commonly consumed grains, such as rice, highland barley, and oats, may potentially exert skin care and health benefits, such as relieving oxidative stress, scavenging free radicals, and exerting anti-inflammatory capabilities [20,21]. High levels of phenols, including proanthocyanins, flavanols, and their derivatives, are found in rice, highland barley, and oats [20,22,23,24]. Studies have confirmed that most of the phenols contained in highland barley are in bound forms, which have strong antioxidant activities and can also inhibit the proliferation of human hepatoma cells [20]. Additionally, the phenol extraction rates from highland barley or oats using enzymatic or fermented hydrolysis are higher than that of chemical extraction. The extracts also show stronger antioxidant activities [22,25]. The above studies have confirmed that mild extraction methods, such as enzymatic hydrolysis and fermentation, can effectively improve the antioxidant activity of grains. Based on these results, a previous study produced three kinds of S. commune fermented broths, including rice, highland barley, and oats [16,26,27] to verify whether they followed the RNA-seq findings.
In doing so, we hope our study will harmonize these distinct methods, and facilitate future experiments and analyses.

2. Materials and Methods

2.1. Materials

Human skin fibroblasts (HSFs) were purchased from Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences; Dulbecco’s Modified Eagle Medium (DMEM), Fibroblast Medium (FM), fetal bovine serum (FBS), phosphate buffer saline (PBS), and 0.25% trypsin-EDTA and penicillin(1 × 105 U/L)-streptomycin (100 mg/L) were all purchased from GIBCO Life Technologies (Carlsbad, CA, USA); EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix reverse transcription kit, TransStart® Top Green qPCR SuperMix kit were obtained from Beijing TransGen Biotech Co., Ltd. (Beijing, China), and Cell Counting Kit-8 (CCK-8) was purchased from Biorigin (Beijing) Inc. (Beijing, China).

2.2. Preparation of S. commune Fermented Broths

The rice fermentation broth (RFB), highland barley fermentation broth (HBFB), and oats fermentation broth (OFB) were collected, sterilized, and freeze-dried to be made into powders following the parameters in the literature [16,26,27] with slight modifications. The S. commune strain was initially cultured in the seed medium as fermented seed at 28 °C for 3 days. The resulting seed culture was inoculated with a 3% inoculum size (v/v) in the fermentation medium and cultivation was carried out at 160 rpm and 28 °C for 3 days. The rice/highland barley/oats-supplemented mediums contain 1% rice/highland barley/oats powder (m/v), respectively.

2.3. Cell Culture and the Cell Viability Measurement

The cells were cultured in DMEM supplemented with 10% FBS, 1% fibroblast growth additives, and 1% penicillin-streptomycin. Then, the cells were incubated (Shanghai Shengke Instrument Equipment Co., Ltd., Shanghai, China) in a 5% CO2 humidified atmosphere at 37 °C. The culture medium was changed when cell confluence reached 80%.
Cells viability was assayed using the colorimetric CCK-8 method [28,29,30] by following the manufacturer’s instructions. Then, the cells were seeded at a concentration of 1 × 105 cells/mL into a 96-well plate for 12 h and were incubated with various concentrations of RFB (0 to 5 mg/mL), HBFB (0 to 2.5 mg/mL), and OFB (0 to 1.25 mg/mL) for 24 h. Next, the cells were incubated for 4 h by adding 10 μL of CCK8 solution (Biorigin, Beijing, Inc.) into each well. The optical densities of the solutions were quantified at a wavelength of 450 nm using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA).

2.4. UVA/H2O2-Induced Model Establishment

IC50 parameters (50% cell viability) of UVA/H2O2 were chosen to establish the model. Cell viability was evaluated using the Cell Counting Kit-8 (CCK-8) method.
The UVA-induced model was established under the condition of 25 J/cm2. The detailed procedure was as follows: HSF cells were seeded into a 6-well plate (1 × 106 per well) and cultured for 12 h. Then, one milliliter of PBS (pH 7.4, 0.01 M) was added in each well, and the cells were irradiated at a dose of 25 J/cm2. UVA (365 nm) irradiation was created using an UVA lamp, and its intensity was measured using a UV power meter (LS125, Shenzhen Shanglin Technology Co., Ltd., Shenzhen, China).
The H2O2-induced model was established by treating H2O2 at a concentration of 2000 µmol/L for 30 min. The detailed procedures were as follows: HSF cells were seeded into a 6-well plate (1 × 106 well) and cultured for 12 h. Two milliliters of H2O2 at the concentration of 2000 µmol/L was added into each well, and the plate was incubated for 30 min.
The control group was treated without UVA/H2O2, and the cell viability under different conditions were simultaneously measured.

2.5. Transcriptome Sequencing

The cells were collected after the different treatments and total RNAs were extracted using the TriQuick Reagent (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). RNA quality was determined using an Agilent 2100 Bioanalyser (Agilent Technologies, Santa Clara, CA, USA) and quantified using a NanoDrop 2000 system (Thermo Scientific™ Technologies, Wilmington, DE, USA). Only high-quality RNA samples (OD260/280 = 1.8~2.2, OD260/230 ≥ 2.0, RIN ≥ 6.5, 28S:18S ≥ 1.0, > 2 μg) were used to construct the sequencing library. Transcriptome sequencing was performed by Shanghai Majorbio Bio-pharm Technology Co. Ltd. Gene read counts were obtained for each group, and high-quality reads were retained to perform the differential expression analysis of the genes. The p-value and fold change (FC) in each gene was calculated to determine the differences in expression between the libraries. In addition, we determined and summarized read frequencies and differences in sequence generation, trimming, and the mapping results of the cell samples before and after UVA and H2O2 treatments. In the UVA-induced model, approximately 20.6 and 20.3 million raw reads were obtained in the control and model groups, respectively. After removing low-quality reads, 20.4 and 20 million high-quality reads remained in the control and model groups, respectively (>98.5% for both), and were assembled for downstream analysis. In the H2O2-indued model, approximately 50.5 and 50.46 million raw reads were obtained from the control and model groups, respectively. After removing low-quality reads, 50 and 49.92 million high-quality reads remained in the control and model groups, respectively (> 98.9% for both), and were assembled for downstream analysis. The clean reads were mapped to the reference genome (Genome assembly: GRCh38.p10, http://www.ensembl.org/Homo_sapiens/Info/Index, accessed on 1 February 2023) and the detailed mapping output is summarized in Table 1.

2.6. Screening for Differential Expressed Genes (DEGs) and Functional Analysis

Differential expression analysis was performed between control group and model group to identify the DEGs and their functions.
The DEGs between the control and UVA-induced model were screened using |log2FC| > 1.2 and P-adjust < 0.05 as the thresholds. The DEGs in the H2O2-induced oxidative damage study were screened using the criteria, |log2FC| > 2 and P-adjust < 0.05. The DEGs were functionally annotated using Blast2go (Version 2.5) and goatools (Version 0.6.5) for Gene Ontology (GO) annotation and clustering analysis. The clustered GO terms involving biological process (BP), molecular function (MF), and cellular component (CC) were obtained based on the criteria of the enrichment score of > 2. The significantly enriched pathways were identified using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database with p < 0.05 as the criterion. The website Database for Annotation, Visualization and Integrated Discovery (DAVID ver 6.8, http://david.ncifcrf.gov/, accessed on 1 February 2023) was also used.

2.7. RT-qPCR

RT-qPCR was used to investigate the expression levels of the PI3K-AKT pathway associated genes (COL1A1, COL1A2, COL4A5, FN1, IGF2, and PIK3R1).
Total RNA extraction and cDNA synthesis were performed using the TriQuick Reagent (TRIzol Substitute) (Beijing Solarbio Science & Technology Co., Ltd.) and the UEIris II RT-PCR System for the cDNA Synthesis SuperMix (Beijing TransGen Biotech Co., Ltd.) according to the manufacturers’ instructions. All synthesized cDNA were used for the PCR amplification using the TransStart® Top Green qPCR SuperMix kit (Beijing TransGen Biotech Co., Ltd.). The total reaction system was 20 μL. The primer sequences used were presented in Table 2 [6]. GAPDH was used as a normalization control.
The cyclic parameters used were pre-denaturation at 94 °C for 30 s, followed by the PCR reaction (45 cycles of 94 °C for 15 s, 60 °C for 15 s, and 72 °C for 10 s), while fluorescence data were collected at 72 °C. The relative gene expression levels were analyzed using the 2−ΔΔCT method [31].

2.8. Statistics

All experiments were performed in triplicate at least, and the data were expressed as mean ± standard deviation (SD). The data were analyzed using SPSS 17.0 (SPSS, Armonk, New York, NY, USA) and GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA). One-way analysis of variance was used for the significance of differences between the groups (#, * p < 0.05; ##, ** p < 0.01).

3. Results

3.1. The Establishment of UVA/H2O2-Induced Models and Identification of DEGs

Special criteria were used to screen for the differences between the DEGs in the model and control in each study. For the UVA-induced oxidative damage study, we collected and filtered out a total of 552 DEGs based on the criteria of |log2FC| > 1.2 and P-adjust < 0.05, of which 249 genes were upregulated and 304 genes were downregulated. As shown in Table 3, among the upregulated DEGs, 144 genes were involved in cell proliferation and regulation, with 22 genes encoding proteins that can produce a response to an external stimulus. A total of 15 genes participated in immune and inflammatory response, 9 genes were involved in skin barrier-related responses. In addition, 7 of the genes that encoded proteins were also found to play a role in the oxidative stress response, while the functions of the other 36 genes were unknown. Among the downregulated DEGs, 166 genes were involved in cell metabolism, proliferation, and regulation, while 24 genes participated in intercellular signaling. A total of 16 genes encoded proteins that could play a role in the oxidative stress response, and 11 genes were involved in inflammatory processes. Six genes were involved in the synthesis of the cytoskeleton. Apart from these genes, the functions of eight DEGs were uncharacterized.
UVA/H2O2 can induce ROS generation, leading to a decrease in cell viability, which lead to a decline in cellular fitness and ultimately, to cell death. We determined the effects of the inducers (UVA/H2O2) on cell viabilities (Figure 1A,B). Dose dependency was observed in both studies. IC50 parameters were chosen to establish damage models. UVA irradiation at a dose of 15 J/cm2 was finally selected to be used to establish the UVA-induced oxidative stress damage model for subsequent studies. H2O2 at a concentration of 1000 µmol/L H2O2 for 30 min was used as the modeling condition of the H2O2-induced oxidative stress damage model (Figure 1).
Likewise, as shown in Table 4, we compared the H2O2-injured Model with the Control, and a total of 607 DEGs were screened based on the criteria, |log2FC| > 2 and P-adjusted < 0.05. Among them, 226 DEGs were upregulated and 381 DEGs were downregulated. Among the upregulated DEGs, 19 genes encoded proteins that regulated the oxidative stress response, 10 genes regulated interactions between cells and the surrounding environment, and 6 genes were involved in skin barrier function and lipid anabolism. In addition, there were 42 genes whose functions were unknown. The downregulated DEGs were significantly involved in pathways, cellular matrix composition entry and complement coagulation cascade. Among them, a total of 139 genes encoded proteins that participated in cell proliferation and regulation, 27 genes were responsible for regulating the immune response process and immune system, 24 genes were involved in the positive regulation process of cell chemotaxis and inflammatory response, while 9 genes were responsible for regulating the cell response. In addition, there were 54 genes whose functions were unknown.
The above-mentioned sequencing analysis indicated that some similar functions of DEGs are grouped. There were no common genes between UVA-upregulated and H2O2-upregulated DEGs (Venn diagram shown in Figure S1 in Supplementary material), suggesting that different insight mechanisms exist. DAVID analysis showed that UVA-induced upregulated DEGs mainly focused on the regulation of transcription (enrichment score = 3.47) and protein phosphorylation (enrichment score = 1.35), which both had roles in signal transduction. While the H2O2-induced upregulated DEGs mainly participated in the processes related to the immune response (enrichment score = 3.11), inflammatory responses (enrichment score = 3.09), cell adhesion (enrichment score = 1.93) and regulation of transcription (Enrichment score = 1.11) (data not shown). While 15 common DEGs existed both in UVA and H2O2 induced downregulated DEGs, 5 existed in the extracellular exosome and participated in cell migration (Data not shown).

3.2. Gene Ontology (GO) and KEGG Pathway Analysis

In the UVA induced damage model, the results of the GO enrichment analysis showed that a total of 14 GO terms of the upregulated (Figure 1a) and downregulated (Figure 1b) DEGs were enriched. Two GO terms were enriched in the upregulated DEGs, namely cyclin-dependent protein kinase activity and cyclin-dependent protein serine/threonine kinase activity. On the contrary, a total of 12 categories were enriched in the downregulated DEGs. Among them, DNA-binding transcription activator activity (RNA), negative regulation of phosphorylation, and collagen-containing extracellular matrix were the top 3 GO terms with high gene ratios and significant P-adjust values, which indicated that the processes of cell proliferation, cell communication, and extracellular matrix production were inhibited. Furthermore, extracellular matrix components and their regulated genes were decreased, indicating changes in cellular morphology. At the same time, biological signal transduction induced by phosphorylation were slowed down or even inhibited.
In the H2O2 oxidative damage model, there were 10 GO terms enriched in upregulated DEGs (Figure 1c) and 12 GO terms enriched in downregulated DEGs (Figure 1d). Among these enriched terms of upregulated DEGs, receptor ligand activity, extracellular matrix organization, and response to molecule of bacterial origin, were the top three terms with high gene ratios and significant P-adjusted values. The terms related to extracellular matrix constituents or collagen production were both found in the UVA and H2O2-induced damage models, indicating the damaged changes in cellular morphology.
KEGG enrichment analysis was performed. As shown in Figure 2, the UVA-induced upregulated DEGs were mostly enriched in virus infection (herpes simplex virus 1 infection), while the downregulated DEGs were significantly enriched in the TNF signaling pathway and IL-17 signaling pathway (Figure 2A,B). It is worth noting that TNF and IL-17 can activate or regulate the PI3K-AKT signaling pathway, indicating that UVA may damage cells through that pathway. A comprehensive KEGG enrichment analysis was also conducted, as shown in Figure 2C. All the DEGs that were both upregulated and downregulated were enriched in pathway terms, such as ECM-receptor interaction and the PI3K-AKT signaling pathway.
The KEGG enrichment analysis results of the H2O2-induced damage model (Figure 2D,E) showed that the upregulated DEGs were significantly enriched in cytokine–cytokine receptor interaction and the IL-17 signaling pathway, while the downregulated DEGs were enriched in axon guidance and complement and coagulation cascades. The H2O2-induced and UVA-induced DEGs were both involved in several common terms regardless of the method of regulation. These terms were ECM-receptor interaction, PI3K-AKT signaling pathway, focal adhesion, and TNF signaling pathway. In addition, the H2O2-induced DEGs were also involved in the other pathway terms, such as complement and coagulation cascades and cytokine–cytokine receptor interaction, which are associated with immune response (Figure 2F).

3.3. Key DEGs Functioned in PI3K-AKT Pathway

According to Figure 2C,F, several common KEGG terms were found to be enriched in both UVA and H2O2 induced cell damage. The pathways involved in the occurrence, development, and response of inflammation were both enriched in these two models. TNF can combine with tumor necrosis factor receptor 1 (TNFR1) to form complex 1, which promotes the ubiquitination of E3, the ubiquitin-connected protein inhibitor of apoptosis (cIAP), which in turn activates the NF-κB signaling pathway, leading to keratinocyte inflammatory response and even keratinocyte inflammatory response. NF-κB inhibition of the keratinocytes causes RIPK1-mediated necroptosis and skin inflammation. In addition, the extracellular matrix (ECM)-related gene expression process has also been identified as an important factor that affects the level of cellular inflammation. Based on gene counts and P-value into account, we found that many DEGs induced by UVA (70) or H2O2 (55) were involved in the PI3K-AKT pathway based on a relatively high value of -log10(P), as shown in Figure 2C,F.
Based on the findings presented here, the PI3K-AKT signaling pathway was the focus of our ongoing studies. As shown in Figure 3, the expression changes of the genes involved in the PI3K-AKT signaling pathway induced by UVA (Figure 3A) and H2O2 (Figure 3B) are clearly demonstrated.
In the UVA-induced model, most of the DEGs involved in PI3K-AKT pathway were downregulated (60 downregulated DEGs out of 70 DEGs) and mainly participated in three biological processes, such as cell adhesion, regulation of MAPK cascade, and cell proliferation and differentiation (Table S1 in Supplementary Material). The expression of receptor tyrosine (RTK)-associated protein on the membrane was downregulated, which was induced by the decrease of population stimulating factor (GF) in the extracellular matrix. RTK subsequently changed the expression of SOS and Ras, which finally induced the decrease of cell proliferation, angiogenesis, and DNA repair. Furthermore, phosphatidylinositol 3 kinase (PI3K) was also downregulated by Ras. Some cytokines and ECM in the extracellular matrix were also repressed in expression, causing a downregulation of PI3K. As previously stated, PI3K is a hub node that can influence how the expression of downstream proteins affects protein synthesis, glycolysis, apoptosis, and crosstalk with other signaling pathways. For example, the downregulation of CREB (cAMP-response element binding protein), and FOXO (Forkhead box O) in this study may affect cell survival and cell cycle progression. The levels of PKCs also decreased, affecting glucose uptake and vesicle transport. The accelerated DNA damaging-induced transcript (REDD1) and serine threonine kinase (LKB1) also resulted in an unbalancing of protein synthesis.
Figure 3B showed the DEGs involved in PI3K-AKT signaling pathway in the H2O2-induced oxidative damaged model, which is different from that of the UVA model. A total of 55 DEGs, including 28 upregulated DEGs and 27 downregulated DEGs, were enriched in the PI3K-AKT signaling pathway. Three GO terms were enriched (Table S2 in Supplementary Material). Cell adhesion, for example, showed a high enrichment score of 11.81, which played an important part in the inflammatory response.
In the H2O2-induced model, the downregulation of PI3K was mainly due to the downregulation of toll-like receptor (TLR2/4) and integrin (ITGB) on cell membrane and extracellular matrix (ECM), which ultimately affected cell survival, cell cycle, metabolism, and protein synthesis. Additionally, the reduced expression of Adenosine 5 ‘-Monophosphate (AMP)-activated protein kinase (AMPK) also influenced the synthesis of proteins. The expression level of the protein encoded by phosphatase type 2 phosphatase activator (PP2A) decreased, which induced an increase in the CREB and MDM2 prototype oncogene, indirectly. The increased expression of the MDM2 inhibited tumor suppressor p53, which played a positive role in cell survival. Furthermore, the downregulation of PI3K and PP2A also affected cell metabolism, indirectly. We also found that the transmembrane 4 L six family member 1 (TM4SF1), E2F transcription factor 7 (E2F7), and BCL2 related protein A1 (BCL2A1) showed a high level of expression.
Overall, although differences were found between these two oxidative damage models, there were certain common DEGs. A total of 11 DEGs with a similar trend were identified in the pathway: PIK3R1, IGF2, ITGA4, LAMA2, LAMA5, LAMB2, NR4A1, COL1A1, COL1A2, COL4A5, and FN1. Some of them were regulatory hub nodes, while others encoded for the cellular matrix. We finally chose 6 of them in the subsequent verification (COL1A1, COL1A2, COL4A5, FN1, IGF2, and PIK3R1) by qRT-PCR, and found the consistency with the RNA-seq results.

3.4. Composition Analysis and Protective Effects of RFB, HBFB and OFB

S. commune is an edible fungus with good nutritive value that is often used in food as a functional additive. Since the functional effects of S. commune-fermented grain additives have been developed and studied in the lab for many years, we selected three kinds of fermented actives in this study to verify whether they were suitable for the criteria obtained from the above-mentioned RNA-seq results.
The physicochemical properties of the RFB, HBFB, OFB are shown in detail in Table 5 and Table 6. The carbohydrate content of RFB, HBFB, and OFB was 83.9%, 73.3% and 59.2%, respectively. Among them, total sugar content of RFB was highest, about 43.36%, and the β-glucan content of OFB was the highest (2.74%). The reducing sugar was highest in RFB (3.18%).
The cell viabilities to HSFs of RFB (Figure 4A), HBFB (Figure 4B), and OFB (Figure 4C) were examined. RFB at a concentration of 5 mg/mL had a relatively high cell viability with a cell survival rate of 69.55% ± 2.30%. OFB at a concentration of 1.25 mg/mL led to a cell survival rate of 57.83% ± 3.81%. Apart from these results, other concentrations showed more than 80% cell survival rates, indicating almost no toxicity to cells. Furthermore, at a concentration ranging from 0.16 to 0.625 mg/mL, RFB showed the most excellent proliferation promoting effect among these three samples. We finally chose a concentration of 0.625 mg/mL of RFB, 0.625 mg/mL of HBFB, and 0.32 mg/mL OFB to be used in further studies.
The proliferation effects on the damaged cells caused by UVA and H2O2 were then studied. As shown in Figure 4D–F, all of the samples can proliferate the decreased cell viabilities induced by UVA and H2O2 (p < 0.05), which indicated the excellent proliferation effects of RFB, HBFB and OFB.

3.5. Validation of Key DEGs by RT-qPCR

RT-qPCR was performed to validate the expression levels of the selected DEGs. The results obtained are presented in Figure 5. The PI3K-AKT pathway in the cytoplasm plays an important role in protecting cells from oxidative stress. The decreased expression levels of COL1A1, COL1A2, COL4A5, FN1, IGF2, and PIK3R1 were detected in the cells induced by UVA/H2O2 (all p < 0.01, Figure 5). RFB could significantly upregulate the expression levels of all genes that were downregulated due to UVA/H2O2 injury (all p < 0.01, compared with each model, Figure 5A). Except for COL1A2, HBFB showed similar effects on the expression of COL1A1, COL4A5, FN1, IGF2, and PIK3R1 (all p < 0.01, compared with the model separately, Figure 5B). OFB could significantly increase the expression of COL1A1, FN1, IGF2, and PIK3R1 (all p < 0.01, compared with the model separately, Figure 5C), but could not promote the expression of COL1A2 in either of the models. Furthermore, the expression of COL4A5 in the H2O2-induced model can be accelerated by OFB but was suppressed in the UVA-induced model.

4. Discussion

Oxidative stress is a disorder between oxidative molecules and insufficient defense of antioxidants, resulting in tissue damage and systemic injury. Oxidative damage leads to elevated levels of ROS in cells. ROS are an oxygen-containing small species, such as singlet oxygen (1O2), ozone (O3), hydroxy radical (OH•), hydrogen peroxide (H2O2), and superoxide anion radical (O2 •−) [6]. Melatonin acts as an antioxidant by scavenging free radicals [32]. There are close relationships between oxidation and skin aging. External agents, such as ultraviolet light and environmental pollution, together with endogenous metabolic irregularities, affect skin cell oxidative damages, resulting in skin aging [33].
However, low levels of oxidative stress activate the transcription of genes encoding proteins which are involved in the defense against oxidative damage, oxidative damage repair mechanisms, and apoptosis. On the contrary, a high level of oxidative stress is a severe threat to lots of macromolecules, such as lipid peroxidation, DNA oxidative damage, protein oxidation, and monosaccharide oxidation [34].
Many efforts have been made to fight against skin aging as people’s cosmetic desires increase, and many studies have examined the functional actives that can prevent oxidative damage [35,36]. UVA and H2O2 are traditional inducers used to establish oxidative damage cell models in the exploration of the internal mechanism and to screen functional components. It is generally agreed that H2O2 can induce the production of ROS in cells, leading to oxidative damage [37]. Exogenous H2O2 treatment is a simple and feasible cell model for studying the mechanism of oxidative damage and actives screening, which can effectively simulate the process of oxidative damage. Similarly, a UVA-induced photoaging model can penetrate more deeply into the skin, elevate ROS, and thus cause DNA damage [38]. In addition, inflammatory reactions are directly associated with the pathogenesis of photoaging [39]. It has been reported that Rhodiola rosea fermented by lactobacillus plantarum, ectoin, Laminaria japonica fermentation broth, and Lacticaseibacillus paracasei Subsp. paracasei SS-01 strain exopolysaccharide all have potential roles in anti-oxidative damage effects [2,6,33,40], no matter which oxidative damage models are used in the studies. However, limited studies have been performed to compare different oxidative stress models in phenotypes and mechanisms.
In the study, RNA-seq technology was performed to examine the similarities and differences of the two models in the function of the involved DEGs and pathways. DEGs of UVA-induced HSFs were mainly focused on the biological processes, such as the regulation of cell proliferation, external stimulus response, and cellular inflammatory response. The negative regulation of DNA-binding transcriptional activity and phosphorylation were inhibited as shown by the GO enrichment analysis. PI3K-AKT signaling pathway was selected as one of the important terms with a high number of genes involved and a significant P-value. In the other model of this study, which was H2O2-induced, processes such as receptor ligand activity, extracellular matrix organization, and response to lipopolysaccharide were significantly upregulated, and collagen-containing extracellular matrix and extracellular matrix structural components were significantly downregulated. Although differences were obtained by the analysis of GO annotation and clustering, the same pathway (PI3K-AKT signaling pathway) obviously changed. Furthermore, the IL-17 signaling pathway was significantly influenced but with a different tendency.
The results obtained partly verified the previous conclusions. Alafiatayo et al. found that UV-irradiated HDF cells showed a lower level of proliferation, more morphological changes, and lower activity compared with the control group. Additionally, the MAPK pathway was found to have been accelerated as antioxidant-related genes were downregulated [41]. In our study, some DEGs in the UVA-induced damage model participated in the PI3K-AKT signaling pathway, the downregulated DEGs of which were mainly involved in cell adhesion, MAPK cascade regulation, and cell proliferation and differentiation. Another transcriptome deep sequencing analysis study conducted by Zheng et al. reported that the differential expression genes altered by UVA were involved in a variety of biological processes, such as the regulation of elastin and phosphoglucomutase encoding levels, and cellular inflammation. Our study found that the functional annotation of the DEGs in UVA-induced HSFs appeared in several terms, such as the regulation of cell proliferation, DNA-binding transcriptional activity, response to external stimuli, and cellular inflammation, which showed consistencies with Zheng et al. [42]. In addition, the expression of ECM and protein complexes in the extracellular matrix and the PI3K-related DEGs decreased simultaneously. As a pivotal node of this signaling pathway, the downregulation of PI3K can interfere with cell survival, apoptosis, DNA damage induction, and downstream protein synthesis, even as it affects cell cycle progression.
Many research studies have examined H2O2-induced damage to cells. In a previous report published by Barandalla et al., the overall gene expression profile of H2O2 -induced HUES3 cells were analyzed using an Illumina HT-12 V4 chip, and it was found that the most affected genes were associated with RNA processing and splicing, redox reduction, and sterol metabolic processes [43]. Studies have shown that IL-17 may inhibit apoptosis through the PI3K-AKT signaling pathway, and that TNF could activate the PI3K-AKT signaling pathway [44,45]. Our study also reached a similar conclusion that, when cells were stimulated by H2O2, the upregulated DEGs were significantly enriched in the cytokine–cytokine receptor interaction and IL-17 signaling pathway, which in turn activated the PI3K signaling pathway. We also performed an enrichment analysis of the PI3K signaling pathway genes involved in the H2O2 injury model. The DEGs were mainly enriched in cell adhesion, which was found to play an important role in inflammatory responses. The downregulation of the PI3K was mainly due to the downregulation of TLR2/4 and ECM.
Zou et al. systematically mapped single cell transcriptomes involved in human skin aging and revealed that the matriculated expression of transcription factors drove human skin aging. They found that the downregulation of KLF6 and HES1 were the driving force involved in skin aging [46]. In our study, the sequencing results of the UVA-induced model showed that KLF6 was significantly downregulated, too. Therefore, it can be suggested that UVA radiation can lead to skin aging by the downregulation of KLF6, and that the activation of KLF6 may be a major anti-aging approach. HES1 factor was also identified in the sequencing results of H2O2-induced model but was differentially upregulated. Therefore, it can be suggested that, upon stimulation by H2O2, HSFs may activate a self-protection mechanism that activates HES1 factor to prevent cell senescence, which then plays a role in resisting changes caused by external stimuli.
In a previously published report, the underlying signaling pathway and biological processes involved in UVB-induced skin injury were identified [47]. The IL-6 gene of the interleukin family was also identified in our results. ECM is an integral component of all organs and plays a pivotal role in tissue homeostasis and repair [48]. CCN1 is a secreted ECM protein, and research has shown that blocking CCN1 function in vivo can effectively alleviate epidermal hyperplasia and inflammation in psoriasis-like mice [49,50]. In the study, the decline in ECM was a common factor for the activation of PI3K. It indicated that both light and oxidative damage could damage the secretion, synthesis, and normal operation of the cell matrix, and that the activation of the PI3K pathway was an effective regulatory pathway to restore such damage.
Our study showed that both the UVA and H2O2 injury models were able to regulate the expression levels of the PI3K-AKT signaling pathway genes. The two lesions together affected 11 genes, including PIK3R1, IGF2, ITGA4, LAMA2, LAMA5, LAMB2, NR4A1, COL1A1, COL1A2, COL4A5, and FN1, with similar expression trends. The above-mentioned genes were partly responsible for regulating the central node and partly for encoding the cytoplasmic matrix.
However, the regulation of PI3K-AKT pathway in the UVA and H2O2 injury models was not completely consistent. In the DEGs analysis results of the UVA injury model, the main inducing factors leading to the downregulation of PI3K signaling were the decrease in the expression of cytokines, protein complexes, and population-stimulating factors in the extracellular matrix. The chain reaction caused by the decrease in PI3K signaling led to the responses in the extracellular matrix, manifested as increased transcriptional activity of DNA damage-inducing transcript (REDD1) and serine threonine kinase (LKB1), which affected normal protein synthesis and hindered cell cycle progression and survival. Although ECM factors were involved in the regulation of PI3K in the H2O2 injury model, the regulation was mostly proceeded by downregulating TLR2/4 and ITGB genes. Therefore, we can infer that the main action pathway of skin aging damage caused by light and oxidation are concentrated in the PI3K-AKT signaling pathway.
Both of the damaged models suppressed PI3K gene expression and decreased the content of ECM components. H2O2 was not limited to the regulation of ECM; membrane receptors and integrins were also involved. The results indicated that H2O2-induced skin oxidative aging was stronger and more complicated than light damage.
S. commune is a fungus composed of mycelium and fruiting bodies, which is rich in organic acids and polysaccharides, such as chitosan, glucosamine, and lignocellulolytic enzymes [51,52]. Studies have shown that Schizophyllum exerts anticancer, antitumor, and immunomodulatory activities [27,53,54]. Existing studies have shown that Schizophyllan can effectively restore the brain function of aging mice, increase the SOD content in serum and brain, and reduce the accumulation of malondialdehyde (MDA), thus leading to significant anti-aging activity [55]. S. commune fermented broths were also reported to have potential benefits for humans [16,26].
Rice, highland barley, and oats are some of the main food crops used worldwide and are rich in carbohydrates, such as starch, cellulose, and protein. Among them, highland barley and oats contain unique substances, such as arabinoxylan and oat polyphenols, which have been widely applied in food and pharmaceutical industries [56,57,58,59,60]. In the study, three kinds of S. commune fermented broths (RFB, HBFB, and OFB) were obtained. Previous studies have demonstrated their anti-oxidative effects in our lab (Some data shown in Figure S2 in Supplementary material). Here, RFB, HBFB, and OFB were used to verify whether the genes screened out could be accelerated by the broths, and the results were confirmed as expected. It can be concluded that RFB, HBFB, and OFB might play roles in the synthesis of insulin growth factor, cell proliferation, and DNA repair. They may also affect cell survival by promoting the formation of anti-apoptotic protein (Bcl-XL), as well as the upregulation of collagen and fibronectin, thus protecting human skin fibroblasts from UVA or H2O2 oxidative damage (Figure 6).
RNA-seq analysis and verification results of our study showed that the expression of key genes involved in the PI3K-AKT signaling pathway could be the screening standard to understand the potential antioxidant actives.
There are still some limitations. Although three replicates were performed when we established these two types of models, more parallel tests are needed to obtain results with good stability and repeatability. The criteria used in RNA-seq analysis are empirical, which have great relationships with data analysis. We hope to determine a common screening method to identify active ingredients that can prevent oxidative damage, and plenty of standard antioxidants should be used to verify the results. Further studies should be performed to validate the results in this study.

5. Conclusions

In this study, oxidative stress injury models of human skin fibroblasts were established using H2O2 and UVA stimulation. RNA-seq technology was used to conduct GO and KEGG functional enrichment analysis of the DEGs in the two oxidative injury models. The PI3K-AKT signaling pathway was selected as the common criteria of the two kinds of models. S. commune-fermented RFB, HBFB, and OFB were used for further mRNA validation. Results showed that these three broths can protect against oxidative damage through this pathway, indicating that it might provide a research direction for future studies on the oxidative damage mechanisms and the screening of functional actives.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/foods12040806/s1, Figure S1: Venn diagram of the two models. UVA-up: up-regulated DEGs in UVA-induced model; UVA-dn: down-regulated DEGs in UVA-induced model; H2O2-up: up-regulated DEGs in H2O2-induced model; H2O2-dn: down-regulated DEGs in H2O2-induced model; Figure S2. Determination of antioxidant capacities of S. commune polysaccharide (SP) and VC in vitro. A, DPPH• scavenging effects; B, •OH free radicals scavenging effects; C, Fe2+ chelating abilities. VC, namely ascorbic acid, was chosen as the positive control. Results were expressed as the mean ±SD (n = 3); Table S1 UVA-induced model; Table S2 H2O2-induced model.

Author Contributions

J.Z., C.W., and M.L. provided concepts and designed experiments; W.C. and L.L. conducted experiments; F.D., D.Z., and X.S. analyzed data; Q.A.; data visualization; W.C. wrote the manuscript; J.Z., M.L. read and commented on the first draft. All authors have read and agreed to the published version of the manuscript.

Funding

Zhejiang Provincial Science and Technology Department: Zhejiang Province Leading Innovation and Entrepreneurship Team Project (2020R01018); Zhuji Science and Technology Burea: Shaoxing City “Top Ranking” System Science and Technology Project (2021B42001); Science and Technology Department of Zhejiang Province: Zhejiang Province Science and Technology Plan Project (2022C02037).

Data Availability Statement

The data are available from the corresponding author upon reasonable request.

Acknowledgments

Thanks for the guidance and contributions to this research from the members of the group, and Yunnan Baiyao Group Co, Ltd. for providing partial experimental instrument to carry out this work.

Conflicts of Interest

The author Quan An was employed by the company Yunnao Baiyao Group Co, Ltd. He took part in the visualization of the data in the manuscript. The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Pollman, M.J.; Hall, J.L.; Gibbons, G.H. Determinants of vascular smooth muscle cell apoptosis after balloon angioplasty injury. Influence of redox state and cell phenotype. Circ. Res. 1999, 84, 113–121. [Google Scholar] [CrossRef]
  2. Fu, H.; Zhang, Y.; An, Q.; Wang, D.; You, S.; Zhao, D.; Zhang, J.; Wang, C.; Li, M. Anti-Photoaging effect of rhodiola rosea fermented by lactobacillus plantarum on UVA-damaged fibroblasts. Nutrients 2022, 14, 2324. [Google Scholar] [CrossRef] [PubMed]
  3. Kang, K.A.; Wang, Z.H.; Zhang, R.; Piao, M.J.; Kim, K.C.; Kang, S.S.; Kim, Y.W.; Lee, J.; Park, D.; Hyun, J.W. Myricetin protects cells against oxidative stress-induced apoptosis via regulation of PI3K/AKT and MAPK Signaling Pathway. Int. J. Mol. Sci. 2010, 11, 4348–4360. [Google Scholar] [CrossRef] [PubMed]
  4. Morry, J.; Ngamcherdtrakul, W.; Yantasee, W. Oxidative stress in cancer and fibrosis: Opportunity for therapeutic intervention with antioxidant compounds, enzymes, and nanoparticles. Redox Biol. 2017, 11, 240–253. [Google Scholar] [CrossRef]
  5. Yang, S.S.; Zhou, L.; Nephrology, D.O. Resveratrol inhibits oxidative stress-mediated apoptosis in renal tubular epithelial cells by activating PI3K/AKT pathway. Mod. Chin. Med. 2019, 21, 913–919. [Google Scholar]
  6. Cheng, W.; An, Q.; Zhang, J.; Shi, X.; Wang, C.; Li, M.; Zhao, D. Protective effect of ectoin on UVA/H2O2-induced oxidative damage in human skin fibroblast cells. Appl. Sci. 2022, 12, 8531. [Google Scholar] [CrossRef]
  7. Abadie, S.; Bedos, P.; Rouquette, J. A human skin model to evaluate the protective effect of compounds against UVA damage. Int. J. Cosmet. Sci. 2019, 41, 594–603. [Google Scholar] [CrossRef] [PubMed]
  8. Yaar, M.; Gilchrest, B.A. Photoageing: Mechanism, prevention and therapy. Br. J. Dermatol. 2007, 157, 874–887. [Google Scholar] [CrossRef]
  9. Chen, T.; Guo, Z.P.; Jiao, X.Y.; Zhang, Y.H.; Li, J.Y.; Liu, H.J. Protective effects of peoniflorin against hydrogen peroxide-induced oxidative stress in human umbilical vein endothelial cells. Can. J. Physiol. Pharmacol. 2011, 89, 445–453. [Google Scholar] [CrossRef]
  10. Park, K.J.; Kim, Y.J.; Kim, J.; Kim, S.; Lee, S.Y.; Bae, J.W. Protective effects of peroxiredoxin on hydrogen peroxide induced oxidative stress and apoptosis in cardiomyocytes. Korean Circ. J. 2012, 42, 23–32. [Google Scholar] [CrossRef]
  11. Zhu, L.; Chang, R.Z.; Qiu, L.J. Application of serial analysis of gene expression in the analysis of gene expression in plant. Sci. Agric. Sin. 2003, 36, 1233–1240. [Google Scholar]
  12. Su, Z.Q.; Fang, H.; Hong, H.X.; Shi, L.M.; Zhang, W.Q.; Zhang, Y.Y. An investigation of biomarkers derived from legacy microarray data for their utility in the RNA-seq era. Genome Biol. 2014, 15, 523. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Wang, C.B.; Lu, W.H.; Lin, Y.; Luo, J.Z. Development and application of transcriptome sequencing. Environ. Sci. Technol. 2018, 35, 20–26. [Google Scholar]
  14. Qi, Y.X.; Liu, Y.B.; Rong, W.H. RNA-Seq and its applications: A new technology for transcriptomics. Hereditas 2011, 33, 1191–1202. [Google Scholar] [CrossRef]
  15. Bhatt, G.; Gupta, A.; Rangan, L.; Limaye, A.M. Global transcriptome analysis reveals partial estrogen-like effects of karanjin in MCF-7 breast cancer cells. Gene 2022, 830, 146507. [Google Scholar] [CrossRef]
  16. Deng, Y.; Huang, Q.; Hu, L.; Liu, T.; Zheng, B.; Lu, D.; Guo, C.; Zhou, L. Enhanced exopolysaccharide yield and antioxidant activities of Schizophyllum Sommune fermented products by the addition of radix puerariae. RSC Adv. 2021, 11, 38219–38234. [Google Scholar] [CrossRef]
  17. Caseiro, C.; Ribeiro Dias, J.N.; Godinho de Andrade Fontes, C.M.; Bule, P. From cancer therapy to winemaking: The molecular structure and applications of β-glucans and β-1,3-glucanases. Int. J. Mol. Sci. 2022, 23, 3156. [Google Scholar] [CrossRef]
  18. Badalyan, S.M.; Barkhudaryan, A.; Rapior, S. Medicinal macrofungi as cosmeceuticals: A review. Int. J. Med. Mushrooms 2022, 24, 1–13. [Google Scholar] [CrossRef]
  19. Vuong, V.; Muthuramalingam, K.; Singh, V.; Choi, C.; Kim, Y.M.; Unno, T.; Cho, M. Schizophyllum commune-derived β-glucan improves intestinal health demonstrating protective effects against constipation and common metabolic disorders. Appl. Biol. Chem. 2022, 65, 9. [Google Scholar]
  20. Shen, Y.; Hu, C.; Zhang, H.; Jiang, H. Characteristics of three typical chinese highland barley varieties: Phenolic compounds and antioxidant activities. J. Food Biochem. 2018, 42, e12488. [Google Scholar] [CrossRef]
  21. Okonogi, S.; Kaewpinta, A.; Junmahasathien, T.; Yotsawimonwat, S. Effect of rice variety and modification on antioxidant and anti-inflammatory activities. Drug Discov. Ther. 2018, 12, 206–213. [Google Scholar] [CrossRef] [PubMed]
  22. Zhu, Y.; Li, T.; Fu, X.; Brennan, M.; Abbasi, A.M.; Zheng, B.; Liu, R.H. The use of an enzymatic extraction procedure for the enhancement of highland barley (Hordeum vulgare L.) phenolic and antioxidant compounds. Int. J. Food Sci. Tech. 2016, 51, 1916–1924. [Google Scholar] [CrossRef]
  23. Chang, Y.W.; Alli, I.; Konishi, Y.; Ziomek, E. Characterization of protein fractions from Chickpea (Cicer Arietinum L.) and Oat (Avena Sativa L.) seeds using proteomic techniques. Food Res. Int. 2011, 44, 3094–3104. [Google Scholar] [CrossRef]
  24. Abd Razak, D.L.; Abd Rashid, N.Y.; Jamaluddin, A.; Sharifudin, S.A.; Long, K. Enhancement of phenolic acid content and antioxidant activity of rice bran fermented with rhizopus oligosporus and monascus purpureus. Biocatal. Agric. Biotechnol. 2015, 4, 33–38. [Google Scholar] [CrossRef]
  25. Wu, H.; Liu, H.N.; Ma, A.M.; Zhou, J.Z.; Xia, X.D. Synergetic effects of lactobacillus plantarum and rhizopus oryzae on physicochemical, nutritional and antioxidant properties of whole-grain Oats (Avena Sativa L.) during solid-state fermentation. LWT 2022, 154, 112687. [Google Scholar] [CrossRef]
  26. Deng, Y.; Liu, H.; Huang, Q.; Tu, L.; Hu, L.; Zheng, B.; Sun, H.; Lu, D.; Guo, C.; Zhou, L. Mechanism of longevity extension of caenorhabditis elegans induced by Schizophyllum Commune fermented supernatant with added radix puerariae. Front. Nutr. 2022, 9, 847064. [Google Scholar] [CrossRef]
  27. Liu, W.; Chen, Y.; Wang, Q. Attenuated and synergistic effects of liquid fermentation polysaccharide of Schizophyllum on tumor-bearing mice treated with chemotherapy. Lishizhen Med. Mater. Med. Res. 2012, 23, 321–322. [Google Scholar]
  28. Song, Y.R.; Han, A.R.; Park, S.G. Effect of enzyme-assisted extraction on the physicochemical properties and bioactive potential of lotus leaf polysaccharides. Int. J. Biol. Macromol. 2020, 153, 169–179. [Google Scholar] [CrossRef]
  29. You, C.H.; Heng, W.L.; Mallikarjuna, K. Dermato-protective properties of ergothioneine through induction of Nrf2/ARE-mediated antioxidant genes in UVA-irradiated Human keratinocytes. Free Radical Bio. Med. 2015, 86, 102–117. [Google Scholar]
  30. Li, Q.; Bai, D.; Qin, L.; Shao, M.; Zhang, S.; Yan, C.; Yu, G.; Hao, J. Protective effect of D-tetramannuronic acid tetrasodium salt on UVA-induced photo-aging in HaCaT cells. Biomed. Pharmacother. 2020, 126, 110094. [Google Scholar] [CrossRef]
  31. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  32. Reiter, R.J.; Tan, D.X.; Rosales-Corral, S.; Galano, A.; Zhou, X.J.; Xu, B. Mitochondria: Central Organelles for Melatonin’s Antioxidant and Anti-Aging Actions. Molecules 2018, 23, 509. [Google Scholar] [CrossRef] [PubMed]
  33. Sun, Q.; Fang, J.; Wang, Z.; Song, Z.; Geng, J.; Wang, D.; Wang, C.; Li, M. Two Laminaria japonica Fermentation Broths Alleviate Oxidative Stress and Inflammatory Response Caused by UVB Damage: Photoprotective and Reparative Effects. Mar. Drugs 2022, 20, 650. [Google Scholar] [CrossRef] [PubMed]
  34. Schieber, M.; Chandel, N.S. ROS Function in Redox Signaling and Oxidative Stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef]
  35. Kim, J.W.; Jo, E.H.; Moon, J.E.; Cha, H.; Chang, M.H.; Cho, H.T. In vitro and in vivo inhibitory effect of citrus junos tanaka peel extract against oxidative stress-induced apoptotic death of Lung cells. Antioxidants 2020, 9, 1231. [Google Scholar] [CrossRef]
  36. Zhou, F.; Huang, X.; Pan, Y.; Cao, D.; Liu, C.; Liu, Y.; Chen, A. Resveratrol protects HaCaT cells from ultraviolet B-induced photoaging via upregulation of HSP27 and modulation of mitochondrial caspase-dependent apoptotic pathway. Biochem. Biophys. Res. Commun. 2018, 499, 662–668. [Google Scholar] [CrossRef]
  37. Sies, H. Role of metabolic H2O2 generation: Redox signaling and oxidative stress. J. Biol. Chem. 2014, 289, 8735–8741. [Google Scholar] [CrossRef]
  38. Feehan, R.P.; Coleman, C.S.; Ebanks, S.; Lang, C.H.; Shantz, L.M. REDD1 interacts with AIF and regulates mitochondrial reactive oxygen species generation in the keratinocyte response to UVB. Biochem. Bioph. Res. Commun. 2022, 616, 56–62. [Google Scholar] [CrossRef]
  39. Baumann, L. Skin ageing and its treatment. J. Pathol. 2007, 211, 241–251. [Google Scholar] [CrossRef]
  40. Su, Y.; Zhang, Y.; Fu, H.; Yao, F.; Liu, P.; Mo, Q.; Wang, D.; Zhao, D.; Wang, C.; Li, M. Physicochemical and anti-UVB-induced skin inflammatory properties of Lacticaseibacillus paracasei Subsp. paracasei SS-01 strain exopolysaccharide. Fermentation 2022, 8, 198. [Google Scholar]
  41. Alafiatayo, A.A.; Lai, K.S.; Ahmad, S.; Mahmood, M.; Shaharuddin, N.A. RNA-seq analysis revealed genes associated with UV-induced cell necrosis through MAPK/TNF-α pathways in human dermal fibroblast cells as an inducer of premature photoaging. Genomics 2020, 112, 484–493. [Google Scholar] [CrossRef] [PubMed]
  42. Zheng, Y.; Xu, Q.; Chen, H. Transcriptome analysis of ultraviolet A-induced photoaging cells with deep sequencing. J. Dermatol. 2018, 45, 175–181. [Google Scholar] [CrossRef] [PubMed]
  43. Barandalla, M.; Shi, H.; Xiao, H.; Colleoni, S.; Galli, C.; Lio, P.; Trotter, M.; Lazzari, G. Global gene expression profiling and senescence biomarker analysis of hESC exposed to H2O2 induced non-cytotoxic oxidative stress. Stem Cell Res. Ther. 2017, 8, 160. [Google Scholar] [CrossRef] [PubMed]
  44. Yang, M.; Song, Y.; Zhang, H.; Ji, J.; Yang, J. IL-17 inhibits apoptosis of Hep-2 cells by regulating PI3K/AKT/FAS/FASL signaling pathway. Acta Univ. Med. Anhui 2018, 53, 1681–1684. [Google Scholar]
  45. Zha, L.; He, L.; Liang, Y.; Qin, H.; Yu, B.; Chang, L.; Xue, L. TNF-Alpha Contributes to Postmenopausal Osteoporosis by Synergistically Promoting RANKL-Induced Osteoclast Formation. Biomed. Pharmacother. 2018, 102, 369–374. [Google Scholar] [CrossRef] [PubMed]
  46. Zou, Z.R.; Long, X.; Zhao, Q.; Zheng, Y.D.; Song, M.S.; Ma, S. A Single-Cell Transcriptomic Atlas of Human Skin Aging. Dev. Cell 2020, 3, 383. [Google Scholar] [CrossRef]
  47. Hao, D.; Wen, X.; Liu, L.; Wang, L.; Zhou, X.; Li, Y. Sanshool improves UVB-induced skin photodamage by targeting JAK2/STAT3-dependent autophagy. Cell Death Dis. 2019, 10, 485–494. [Google Scholar] [CrossRef]
  48. Ma, C.; Jia, X. Research progress on the role of extracellular matrix in skin cryopreservation. Acad. J. PLA Postgrad. Med. Sch. 2006, 27, 398–400. [Google Scholar]
  49. Miller, L.S.; Cho, J.S. Immunity against staphylococcus aureus cutaneous infections. Nat. Rev. Immunol. 2011, 11, 505–518. [Google Scholar] [CrossRef] [Green Version]
  50. Sun, Y.; Zhang, J.; Zhou, Z.; Wu, P.; Huo, R.; Wang, B.; Shen, Z.; Li, H.; Zhai, T.; Shen, B.; et al. CCN1, a pro-inflammatory factor, aggravates psoriasis skin lesions by promoting keratinocyte activation. J. Investig. Dermatol. 2015, 135, 2666–2675. [Google Scholar] [CrossRef]
  51. Kalutharage, N.K.; Rathnasinghe, D.L. A Study of Chitosan and Glucosamine Isolated from Sri Lankan Local Mushroom Schizophyllum Commune and Oyster Mushroom (Pleurotus Ostreatus). Mater. Today Proc. 2020, 23, 119–122. [Google Scholar] [CrossRef]
  52. Kumar, A.; Bharti, A.K.; Bezie, Y. Schizophyllum Commune: A Fungal Cell-Factory for Production of Valuable Metabolites and Enzymes. Bioresources 2022, 17, 5420–5436. [Google Scholar] [CrossRef]
  53. Patel, S.; Goyal, A. Recent developments in mushrooms as anti-cancer therapeutics: A review. 3 Biotech 2011, 2, 1–15. [Google Scholar] [CrossRef] [PubMed]
  54. Chen, Z.; Yin, C.; Fan, X.; Ma, K.; Yao, F.; Zhou, R.; Shi, D.; Cheng, W.; Gao, H. Characterization of physicochemical and biological properties of Schizophyllum Commune polysaccharide extracted with different methods. Int. J. Biol. Macromol. 2020, 156, 1425–1434. [Google Scholar] [CrossRef]
  55. Meade, B.; Thome, K. International Food Security Assessment, 2017–2027; U.S. Department of Agriculture: Washington, DC, USA, 2017; pp. 26–37. [Google Scholar]
  56. Zhang, F.; Jiang, G.; Li, W.; Qin, S.; Li, H.; Gao, Z.; Cai, G.; Lin, T. MaxENT modeling for predicting the spatial distribution of three reptors in the Sanjiangyuan National Park. China Ecol. Evol. 2019, 9, 6643–6654. [Google Scholar] [CrossRef]
  57. Zhang, T.; Wang, Q.; Li, J.; Zhao, S.; Qie, M.; Wu, X.; Bai, Y.; Zhao, Y. Study on the origin traceability of tibet highland barley (Hordeum Vulgare L.) based on its nutrients and mineral elements. Food Chem. 2021, 346, 128928. [Google Scholar] [CrossRef]
  58. Obadi, M.; Sun, J.; Xu, B. Highland barley: Chemical composition, bioactive compounds, health effects, and applications. Food Res. Int. 2021, 140, 110065. [Google Scholar] [CrossRef] [PubMed]
  59. Ren, C.; Yan, J.; Dong, R.; Hu, X. Research progress on oat nutrients, functional properties and related products. Sci. Technol. Food Ind. 2022, 5, 1–14. [Google Scholar]
  60. Yang, C.; Chen, M.; Dai, T.; Chen, J. Research advances in functional properties and application of Oat β-glucan. J. Chin. Inst. Food Sci. Technol. 2021, 6, 301–311. [Google Scholar]
Foods 12 00806 g001 550
Figure 1. The toxicity of UVA (A), H2O2 (B) to HSF cells, and the diagrams of the DEG GO terms (C–F). The results were expressed as mean ± SD (n = 6). The Model in (A) was established by UVA (15 J/cm2) irradiation; and the Model in (B) was established by H2O2 (1000 μmol/L for 30 min) treatment. In the bubble diagram, the vertical axis indicated GO terms and the horizontal axis represented gene ratio involved in each term. The size of dots indicated the number of genes in the GO term. The color of dots exhibited the significance. (C,E), differentially upregulated genes; (D,F), differently downregulated genes.
Figure 1. The toxicity of UVA (A), H2O2 (B) to HSF cells, and the diagrams of the DEG GO terms (C–F). The results were expressed as mean ± SD (n = 6). The Model in (A) was established by UVA (15 J/cm2) irradiation; and the Model in (B) was established by H2O2 (1000 μmol/L for 30 min) treatment. In the bubble diagram, the vertical axis indicated GO terms and the horizontal axis represented gene ratio involved in each term. The size of dots indicated the number of genes in the GO term. The color of dots exhibited the significance. (C,E), differentially upregulated genes; (D,F), differently downregulated genes.
Foods 12 00806 g001
Foods 12 00806 g002 550
Figure 2. Bar diagrams and bubble diagrams of KEGG pathway enrichment analysis of UVA-induced (A–C) and H2O2-induced (D–F) DEGs. (A, D), differentially upregulated genes in each study; (B,E), differently downregulated genes in each study. In the bubble diagram, the vertical axis indicated GO terms and the horizontal axis represented gene ratio involved in each term. The size of dots indicated the number of genes in the GO term. The color of dots exhibited the significance. (C,F), the top 10 ranked KEGG terms of both upregulated and downregulated DEGs. In the bar diagram, the right vertical axis indicated the significance of each term by exhibiting a value of −log10(P), and the left vertical axis showed the number of genes involved in each term. The horizontal axis represented the top 10 ranked KEGG terms.
Figure 2. Bar diagrams and bubble diagrams of KEGG pathway enrichment analysis of UVA-induced (A–C) and H2O2-induced (D–F) DEGs. (A, D), differentially upregulated genes in each study; (B,E), differently downregulated genes in each study. In the bubble diagram, the vertical axis indicated GO terms and the horizontal axis represented gene ratio involved in each term. The size of dots indicated the number of genes in the GO term. The color of dots exhibited the significance. (C,F), the top 10 ranked KEGG terms of both upregulated and downregulated DEGs. In the bar diagram, the right vertical axis indicated the significance of each term by exhibiting a value of −log10(P), and the left vertical axis showed the number of genes involved in each term. The horizontal axis represented the top 10 ranked KEGG terms.
Foods 12 00806 g002
Foods 12 00806 g003 550
Figure 3. PI3K-AKT Signaling Pathway in UVA-induced(A) and H2O2-induced(B) model. Red: upregulated gene; Yellow: downregulated gene; Green: not regulated significantly gene.
Figure 3. PI3K-AKT Signaling Pathway in UVA-induced(A) and H2O2-induced(B) model. Red: upregulated gene; Yellow: downregulated gene; Green: not regulated significantly gene.
Foods 12 00806 g003
Foods 12 00806 g004 550
Figure 4. The toxicity of RFB (A), HBFB (B) and OFB (C) to HSF cells and the repair effects of RFB (D), HBFB (E), and OFB (F) on UVA-induced and H2O2-induced oxidative stress damage in HSF cells. The results were expressed as mean ± SD (n = 6). The discussed concentrations of RFB, HBFB and OFB were 0.625 mg/mL, 0.625 mg/mL, and 0.32 mg/mL, respectively. **, p < 0.01, UVA/H2O2-induced model compared with the DMEM-treated control. # p < 0.05, and ## p < 0.01, RFB, HBFB, OFB compared with the Model.
Figure 4. The toxicity of RFB (A), HBFB (B) and OFB (C) to HSF cells and the repair effects of RFB (D), HBFB (E), and OFB (F) on UVA-induced and H2O2-induced oxidative stress damage in HSF cells. The results were expressed as mean ± SD (n = 6). The discussed concentrations of RFB, HBFB and OFB were 0.625 mg/mL, 0.625 mg/mL, and 0.32 mg/mL, respectively. **, p < 0.01, UVA/H2O2-induced model compared with the DMEM-treated control. # p < 0.05, and ## p < 0.01, RFB, HBFB, OFB compared with the Model.
Foods 12 00806 g004
Foods 12 00806 g005 550
Figure 5. The relative gene expression changes after the repair of rice fermentation broth (RFB, A), highland barley fermentation broth (HBFB, B) and oats fermented broth (OFB, C) on UVA and H2O2 injury. RFB, HBFB, and OFB are three kinds of S. commune fermentation broths. Genes, COL1A1 (A-1, B-1, C-1), COL1A2 (A-2, B-2, C-2), PIK3R1 (A-3, B-3, C-3), FN1 (A-4, B-4, C-4), IGF2 (A-5, B-5, C-5) and COL4A5 (A-6, B-6, C-6) were measured. The UVA bar represented the model established by UVA (15 J/cm2) treatment; the H2O2 bar represented the model established by H2O2 (1000 µmol/L for 30 min) treatment. **, p < 0.01, the UVA/H2O2-induced model compared with the DMEM-treated control. ## p < 0.01 and n.s. p > 0.05, RFB, HBFB, and OFB treated cells compared with the Model.
Figure 5. The relative gene expression changes after the repair of rice fermentation broth (RFB, A), highland barley fermentation broth (HBFB, B) and oats fermented broth (OFB, C) on UVA and H2O2 injury. RFB, HBFB, and OFB are three kinds of S. commune fermentation broths. Genes, COL1A1 (A-1, B-1, C-1), COL1A2 (A-2, B-2, C-2), PIK3R1 (A-3, B-3, C-3), FN1 (A-4, B-4, C-4), IGF2 (A-5, B-5, C-5) and COL4A5 (A-6, B-6, C-6) were measured. The UVA bar represented the model established by UVA (15 J/cm2) treatment; the H2O2 bar represented the model established by H2O2 (1000 µmol/L for 30 min) treatment. **, p < 0.01, the UVA/H2O2-induced model compared with the DMEM-treated control. ## p < 0.01 and n.s. p > 0.05, RFB, HBFB, and OFB treated cells compared with the Model.
Foods 12 00806 g005
Foods 12 00806 g006 550
Figure 6. RFB, HBFB and OFB influence the signaling pathways of UVA/H2O2-induced skin oxidative damage. RFB, HBFB, and OFB are three kinds of S. commune fermentation broths. RFB, rice fermentation broth; HBFB, highland barley fermentation broth; OFB, oats fermented broth.
Figure 6. RFB, HBFB and OFB influence the signaling pathways of UVA/H2O2-induced skin oxidative damage. RFB, HBFB, and OFB are three kinds of S. commune fermentation broths. RFB, rice fermentation broth; HBFB, highland barley fermentation broth; OFB, oats fermented broth.
Foods 12 00806 g006
Table
Table 1. Summary of read screening and mapping results of the sequences generated from cells with different treatments.
Table 1. Summary of read screening and mapping results of the sequences generated from cells with different treatments.
TermSampleRaw ReadsClean ReadsTotal ReadsMultiple MappedUniquely Mapped
H2O2control152,006,26051,489,80651,489,8061,585,446 (3.08%)48,550,893 (94.29%)
control251,434,36651,007,38251,007,3821,656,100 (3.25%)48,073,211(94.25%)
contro1347,992,48047,570,27847,570,2781,767,599 (3.72%)44,528,485 (93.61%)
model142,375,54441,851,30441,851,3042,523,225 (6.03%)37,561,116 (89.75%)
model255,834,67255,256,32455,256,3241,946,513 (3.52%)51,879,913 (93.89%)
model353,168,94452,654,86452,654,8641,852,768 (3.52%)49,508,846 (94.03%)
UVAcontrol1203,492,014201,140,460201,140,4609,220,602 (4.58%)108,745,918 (54.06%)
control2214,473,458212,140,016212,140,01610,108,543 (4.77%)114,327,168 (53.89%)
control3201,264,476199,240,206199,240,2068,290,552 (4.16%)103,655,047 (52.03%)
model1183,171,608180,873,264180,873,26410,508,759 (5.81%)117542871 (64.99%)
model2219,499,948216,959,018216,959,01812,593,146 (5.8%)137,233,440 (63.25%)
model3207,223,010204,370,646204,370,64612,256,006 (6.0%)131,192,428 (64.19%)
Notes: Control represents the cell sample without the UVA/H2O2; Model represents the cell sample with the UVA/H2O2. Three replicates of Control (Control 1, 2 and 3) and Model (Model 1, 2 and 3) treatments were carried out in RNA-seq analysis.
Table
Table 2. Primer sequences for real-time PCR.
Table 2. Primer sequences for real-time PCR.
GeneDirectionPrimer Pair Sequence (5′→3′)
GAPDHFTCAGACACCATGGGGAAGGT
RTCCCGTTCTCAGCCATGTAG
COL4A5FCAAGGTCTACCAGGTCCAGAA
RTCATTCCATTGAGACCCGGC
FN1FCCCAATTGAGTGCTTCATGCC
RCCTCCAGAGCAAAGGGCTTA
IGF2FTCCTGTGAAAGAGACTTCCAG
RGTCTCACTGGGGCGGTAAG
COL1A1FGAGGGCCAAGACGAAGACATC
RCAGATCACGTCATCGCACAAC
COL1A2FGTTGCTGCTTGCAGTAACCTT
RAGGGCCAAGTCCAACTCCTT
PIK3R1FACCACTACCGGAATGAATCTCT
RGGGATGTGCGGGTATATTCTTC
Notes: F, forward primer; R, reverse primer; the primer organism is homo sapiens.
Table
Table 3. Functional characterization of up/downregulated differential expressed genes in UVA-induced model.
Table 3. Functional characterization of up/downregulated differential expressed genes in UVA-induced model.
Gene_IdGene NameGene DescriptionLog2FCP-AdjustFunction
ENSG00000187961KLHL17kelch like family member 17 0.4578.97 × 10−5Cytoskeleton organization
ENSG00000125817CENPBcentromere protein B 0.3421.87 × 10−10Cytoskeleton organization
ENSG00000011426ANLNanillin actin binding protein −0.2993.31 × 10−2Cytoskeleton organization
ENSG00000123384LRP1LDL receptor related protein 1 −0.4352.99 × 10−16Cytoskeleton organization
ENSG00000288380CRIPAKcysteine rich PAK1 inhibitor −0.4011.97 × 10−2Cytoskeleton organization
ENSG00000275993SIK1Bsalt inducible kinase 1B (putative) −2.2111.70 × 10−22Cytoskeleton organization
ENSG00000147202DIAPH2diaphanous related formin 2 −0.3341.34 × 10−8Cytoskeleton organization
ENSG00000160551TAOK1TAO kinase 1−0.2644.71 × 10−9Cytoskeleton organization
ENSG00000075826SEC31BSEC31 homolog B, COPII coat complex component 0.3706.71 × 10−5Transport
ENSG00000137700SLC37A4solute carrier family 37 member 4 0.4851.26 × 10−3Transport
ENSG00000225697SLC26A6solute carrier family 26 member 6 0.4483.28 × 10−12Transport
ENSG00000155287SLC25A28solute carrier family 25 member280.4033.14 × 10−6Transport
ENSG00000153291SLC25A27solute carrier family 25 member 27 0.2786.30 × 10−4Transport
ENSG00000213901SLC23A3solute carrier family 23 member 3 0.3403.43 × 10−2Transport
ENSG00000197208SLC22A4solute carrier family 22 member40.2922.76 × 10−5Transport
ENSG00000101194SLC17A9solute carrier family 17 member 9 0.4212.03 × 10−5Transport
ENSG00000105643ARRDC2arrestin domain containing 2 0.2764.49 × 10−2Transport
ENSG00000205593DENND6BDENN domain containing 6B 0.2934.04 × 10−2Transport
ENSG00000157514TSC22D3TSC22 domain family member 30.2857.88 × 10−4Transport
ENSG00000140104CLBA1clathrin binding box of aftiphilin containing 1 0.3282.62 × 10−2Transport
ENSG00000106266SNX8sorting nexin 80.2942.33 × 10−4Transport
ENSG00000274512TBC1D3LTBC1 domain family member 3L 0.3772.85 × 10−3Transport
ENSG00000104886PLEKHJ1pleckstrin homology domain containing J1 0.3119.15 × 10−3Transport
ENSG00000177096PHETA2PH domain containing endocytic trafficking adaptor 20.3051.35 × 10−2Transport
ENSG00000257390AC023055.1novel protein0.4671.20 × 10−3Transport
ENSG00000254852NPIPA2nuclear pore complex interacting protein family member A20.2794.98 × 10−3Transport
ENSG00000095066HOOK2hook microtubule tethering protein 20.2971.92 × 10−2Transport
ENSG00000101199ARFGAP1ADP ribosylation factor GTPase activating protein 1 0.2809.43 × 10−7Transport
ENSG00000213983AP1G2adaptor related protein complex 1 subunit gamma 2 0.3181.78 × 10−2Transport
ENSG00000181404WASHC1WASH complex subunit 10.4506.60 × 10−18Transport
ENSG00000139190VAMP1vesicle associated membrane protein 1 0.6015.83 × 10−6Transport
ENSG00000162341TPCN2two pore segment channel 2 0.2921.43 × 10−2Transport
ENSG00000114268PFKFB46-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 0.6321.33 × 10−3Transport
ENSG00000196655TRAPPC4trafficking protein particle complex 4 0.2754.52 × 10−2Transport
ENSG00000102287GABREgamma-aminobutyric acid type A receptor epsilon subunit 0.3174.13 × 10−4Transport
ENSG00000225663MCRIP1MAPK regulated corepressor interacting protein 1 0.2704.63 × 10−3Transport
ENSG00000081692JMJD4jumonji domain containing 40.3532.60 × 10−2Transport
ENSG00000168026TTC21Atetratricopeptide repeat domain 21A0.3834.65 × 10−2Transport
ENSG00000108932SLC16A6solute carrier family 16 member 6 −0.4161.95 × 10−4Transport
ENSG00000117479SLC19A2solute carrier family 19 member 2 −1.3606.72 × 10−42Transport
ENSG00000140199SLC12A6solute carrier family 12 member6−0.2792.21 × 10−5Transport
ENSG00000171488LRRC8Cleucine rich repeat containing 8 VRAC subunit C −0.2692.37 × 10−2Transport
ENSG00000169446MMGT1membrane magnesium transporter 1 −0.3064.40 × 10−4Transport
ENSG00000228253MT-ATP8mitochondrially encoded ATP synthase membrane subunit 8 −0.5676.75 × 10−4Transport
ENSG00000198899MT-ATP6mitochondrially encoded ATP synthase membrane subunit 6 −0.4572.44 × 10−3Transport
ENSG00000165714BORCS5BLOC-1 related complex subunit 5−0.2854.97 × 10−3Transport
ENSG00000181333HEPHL1hephaestin like 1 −0.2853.27 × 10−3Transport
ENSG00000107771CCSER2coiled-coil serine rich protein 2 −0.2721.36 × 10−6Transport
ENSG00000115657ABCB6ATP binding cassette subfamily B member 6 (Langereis blood group)0.3037.37 × 10−4Cellular and extracellular matrix
ENSG00000117425PTCH2patched 2 0.2851.16 × 10−2Cellular and extracellular matrix
ENSG00000125551PLGLB2plasminogen like B20.3831.82 × 10−2Cellular and extracellular matrix
ENSG00000164877MICALL2MICAL like 20.2859.72 × 10−3Cellular and extracellular matrix
ENSG00000156535CD109CD109 molecule−0.3991.50 × 10−25Cellular and extracellular matrix
ENSG00000185022MAFFMAF bZIP transcription factor F−0.9685.78 × 10−80Cellular and extracellular matrix
ENSG00000166147FBN1fibrillin 1−0.4214.89 × 10−30Cellular and extracellular matrix
ENSG00000165240ATP7AATPase copper transporting alpha −0.2772.43 × 10−4Cellular and extracellular matrix
ENSG00000142871CCN1cellular communication network factor 1 −0.4104.51 × 10−25Cellular and extracellular matrix
ENSG00000038427VCANversican −0.4922.64 × 10−13Cellular and extracellular matrix
ENSG00000116962NID1nidogen 1 −0.3561.04 × 10−21Cellular and extracellular matrix
ENSG00000187955COL14A1collagen type XIV alpha 1 chain −0.3031.32 × 10−3Cellular and extracellular matrix
ENSG00000196569LAMA2laminin subunit alpha 2 −0.4075.66 × 10−28Cellular and extracellular matrix
ENSG00000142798HSPG2heparan sulfate proteoglycan 2−0.4408.61 × 10−14Cellular and extracellular matrix
ENSG00000123500COL10A1collagen type X alpha 1 chain−0.2822.54 × 10−2Cellular and extracellular matrix
ENSG00000187498COL4A1collagen type IV alpha 1 chain −0.2657.12 × 10−12Cellular and extracellular matrix
ENSG00000115414FN1fibronectin 1−0.4461.23 × 10−34Cellular and extracellular matrix
ENSG00000163359COL6A3collagen type VI alpha 3 chain −0.4123.41 × 10−38Cellular and extracellular matrix
ENSG00000103196CRISPLD2cysteine rich secretory protein LCCL domain containing 2 −0.3216.09 × 10−4Cellular and extracellular matrix
ENSG00000111799COL12A1collagen type XII alpha 1 chain −0.3887.55 × 10−28Cellular and extracellular matrix
ENSG00000080561MID2midline 2 −0.2758.28 × 10−4Cellular and extracellular matrix
ENSG00000171223JUNBJunB proto-oncogene, AP-1 transcription factor subunit−1.7049.13 × 10−173Cellular and extracellular matrix
ENSG00000101825MXRA5matrix remodeling associated 5 −0.3878.91 × 10−32Cellular and extracellular matrix
ENSG00000113369ARRDC3arrestin domain containing 3 −0.2896.30 × 10−4Cellular and extracellular matrix
ENSG00000138759FRAS1Fraser extracellular matrix complex subunit 1 −0.4474.82 × 10−14Cellular and extracellular matrix
ENSG00000106780MEGF9multiple EGF like domains 9 −0.2843.72 × 10−3Cellular and extracellular matrix
ENSG00000119681LTBP2latent transforming growth factor beta binding protein 2−0.2703.80 × 10−10Cellular and extracellular matrix
ENSG00000182179UBA7ubiquitin like modifier activating enzyme 7 0.2786.06 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000148399DPH7diphthamide biosynthesis 70.3455.72 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000167733HSD11B1Lhydroxysteroid 11-beta dehydrogenase 1 like 0.2844.11 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000104852SNRNP70small nuclear ribonucleoprotein U1 subunit 70 0.3406.65 × 10−17Metabolism/Cell Proliferation/Regulation
ENSG00000125901MRPS26mitochondrial ribosomal protein S260.2893.13 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000183513COA5cytochrome c oxidase assembly factor 5 0.2734.15 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000165792METTL17methyltransferase like 17 0.4015.91 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000100429HDAC10histone deacetylase 100.2741.11 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000141519CCDC40coiled-coil domain containing 40 0.3833.27 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000172828CES3carboxylesterase 30.5062.88 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000139631CSADcysteine sulfinic acid decarboxylase0.3118.25 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000112578BYSLbystin like0.3311.17 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000213398LCATlecithin-cholesterol acyltransferase0.4883.70 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000232653GOLGA8Ngolgin A8 family member N 0.3482.84 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000145020AMTaminomethyltransferase0.3884.57 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000178038ALS2CLALS2 C-terminal like0.4091.90 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000179886TIGD5tigger transposable element derived 5 0.3134.31 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000128710HOXD10homeobox D10 0.3193.71 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000108641B9D1B9 domain containing 10.2863.29 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000197774EME2essential meiotic structure-specific endonuclease subunit 20.3858.64 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000172732MUS81MUS81 structure-specific endonuclease subunit 0.2767.00 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000039650PNKPpolynucleotide kinase 3′-phosphatase 0.2841.49 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000129250KIF1Ckinesin family member 1C0.3661.72 × 10−17Metabolism/Cell Proliferation/Regulation
ENSG00000010292NCAPD2non-SMC condensin I complex subunit D2 0.3282.36 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000146063TRIM41tripartite motif containing 41 0.3321.10 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000140983RHOT2ras homolog family member T20.3285.44 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000163482STK36serine/threonine kinase 360.2734.31 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000138834MAPK8IP3mitogen-activated protein kinase 8 interacting protein 30.3091.58 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000148120AOPEPaminopeptidase O (putative)0.4691.77 × 10−9Metabolism/Cell Proliferation/Regulation
ENSG00000167100SAMD14sterile alpha motif domain containing 14 0.2704.18 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000110455ACCS1-aminocyclopropane-1-carboxylate synthase homolog (inactive)0.3573.47 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000158062UBXN11UBX domain protein 11 0.3031.60 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000107829FBXW4F-box and WD repeat domain containing 4 0.3471.00 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000138835RGS3regulator of G protein signaling 30.3439.63 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000232119MCTS1MCTS1 re-initiation and release factor 0.2781.81 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000167280ENGASEendo-beta-N-acetylglucosaminidase 0.4091.64 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000149716LTO1LTO1 maturation factor of ABCE10.3074.33 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000250151ARPC4-TTLL3ARPC4-TTLL3 readthrough0.3541.51 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000073605GSDMBgasdermin B0.4481.17 × 10−8Metabolism/Cell Proliferation/Regulation
ENSG00000148824MTG1mitochondrial ribosome associated GTPase 1 0.3031.28 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000137504CREBZFCREB/ATF bZIP transcription factor 0.2873.31 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000180902D2HGDHD-2-hydroxyglutarate dehydrogenase 0.2743.10 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000042429MED17mediator complex subunit 17 0.4081.86 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000149930TAOK2TAO kinase 20.4568.73 × 10−17Metabolism/Cell Proliferation/Regulation
ENSG00000139546TARBP2TARBP2 subunit of RISC loading complex 0.3109.44 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000116001TIA1TIA1 cytotoxic granule associated RNA binding protein0.3328.51 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000115053NCLnucleolin0.2751.29 × 10−12Metabolism/Cell Proliferation/Regulation
ENSG00000173559NABP1nucleic acid binding protein 1 0.2854.36 × 10−10Metabolism/Cell Proliferation/Regulation
ENSG00000198585NUDT16nudix hydrolase 16 0.3174.87 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000167393PPP2R3Bprotein phosphatase 2 regulatory subunit B’’beta 0.3312.50 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000141456PELP1proline, glutamate and leucine rich protein 1 0.3373.84 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000128159TUBGCP6tubulin gamma complex associated protein 6 0.2831.47 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000078399HOXA9homeobox A90.3554.10 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000213339QTRT1queuine tRNA-ribosyltransferase catalytic subunit 1 0.2924.27 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000177192PUS1pseudouridine synthase 10.2754.58 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000144785AC073896.1novel protein0.3824.61 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000185024BRF1BRF1 RNA polymerase III transcription initiation factor subunit 0.3017.22 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000228049POLR2J2RNA polymerase II subunit J20.3393.50 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000197782ZNF780Azinc finger protein 780A0.2811.47 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000147789ZNF7zinc finger protein 70.2821.60 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000171163ZNF692zinc finger protein 6920.3901.49 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000176024ZNF613zinc finger protein 6130.4053.87 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000180626ZNF594zinc finger protein 594 0.5528.53 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000161551ZNF577zinc finger protein 5770.3099.79 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000167785ZNF558zinc finger protein 5580.3306.43 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000152433ZNF547zinc finger protein 547 0.5032.07 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000144026ZNF514zinc finger protein 514 0.2704.19 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000196653ZNF502zinc finger protein 502 0.3204.78 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000083817ZNF416zinc finger protein 4160.3374.62 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000175213ZNF408zinc finger protein 4080.3941.40 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000130684ZNF337zinc finger protein 3370.3406.05 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000083812ZNF324zinc finger protein 3240.3781.21 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000182986ZNF320zinc finger protein 3200.4066.47 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000205903ZNF316zinc finger protein 316 0.3131.86 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000174652ZNF266zinc finger protein 266 0.4331.55 × 10−10Metabolism/Cell Proliferation/Regulation
ENSG00000167380ZNF226zinc finger protein 2260.3371.45 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000197841ZNF181zinc finger protein 1810.2983.56 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000154957ZNF18zinc finger protein 18 0.3392.32 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000179909ZNF154zinc finger protein 1540.3413.55 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000213762ZNF134zinc finger protein 134 0.2802.08 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000125846ZNF133zinc finger protein 1330.3251.48 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000204946ZNF783zinc finger family member 7830.2651.58 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000197114ZGPATzinc finger CCCH-type and G-patch domain containing0.2701.89 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000140987ZSCAN32zinc finger and SCAN domain containing 32 0.4866.71 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000114853ZBTB47zinc finger and BTB domain containing 47 0.3724.54 × 10−9Metabolism/Cell Proliferation/Regulation
ENSG00000099899TRMT2AtRNA methyltransferase 2 homolog A 0.2937.14 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000100038TOP3BDNA topoisomerase III beta 0.2951.09 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000198056PRIM1DNA primase subunit 10.4611.32 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000178028DMAP1DNA methyltransferase 1 associated protein 1 0.3114.49 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000168209DDIT4DNA damage inducible transcript 4 0.2787.35 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000221978CCNL2cyclin L2 0.4292.31 × 10−23Metabolism/Cell Proliferation/Regulation
ENSG00000250506CDK3cyclin dependent kinase 3 0.5356.59 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000156345CDK20cyclin dependent kinase 200.2873.81 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000248333CDK11Bcyclin dependent kinase 11B0.2998.71 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000185324CDK10cyclin dependent kinase 100.3441.84 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000130305NSUN5NOP2/Sun RNA methyltransferase 5 0.2644.48 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000134186PRPF38Bpre-mRNA processing factor 38B0.2696.68 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000103168TAF1CTATA-box binding protein associated factor, RNA polymerase I subunit C 0.3247.71 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000178718RPP25ribonuclease P and MRP subunit p25 0.2803.45 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000264668AC138696.1novel protein0.3843.75 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000041988THAP3THAP domain containing 30.3473.09 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000104129DNAJC17DnaJ heat shock protein family (Hsp40) member C17 0.3643.96 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000187531SIRT7sirtuin 7 0.3861.73 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000108479GALK1galactokinase 10.3119.61 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000140400MAN2C1mannosidase alpha class 2C member 1 0.3843.49 × 10−12Metabolism/Cell Proliferation/Regulation
ENSG00000142102PGGHGprotein-glucosylgalactosylhydroxylysine glucosidase0.3886.40 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000181274FRAT2FRAT regulator of WNT signaling pathway 2 0.3314.77 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000215788TNFRSF25TNF receptor superfamily member 25 0.5581.63 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000153179RASSF3Ras association domain family member 3 0.3265.71 × 10−8Metabolism/Cell Proliferation/Regulation
ENSG00000115875SRSF7serine and arginine rich splicing factor 7 0.2931.90 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000162910MRPL55mitochondrial ribosomal protein L55 0.2954.41 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000172586CHCHD1coiled-coil-helix-coiled-coil-helix domain containing 1 0.4152.99 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000136938ANP32Bacidic nuclear phosphoprotein 32 family member B 0.3091.46 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000177595PIDD1p53-induced death domain protein 1 0.3002.42 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000129473BCL2L2BCL2 like 20.2731.67 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000184207PGPphosphoglycolate phosphatase0.4095.30 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000136271DDX56DEAD-box helicase 560.2925.37 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000106404CLDN15claudin 150.4362.44 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000130734ATG4Dautophagy related 4D cysteine peptidase 0.3604.83 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000256825AC026786.1novel protein0.4661.84 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000113240CLK4CDC like kinase 40.3488.35 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000176444CLK2CDC like kinase 20.3194.36 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000114735HEMK1HemK methyltransferase family member 1 0.3139.02 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000135414GDF11growth differentiation factor 110.3062.35 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000141013GAS8growth arrest specific 80.3951.02 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000065268WDR18WD repeat domain 180.3219.31 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000071246VASH1vasohibin 10.3742.50 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000005007UPF1UPF1 RNA helicase and ATPase0.2754.60 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000126790L3HYPDHtrans-L-3-hydroxyproline dehydratase 0.3769.63 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000102871TRADDTNFRSF1A associated via death domain 0.3992.50 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000146109ABT1activator of basal transcription 10.2631.99 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000264343NOTCH2NLAnotch 2 N-terminal like A0.5401.22 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000258674AC011448.1novel protein0.4323.06 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000149451ADAM33ADAM metallopeptidase domain 330.3825.58 × 10−20Metabolism/Cell Proliferation/Regulation
ENSG00000215041NEURL4neuralized E3 ubiquitin protein ligase 4 0.3081.02 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000150401DCUN1D2defective in cullin neddylation 1 domain containing 20.2821.23 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000251287ALG1L2ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase like 20.3566.01 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000073169SELENOOselenoprotein O 0.3641.01 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000234616JRKJrk helix-turn-helix protein0.3743.11 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000105559PLEKHA4pleckstrin homology domain containing A4 0.4425.49 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000007392LUC7LLUC7 like0.3228.83 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000131584ACAP3ArfGAP with coiled-coil, ankyrin repeat and PH domains 30.3343.35 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000175137SH3BP5LSH3 binding domain protein 5 like0.4225.89 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000159692CTBP1C-terminal binding protein 10.3422.13 × 10−13Metabolism/Cell Proliferation/Regulation
ENSG00000173706HEG1heart development protein with EGF like domains 1 −0.2775.78 × 10−14Metablism/proliferation/regulation
ENSG00000155008APOOLapolipoprotein O like−0.2673.99 × 10−3Metablism/proliferation/regulation
ENSG00000178385PLEKHM3pleckstrin homology domain containing M3 −0.2641.23 × 10−3Metablism/proliferation/regulation
ENSG0000017207EIF2AK3eukaryotic translation initiation factor 2 alpha kinase 3 −0.3072.27 × 10−5Metablism/proliferation/regulation
ENSG00000106392 C1GALT1core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1−0.2681.02 × 10−2Metablism/proliferation/regulation
ENSG00000165195PIGAphosphatidylinositol glycan anchor biosynthesis class A −0.7261.08 × 10−5Metablism/proliferation/regulation
ENSG00000155090KLF10Kruppel like factor 10−1.1361.11 × 10−43Metablism/proliferation/regulation
ENSG00000144655CSRNP1cysteine and serine rich nuclear protein 1 −1.2254.13 × 10−35Metablism/proliferation/regulation
ENSG00000255112CHMP1Bcharged multivesicular body protein 1B −0.5261.54 × 10−16Metablism/proliferation/regulation
ENSG00000179241LDLRAD3low density lipoprotein receptor class A domain containing 3 −0.2721.15 × 10−2Metablism/proliferation/regulation
ENSG00000108582CPDcarboxypeptidase D −0.3081.62 × 10−15Metablism/proliferation/regulation
ENSG00000176641RNF152ring finger protein 152−0.3267.13 × 10−5Metablism/proliferation/regulation
ENSG00000136542GALNT5polypeptide N-acetylgalactosaminyltransferase 5 −0.2647.28 × 10−10Metablism/proliferation/regulation
ENSG00000203814HIST2H2BFhistone cluster 2 H2B family member f −0.3323.21 × 10−4Metablism/proliferation/regulation
ENSG00000162924RELREL proto-oncogene, NF-kB subunit −0.5915.43 × 10−11Metablism/proliferation/regulation
ENSG00000160888IER2immediate early response 2 −1.1376.07 × 10−73Metablism/proliferation/regulation
ENSG00000087074PPP1R15Aprotein phosphatase 1 regulatory subunit 15A −0.5981.91 × 10−38Metablism/proliferation/regulation
ENSG00000136158SPRY2sprouty RTK signaling antagonist 2 −0.3568.30 × 10−5Metablism/proliferation/regulation
ENSG00000137075RNF38ring finger protein 38−0.2663.06 × 10−3Metablism/proliferation/regulation
ENSG00000166340TPP1tripeptidyl peptidase 1−0.3411.59 × 10−9Metablism/proliferation/regulation
ENSG00000130164LDLRlow density lipoprotein receptor−0.2829.25 × 10−6Metablism/proliferation/regulation
ENSG00000112245PTP4A1protein tyrosine phosphatase 4A1−0.3031.01 × 10−6Metablism/proliferation/regulation
ENSG00000119138KLF9Kruppel like factor 9−0.4097.12 × 10−12Metablism/proliferation/regulation
ENSG00000134107BHLHE40basic helix-loop-helix family member e40 −0.5977.53 × 10−11Metablism/proliferation/regulation
ENSG00000115520COQ10Bcoenzyme Q10B−0.4142.48 × 10−7Metablism/proliferation/regulation
ENSG00000049323LTBP1latent transforming growth factor beta binding protein 1 −0.3081.58 × 10−15Metablism/proliferation/regulation
ENSG00000138166DUSP5dual specificity phosphatase 5−0.7386.55 × 10−23Metablism/proliferation/regulation
ENSG00000130513GDF15growth differentiation factor 15−0.9151.32 × 10−35Metablism/proliferation/regulation
ENSG00000119986AVPI1arginine vasopressin induced 1−0.7341.12 × 10−21Metablism/proliferation/regulation
ENSG00000157168NRG1neuregulin 1−0.2952.04 × 10−7Metablism/proliferation/regulation
ENSG00000166225FRS2fibroblast growth factor receptor substrate 2 −0.2927.11 × 10−5Metablism/proliferation/regulation
ENSG00000197081IGF2Rinsulin like growth factor 2 receptor−0.2643.17 × 10−11Metablism/proliferation/regulation
ENSG00000136527TRA2Btransformer 2 beta homolog −0.4212.33 × 10−14Metablism/proliferation/regulation
ENSG00000283782AC116366.3novel protein−0.4355.49 × 10−3Metablism/proliferation/regulation
ENSG00000164220F2RL2coagulation factor II thrombin receptor like 2 −0.3031.82 × 10−10Metablism/proliferation/regulation
ENSG00000185483ROR1receptor tyrosine kinase like orphan receptor 1 −0.2722.88 × 10−5Metablism/proliferation/regulation
ENSG00000080200CRYBG3crystallin beta-gamma domain containing 3 −0.4683.60 × 10−16Metablism/proliferation/regulation
ENSG00000162433AK4adenylate kinase 4−0.2661.58 × 10−2Metablism/proliferation/regulation
ENSG00000178607ERN1endoplasmic reticulum to nucleus signaling 1 −0.3344.90 × 10−6Metablism/proliferation/regulation
ENSG00000004799PDK4pyruvate dehydrogenase kinase 4 −1.2129.25 × 10−10Metablism/proliferation/regulation
ENSG00000155816FMN2formin 2−0.2753.38 × 10−6Metablism/proliferation/regulation
ENSG00000132475H3F3BH3 histone family member 3B−0.4006.12 × 10−11Metablism/proliferation/regulation
ENSG00000184260HIST2H2AChistone cluster 2 H2A family member c −0.3626.93 × 10−3Metablism/proliferation/regulation
ENSG00000272196HIST2H2AA4histone cluster 2 H2A family member a4 −0.7544.41 × 10−2Metablism/proliferation/regulation
ENSG00000105835NAMPTnicotinamide phosphoribosyltransferase −0.7001.23 × 10−34Metablism/proliferation/regulation
ENSG00000143384MCL1MCL1 apoptosis regulator, BCL2 family member −0.4361.54 × 10−22Metablism/proliferation/regulation
ENSG00000067082KLF6Kruppel like factor 6−0.6452.26 × 10−44Metablism/proliferation/regulation
ENSG00000177606JUNJun proto-oncogene, AP-1 transcription factor subunit−1.1142.64 × 10−153Metablism/proliferation/regulation
ENSG00000153936HS2ST1heparan sulfate 2-O-sulfotransferase 1 −0.2644.02 × 10−4Metablism/proliferation/regulation
ENSG00000168621GDNFglial cell derived neurotrophic factor −0.5183.74 × 10−7Metablism/proliferation/regulation
ENSG00000175592FOSL1FOS like 1, AP-1 transcription factor subunit −0.5682.02 × 10−19Metablism/proliferation/regulation
ENSG00000108306FBXL20F-box and leucine rich repeat protein 20 −0.2646.71 × 10−5Metablism/proliferation/regulation
ENSG00000174010KLHL15kelch like family member 15−0.3398.75 × 10−3Metablism/proliferation/regulation
ENSG00000118263KLF7Kruppel like factor 7−0.4152.68 × 10−11Metablism/proliferation/regulation
ENSG00000144959NCEH1neutral cholesterol ester hydrolase 1−0.4011.07 × 10−5Metablism/proliferation/regulation
ENSG00000167470MIDNmidnolin−0.4731.19 × 10−15Metablism/proliferation/regulation
ENSG00000069667RORARAR related orphan receptor A −0.2921.71 × 10−3Metablism/proliferation/regulation
ENSG00000075213SEMA3Asemaphorin 3A−0.3212.38 × 10−5Metablism/proliferation/regulation
ENSG00000176542USF3upstream transcription factor family member 3 −0.3592.91 × 10−7Metablism/proliferation/regulation
ENSG00000100354TNRC6Btrinucleotide repeat containing adaptor 6B −0.2653.40 × 10−10Metablism/proliferation/regulation
ENSG00000185650ZFP36L1ZFP36 ring finger protein like 1−0.3773.07 × 10−20Metablism/proliferation/regulation
ENSG00000122641INHBAinhibin subunit beta A−0.3019.16 × 10−5Metablism/proliferation/regulation
ENSG00000092969TGFB2transforming growth factor beta 2 −0.3097.30 × 10−3Metablism/proliferation/regulation
ENSG00000165997ARL5BADP ribosylation factor like GTPase 5B −0.8282.28 × 10−25Metablism/proliferation/regulation
ENSG00000221869CEBPDCCAAT enhancer binding protein delta −0.3261.21 × 10−4Metablism/proliferation/regulation
ENSG00000136731UGGT1UDP-glucose glycoprotein glucosyltransferase 1 −0.3661.03 × 10−17Metablism/proliferation/regulation
ENSG00000148737TCF7L2transcription factor 7 like 2 −0.3392.90 × 10−6Metablism/proliferation/regulation
ENSG00000152377SPOCK1SPARC (osteonectin), cwcv and kazal like domains proteoglycan 1−0.3237.57 × 10−14Metablism/proliferation/regulation
ENSG00000124813RUNX2RUNX family transcription factor 2 −0.3131.99 × 10−8Metablism/proliferation/regulation
ENSG00000143190POU2F1POU class 2 homeobox 1−0.3311.05 × 10−4Metablism/proliferation/regulation
ENSG00000184384MAML2mastermind like transcriptional coactivator 2 −0.3143.02 × 10−12Metablism/proliferation/regulation
ENSG00000128342LIFLIF interleukin 6 family cytokine−0.7632.73 × 10−10Metablism/proliferation/regulation
ENSG00000120616EPC1enhancer of polycomb homolog 1−0.3219.31 × 10−6Metablism/proliferation/regulation
ENSG00000175197DDIT3DNA damage inducible transcript 3−0.4276.45 × 10−6Metablism/proliferation/regulation
ENSG00000171681ATF7IPactivating transcription factor 7 interacting protein −0.2779.25 × 10−10Metablism/proliferation/regulation
ENSG00000162772ATF3activating transcription factor 3−2.8773.76 × 10−175Metablism/proliferation/regulation
ENSG00000003989SLC7A2solute carrier family 7 member2−0.3594.70 × 10−2Metablism/proliferation/regulation
ENSG00000131389SLC6A6solute carrier family 6 member6−0.2692.71 × 10−7Metablism/proliferation/regulation
ENSG00000059804SLC2A3solute carrier family 2 member3−1.0006.82 × 10−60Metablism/proliferation/regulation
ENSG00000155850SLC26A2solute carrier family 26 member2−0.2661.54 × 10−4Metablism/proliferation/regulation
ENSG00000118596SLC16A7solute carrier family 16 member7−0.3891.14 × 10−8Metablism/proliferation/regulation
ENSG00000163660CCNL1cyclin L1−1.0274.70 × 10−78Metablism/proliferation/regulation
ENSG00000182263FIGNfidgetin, microtubule severing factor−0.3602.43 × 10−3Metablism/proliferation/regulation
ENSG00000137331IER3immediate early response 3−0.8841.62 × 10−10Metablism/proliferation/regulation
ENSG00000143878RHOBras homolog family member B−1.0482.20 × 10−87Metablism/proliferation/regulation
ENSG00000123975CKS2CDC28 protein kinase regulatory subunit 2 −0.4481.76 × 10−7Metablism/proliferation/regulation
ENSG00000102781KATNAL1katanin catalytic subunit A1 like 1 −0.2743.80 × 10−5Metablism/proliferation/regulation
ENSG00000185621LMLNleishmanolysin like peptidase −0.2934.91 × 10−3Metablism/proliferation/regulation
ENSG00000204131NHSL2NHS like 2−0.2921.07 × 10−6Metablism/proliferation/regulation
ENSG00000134954ETS1ETS proto-oncogene 1, transcription factor −0.2988.39 × 10−7Metablism/proliferation/regulation
ENSG00000105810CDK6cyclin dependent kinase 6−0.3062.07 × 10−8Metablism/proliferation/regulation
ENSG00000204524ZNF805zinc finger protein 805−0.3104.10 × 10−4Metablism/proliferation/regulation
ENSG00000197483ZNF628zinc finger protein 628−0.4391.94 × 10−2Metablism/proliferation/regulation
ENSG00000197714ZNF460zinc finger protein 460−0.3053.43 × 10−7Metablism/proliferation/regulation
ENSG00000130844ZNF331zinc finger protein 331 −0.2775.71 × 10−4Metablism/proliferation/regulation
ENSG00000285253AC090517.4zinc finger protein 280D −0.4442.01 × 10−5Metablism/proliferation/regulation
ENSG00000185947ZNF267zinc finger protein 267−0.2843.90 × 10−2Metablism/proliferation/regulation
ENSG00000091656ZFHX4zinc finger homeobox 4−0.3131.06 × 10−9Metablism/proliferation/regulation
ENSG00000180776ZDHHC20zinc finger DHHC-type containing 20 −0.2875.38 × 10−7Metablism/proliferation/regulation
ENSG00000163874ZC3H12Azinc finger CCCH-type containing 12A −0.2743.54 × 10−3Metablism/proliferation/regulation
ENSG00000173276ZBTB21zinc finger and BTB domain containing 21 −0.2881.05 × 10−5Metablism/proliferation/regulation
ENSG00000030419IKZF2IKAROS family zinc finger 2−0.4124.37 × 10−4Metablism/proliferation/regulation
ENSG00000164122ASB5ankyrin repeat and SOCS box containing 5 −0.2696.59 × 10−3Metablism/proliferation/regulation
ENSG00000113448PDE4Dphosphodiesterase 4D −0.3741.92 × 10−3Metablism/proliferation/regulation
ENSG00000184588PDE4Bphosphodiesterase 4B−0.4742.45 × 10−7Metablism/proliferation/regulation
ENSG00000142892PIGKphosphatidylinositol glycan anchor biosynthesis class K−0.2649.96 × 10−4Metablism/proliferation/regulation
ENSG00000118523CCN2cellular communication network factor 2 −0.3133.41 × 10−11Metablism/proliferation/regulation
ENSG00000112419PHACTR2phosphatase and actin regulator 2−0.2811.95 × 10−6Metablism/proliferation/regulation
ENSG00000179094PER1period circadian regulator 1−0.4431.38 × 10−11Metablism/proliferation/regulation
ENSG00000106460TMEM106Btransmembrane protein 106B −0.3118.77 × 10−8Metablism/proliferation/regulation
ENSG00000182752PAPPApappalysin 1 −0.3541.08 × 10−26Metablism/proliferation/regulation
ENSG00000139496NUP58nucleoporin 58 −0.3282.66 × 10−7Metablism/proliferation/regulation
ENSG00000119508NR4A3nuclear receptor subfamily 4 group A member 3 −3.2569.06 × 10−169Metablism/proliferation/regulation
ENSG00000153234NR4A2nuclear receptor subfamily 4 group A member 2 −3.9411.48 × 10−78Metablism/proliferation/regulation
ENSG00000123358NR4A1nuclear receptor subfamily 4 group A member 1 −3.8344.26 × 10−130Metablism/proliferation/regulation
ENSG00000165030NFIL3nuclear factor, interleukin 3 regulated −0.6059.27 × 10−18Metablism/proliferation/regulation
ENSG00000102908NFAT5nuclear factor of activated T cells 5−0.3121.58 × 10−15Metablism/proliferation/regulation
ENSG00000162599NFIAnuclear factor I A−0.3121.38 × 10−4Metablism/proliferation/regulation
ENSG00000141458NPC1NPC intracellular cholesterol transporter 1 −0.6496.52 × 10−53Metablism/proliferation/regulation
ENSG00000284057AP001273.2novel protein, C11orf54-MED17 readthrough−0.3562.99 × 10−2Metablism/proliferation/regulation
ENSG00000138336TET1tet methylcytosine dioxygenase 1 −0.3483.53 × 10−5Metablism/proliferation/regulation
ENSG00000163960UBXN7UBX domain protein 7−0.2651.61 × 10−8Metablism/proliferation/regulation
ENSG00000172059KLF11Kruppel like factor 11 −0.4378.40 × 10−8Metablism/proliferation/regulation
ENSG00000196233LCORligand dependent nuclear receptor corepressor −0.3822.07 × 10−11Metablism/proliferation/regulation
ENSG00000004776HSPB6heat shock protein family B (small) member 6 −0.2861.62 × 10−3Metablism/proliferation/regulation
ENSG00000177570SAMD12sterile alpha motif domain containing 12 −0.3347.44 × 10−6Metablism/proliferation/regulation
ENSG00000197620CXorf40Achromosome X open reading frame 40A −0.3208.98 × 10−3Metablism/proliferation/regulation
ENSG00000198142SOWAHCsosondowah ankyrin repeat domain family member C−0.4276.40 × 10−7Metablism/proliferation/regulation
ENSG00000154175ABI3BPABI family member 3 binding protein −0.3528.25 × 10−6Metablism/proliferation/regulation
ENSG00000280987MATR3matrin 3−0.3234.21 × 10−5Metablism/proliferation/regulation
ENSG00000164296TIGD6tigger transposable element derived 6 −0.2722.37 × 10−2Metablism/proliferation/regulation
ENSG00000205189ZBTB10zinc finger and BTB domain containing 10 −0.2666.94 × 10−3Metablism/proliferation/regulation
ENSG00000151967SCHIP1schwannomin interacting protein 1−0.6283.95 × 10−3Metablism/proliferation/regulation
ENSG00000130962PRRG1proline rich and Gla domain 1−0.3071.52 × 10−5Metablism/proliferation/regulation
ENSG00000169908TM4SF1transmembrane 4 L six family member 1 −0.9457.67 × 10−5Metablism/proliferation/regulation
ENSG00000236383CCDC200coiled-coil domain containing 200 −0.4111.06 × 10−16Metablism/proliferation/regulation
ENSG00000219481NBPF1NBPF member 1 −0.8504.05 × 10−8Metablism/proliferation/regulation
ENSG00000041982TNCtenascin C−0.4661.86 × 10−26Metablism/proliferation/regulation
ENSG00000130702LAMA5laminin subunit alpha 5 −0.2856.65 × 10−5Metablism/proliferation/regulation
ENSG00000150907FOXO1forkhead box O1 −0.2832.58 × 10−3Metablism/proliferation/regulation
ENSG00000135842NIBAN1niban apoptosis regulator 1 −0.3102.05 × 10−7Metablism/proliferation/regulation
ENSG00000181827RFX7regulatory factor X7−0.2642.26 × 10−7Metablism/proliferation/regulation
ENSG00000156030ELMSAN1ELM2 and Myb/SANT domain containing 1 −0.2956.51 × 10−8Metablism/proliferation/regulation
ENSG00000167244IGF2insulin like growth factor 2−0.4096.22 × 10−3Metablism/proliferation/regulation
ENSG00000152409JMYjunction mediating and regulatory protein, p53 cofactor−0.2654.94 × 10−6Metablism/proliferation/regulation
ENSG00000059728MXD1MAX dimerization protein 1−0.3921.74 × 10−3Metablism/proliferation/regulation
ENSG00000170653ATF7activating transcription factor 7−0.3401.15 × 10−8Metablism/proliferation/regulation
ENSG00000118922KLF12Kruppel like factor 12−0.2723.37 × 10−4Metablism/proliferation/regulation
ENSG00000158711ELK4ETS transcription factor ELK4−0.2661.36 × 10−4Metablism/proliferation/regulation
ENSG00000095951HIVEP1human immunodeficiency virus type I enhancer binding protein 1−0.3051.59 × 10−6Metablism/proliferation/regulation
ENSG00000119314PTBP3polypyrimidine tract binding protein 3 −0.3091.49 × 10−7Metablism/proliferation/regulation
ENSG00000173889PHC3polyhomeotic homolog 3−0.2653.70 × 10−10Metablism/proliferation/regulation
ENSG00000099250NRP1neuropilin 1 −0.3021.84 × 10−12Metablism/proliferation/regulation
ENSG00000091409ITGA6integrin subunit alpha 6−0.2774.73 × 10−4Metablism/proliferation/regulation
ENSG00000148841ITPRIPinositol 1,4,5-trisphosphate receptor interacting protein −0.9611.51 × 10−44Metablism/proliferation/regulation
ENSG00000118503TNFAIP3TNF alpha induced protein 3−0.6583.99 × 10−25Metablism/proliferation/regulation
ENSG00000277075HIST1H2AEhistone cluster 1 H2A family member e −0.4032.84 × 10−4Metablism/proliferation/regulation
ENSG00000173611SCAIsuppressor of cancer cell invasion−0.2813.22 × 10−3Metablism/proliferation/regulation
ENSG00000197594ENPP1ectonucleotide pyrophosphatase/phosphodiesterase 1 −0.2931.62 × 10−4Metablism/proliferation/regulation
ENSG00000213064SFT2D2SFT2 domain containing 2 −0.3633.39 × 10−11Metablism/proliferation/regulation
ENSG00000184897H1FXH1 histone family member X−0.3071.90 × 10−4Metablism/proliferation/regulation
ENSG00000168298HIST1H1Ehistone cluster 1 H1 family member e −0.3142.88 × 10−3Metablism/proliferation/regulation
ENSG00000163125RPRD2regulation of nuclear pre-mRNA domain containing 2−0.2651.20 × 10−6Metablism/proliferation/regulation
ENSG00000148773MKI67marker of proliferation Ki-67−0.3396.61 × 10−3Metablism/proliferation/regulation
ENSG00000164307ERAP1endoplasmic reticulum aminopeptidase 1 −0.2809.38 × 10−7Metablism/proliferation/regulation
ENSG00000076770MBNL3muscleblind like splicing regulator 3 −0.2691.35 × 10−2Metablism/proliferation/regulation
ENSG00000139636LMBR1Llimb development membrane protein 1 like 0.3493.97 × 10−5Immune response
ENSG00000107281NPDC1neural proliferation, differentiation and control 1 0.2793.67 × 10−4Immune response
ENSG00000121716PILRBpaired immunoglobin like type 2 receptor beta 0.5123.18 × 10−3Immune response
ENSG00000160360GPSM1G protein signaling modulator 10.3161.77 × 10−9Immune response
ENSG00000104522TSTA3tissue specific transplantation antigen P35B 0.2891.26 × 10−2Immune response
ENSG00000214279SCART1scavenger receptor family member expressed on T cells 10.5881.35 × 10−7Immune response
ENSG00000169228RAB24RAB24, member RAS oncogene family 0.2863.64 × 10−3Immune response
ENSG0000010877DHX58DExH-box helicase 580.3611.47 × 10−3Immune response
ENSG00000160072ATAD3BATPase family AAA domain containing 3B 0.2764.14 × 10−3Immune response
ENSG00000112715VEGFAvascular endothelial growth factor A0.2633.33 × 10−4Immune response
ENSG00000110719TCIRG1T cell immune regulator 1, ATPase H+ transporting V0 subunit a30.2782.19 × 10−6Immune response
ENSG00000204104TRAF3IP1TRAF3 interacting protein 1 0.3132.78 × 10−4Immune response
ENSG00000173531MST1macrophage stimulating 10.5752.35 × 10−7Immune response
ENSG00000273802HIST1H2BGhistone cluster 1 H2B family member g −0.3395.97 × 10−4Immune response
ENSG00000277224HIST1H2BFhistone cluster 1 H2B family member f −0.3322.65 × 10−2Immune response
ENSG00000135870RC3H1ring finger and CCCH-type domains 1 −0.2704.05 × 10−7Immune response
ENSG00000144802NFKBIZNFKB inhibitor zeta−1.5001.51 × 10−32Immune response
ENSG00000125730C3complement C3−0.3212.55 × 10−17Immune response
ENSG00000184678HIST2H2BEhistone cluster 2 H2B family member e −0.6151.72 × 10−20Immune response
ENSG00000164949GEMGTP binding protein overexpressed in skeletal muscle −1.0682.18 × 10−56Immune response
ENSG00000113494PRLRprolactin receptor−0.3723.94 × 10−3Immune response
ENSG00000069702TGFBR3transforming growth factor beta receptor 3 −0.2792.29 × 10−11Immune response
ENSG00000121210TMEM131Ltransmembrane 131 like−0.2811.44 × 10−2Immune response
ENSG00000120738EGR1early growth response 1−2.1950.00Immune response
ENSG00000181722ZBTB20zinc finger and BTB domain containing 20 −0.5114.80 × 10−22Immune response
ENSG00000067992PDK3pyruvate dehydrogenase kinase 3−0.2942.41 × 10−3Immune response
ENSG00000157764BRAFB-Raf proto-oncogene, serine/threonine kinase −0.2771.91 × 10−5Immune response
ENSG00000249437NAIPNLR family apoptosis inhibitory protein −0.3187.20 × 10−3Immune response
ENSG00000131016AKAP12A-kinase anchoring protein 12−0.4941.87 × 10−20Immune response
ENSG00000106089STX1Asyntaxin 1A0.4382.44 × 10−2inflammatory response
ENSG00000185338SOCS1suppressor of cytokine signaling 10.3516.41 × 10−4inflammatory response
ENSG00000136244IL6interleukin 6 −2.3014.19 × 10−65inflammatory response
ENSG00000172292CERS6ceramide synthase 6−0.2865.45 × 10−5inflammatory response
ENSG00000170345FOSFos proto-oncogene, AP-1 transcription factor subunit−2.5301.24 × 10−62inflammatory response
ENSG00000101966XIAPX-linked inhibitor of apoptosis−0.2763.96 × 10−6inflammatory response
ENSG00000169429CXCL8C-X-C motif chemokine ligand 8−0.5723.49 × 10−4inflammatory response
ENSG00000081041CXCL2C-X-C motif chemokine ligand 2 −1.2123.32 × 10−29inflammatory response
ENSG00000128016ZFP36ZFP36 ring finger protein−1.5151.97 × 10−82inflammatory response
ENSG00000179954SSC5Dscavenger receptor cysteine rich family member with 5 domains −0.3073.19 × 10−7inflammatory response
ENSG00000100906NFKBIANFKB inhibitor alpha −0.4063.02 × 10−14inflammatory response
ENSG00000034152MAP2K3mitogen-activated protein kinase kinase 3 −0.4023.85 × 10−12inflammatory response
ENSG00000172817CYP7B1cytochrome P450 family 7 subfamily B member 1 −0.3777.82 × 10−3inflammatory response
ENSG00000173992CCScopper chaperone for superoxide dismutase 0.2835.84 × 10−3Response to oxidative stress
ENSG00000002016RAD52RAD52 homolog, DNA repair protein 0.2971.52 × 10−2Response to oxidative stress
ENSG00000172780RAB43RAB43, member RAS oncogene family 0.3115.51 × 10−3Response to oxidative stress
ENSG00000103245CIAO3cytosolic iron-sulfur assembly component 3 0.3242.22 × 10−2Response to oxidative stress
ENSG00000163516ANKZF1ankyrin repeat and zinc finger peptidyl tRNA hydrolase 1 0.2921.87 × 10−4Response to oxidative stress
ENSG00000140398NEIL1nei like DNA glycosylase 10.4594.10 × 10−5Response to oxidative stress
ENSG00000159363ATP13A2ATPase cation transporting 13A20.2843.52 × 10−2Response to oxidative stress
ENSG00000151012SLC7A11solute carrier family 7 member11−0.3272.98 × 10−4Response to oxidative stress
ENSG00000172115CYCScytochrome c, somatic −0.3233.86 × 10−4Response to oxidative stress
ENSG00000146648EGFRepidermal growth factor receptor −0.3033.91 × 10−19Response to oxidative stress
ENSG00000198840MT-ND3mitochondrially encoded NADH: ubiquinone oxidoreductase core subunit 3 −0.4776.34 × 10−14Response to oxidative stress
ENSG00000158615PPP1R15Bprotein phosphatase 1 regulatory subunit 15B −0.6311.15 × 10−36Response to oxidative stress
ENSG00000109819PPARGC1APPARG coactivator 1 alpha−0.2851.53 × 10−2Response to oxidative stress
ENSG00000137449CPEB2cytoplasmic polyadenylation element binding protein 2−0.3139.29 × 10−6Response to oxidative stress
ENSG00000198763MT-ND2mitochondrially encoded NADH: ubiquinone oxidoreductase core subunit 2 −0.4633.74 × 10−18Response to oxidative stress
ENSG00000198786MT-ND5mitochondrially encoded NADH: ubiquinone oxidoreductase core subunit 5−0.4933.60 × 10−4Response to oxidative stress
ENSG00000198886MT-ND4mitochondrially encoded NADH: ubiquinone oxidoreductase core subunit 4 −0.5564.78 × 10−4Response to oxidative stress
ENSG00000198888MT-ND1mitochondrially encoded NADH: ubiquinone oxidoreductase core subunit 1−0.5111.15 × 10−5Response to oxidative stress
ENSG00000212907MT-ND4Lmitochondrially encoded NADH: ubiquinone oxidoreductase core subunit 4L −0.4672.65 × 10−3Response to oxidative stress
ENSG00000132510KDM6Blysine demethylase 6B −0.5431.21 × 10−18Response to oxidative stress
ENSG00000198712MT-CO2mitochondrially encoded cytochrome c oxidase II −0.3972.79 × 10−3Response to oxidative stress
ENSG00000143322ABL2ABL proto-oncogene 2, non-receptor tyrosine kinase −0.3599.88 × 10−14Response to oxidative stress
ENSG00000127528KLF2Kruppel like factor 2−1.2214.51 × 10−14Response to oxidative stress
ENSG00000286268AF196969.1novel protein0.7129.99 × 10−3Lipids
ENSG00000100288CHKBcholine kinase beta0.3596.43 × 10−5Lipids
ENSG00000132793LPIN3lipin 30.3422.57 × 10−8Lipids
ENSG00000243708PLA2G4Bphospholipase A2 group IVB0.5651.56 × 10−2Lipids
ENSG00000240303ACAD11acyl-CoA dehydrogenase family member 11 0.2849.86 × 10−3Lipids
ENSG00000072778ACADVLacyl-CoA dehydrogenase very long chain 0.2687.46 × 10−10Lipids
ENSG00000197943PLCG2phospholipase C gamma 2 0.3105.49 × 10−3Lipids
ENSG00000102125TAZtafazzin0.4085.69 × 10−4Lipids
ENSG00000111664GNB3G protein subunit beta 30.5063.20 × 10−2Lipids
ENSG00000123689G0S2G0/G1 switch 2−0.4704.89 × 10−2Lipids
ENSG00000073756PTGS2prostaglandin-endoperoxide synthase 2 −2.2201.77 × 10−13Lipids
ENSG00000151176PLBD2phospholipase B domain containing 2 −0.4462.90 × 10−18Lipids
ENSG00000137642SORL1sortilin related receptor 1 −0.4073.23 × 10−2Lipids
ENSG00000172954LCLAT1lysocardiolipin acyltransferase 1−0.3199.16 × 10−5Lipids
ENSG00000171132PRKCEprotein kinase C epsilon −0.2674.13 × 10−4Lipids
ENSG00000165029ABCA1ATP binding cassette subfamily A member 1 −0.2991.82 × 10−13Lipids
ENSG00000117600PLPPR4phospholipid phosphatase related 4−0.3111.43 × 10−3Lipids
ENSG00000147872PLIN2perilipin 2 −0.3408.19 × 10−15Lipids
ENSG00000140474ULK3unc-51 like kinase 30.3024.43 × 10−3Communication
ENSG00000204084INPP5Binositol polyphosphate-5-phosphatase B 0.2953.88 × 10−5Communication
ENSG00000170153RNF150ring finger protein 150 −0.3404.94 × 10−9Communication
ENSG00000198753PLXNB3plexin B3 −0.3721.56 × 10−3Communication
ENSG00000184226PCDH9protocadherin 9 −0.4392.47 × 10−4Communication
ENSG00000253537PCDHGA7protocadherin gamma subfamily A, 7 −0.2644.29 × 10−3Communication
ENSG00000253873PCDHGA11protocadherin gamma subfamily A, 11 −0.3029.94 × 10−4Communication
ENSG00000189152GRAPLGRB2 related adaptor protein like−0.2701.68 × 10−5Communication
ENSG00000187678SPRY4sprouty RTK signaling antagonist 4−0.3101.38 × 10−4Communication
ENSG00000075568TMEM131transmembrane protein 131−0.2681.03 × 10−8Communication
ENSG00000013588GPRC5AG protein-coupled receptor class C group 5 member A −0.4221.06 × 10−10Communication
ENSG00000113441LNPEPleucyl and cystinyl aminopeptidase −0.3361.61 × 10−9Communication
ENSG00000158258CLSTN2calsyntenin 2 −0.3889.23 × 10−10Communication
ENSG00000091129NRCAMneuronal cell adhesion molecule−0.3461.21 × 10−3Communication
ENSG00000083857FAT1FAT atypical cadherin 1−0.3874.48 × 10−33Communication
ENSG00000070018LRP6LDL receptor related protein 6 −0.2841.70 × 10−8Communication
ENSG00000253953PCDHGB4protocadherin gamma subfamily B, 4 −0.2695.57 × 10−4Communication
ENSG00000134982APCAPC regulator of WNT signaling pathway −0.2822.50 × 10−7Communication
ENSG00000112902SEMA5Asemaphorin 5A−0.3411.31 × 10−25Communication
ENSG00000218336TENM3teneurin transmembrane protein 3 −0.3049.06 × 10−4Communication
ENSG00000165124SVEP1sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1−0.4817.92 × 10−36Communication
ENSG00000123096SSPNsarcospan−0.3151.10 × 10−4Communication
ENSG00000145012LPPLIM domain containing preferred translocation partner in lipoma−0.3192.31 × 10−15Communication
ENSG00000067141NEO1neogenin 1−0.2722.21 × 10−7Communication
ENSG00000196159FAT4FAT atypical cadherin 4 −0.3182.88 × 10−12Communication
ENSG00000143341HMCN1hemicentin 1−0.4212.95 × 10−4Communication
ENSG00000078401EDN1endothelin 1−0.4293.86 × 10−3Response to stimulus
ENSG00000135999EPC2enhancer of polycomb homolog 2−0.2847.13 × 10−4Response to stimulus
ENSG00000283321AC019117.3novel protein−0.3375.32 × 10−3Response to stimulus
ENSG00000110395CBLCbl proto-oncogene −0.3032.57 × 10−8Response to stimulus
ENSG00000114933INO80DINO80 complex subunit D−0.3036.43 × 10−7Response to stimulus
ENSG00000130522JUNDJunD proto-oncogene, AP-1 transcription factor subunit−0.6815.90 × 10−30Response to stimulus
ENSG00000120129DUSP1dual specificity phosphatase 1−2.1231.05 × 10−267Response to stimulus
ENSG00000148339SLC25A25solute carrier family 25 member25−0.3036.18 × 10−4Response to stimulus
ENSG00000125740FOSBFosB proto-oncogene, AP-1 transcription factor subunit−4.0900.00Response to stimulus
ENSG00000198727MT-CYBmitochondrially encoded cytochrome b −0.3203.34 × 10−8Response to stimulus
ENSG00000177694NAALADL2N-acetylated alpha-linked acidic dipeptidase like 2 −0.3201.80 × 10−4Response to stimulus
ENSG00000184557SOCS3suppressor of cytokine signaling 3−0.5066.46 × 10−7Response to stimulus
ENSG00000159167STC1stanniocalcin 1 −0.5341.49 × 10−4Response to stimulus
ENSG00000164603BMT2base methyltransferase of 25S rRNA 2 homolog −0.3231.14 × 10−2Response to stimulus
ENSG00000181072CHRM2cholinergic receptor muscarinic 2−0.2732.59 × 10−3Response to stimulus
ENSG00000132635PCED1APC-esterase domain containing 1A0.2801.88 × 10−3Unknown
ENSG00000186166CCDC84coiled-coil domain containing 840.2827.88 × 10−7Unknown
ENSG00000117616RSRP1arginine and serine rich protein 10.3471.04 × 10−9Unknown
ENSG00000214193SH3D21SH3 domain containing 210.2841.03 × 10−2Unknown
ENSG00000134884ARGLU1arginine and glutamate rich 10.2899.33 × 10−6Unknown
ENSG00000268350FAM156Afamily with sequence similarity 156 member A 0.4499.92 × 10−5Unknown
ENSG00000182700IGIPIgA inducing protein0.4003.33 × 10−4Unknown
ENSG00000140365COMMD4COMM domain containing 40.3191.83 × 10−4Unknown
ENSG00000146067FAM193Bfamily with sequence similarity 193 member B 0.2857.51 × 10−3Unknown
ENSG00000014914MTMR11myotubularin related protein 110.2861.90 × 10−2Unknown
ENSG00000148341SH3GLB2SH3 domain containing GRB2 like, endophilin B2 0.2781.62 × 10−4Unknown
ENSG00000188483IER5Limmediate early response 5 like0.3251.54 × 10−2Unknown
ENSG00000135637CCDC142coiled-coil domain containing 1420.4071.10 × 10−4Unknown
ENSG00000213563C8orf82chromosome 8 open reading frame 82 0.2755.43 × 10−3Unknown
ENSG00000143469SYT14synaptotagmin 14−0.2728.77 × 10−4Unknown
ENSG00000215472RPL17-C18orf32RPL17-C18orf32 readthrough−0.2986.96 × 10−3Unknown
Notes: FC, fold change. The differentially expressed genes (DEGs) between the control and UVA-induced model were screened using |log2FC| > 1.2 and P-adjust < 0.05 as the thresholds. The DEGs were functionally annotated using Blast2go (Version 2.5) and goatools (Version 0.6.5) for gene ontology (GO) annotation and clustering analysis.
Table
Table 4. Functional characterization of up/downregulated differential expressed genes in H2O2-induced model.
Table 4. Functional characterization of up/downregulated differential expressed genes in H2O2-induced model.
Gene_IdGene NameGene DescriptionLog2FCP-AdjustFunction
ENSG00000113494PRLRprolactin receptor 1.5092.51 × 10−4immune response
ENSG00000124882EREGepiregulin1.0291.75 × 10−10immune response
ENSG00000128271ADORA2Aadenosine A2a receptor1.9381.64 × 10−10immune response
ENSG00000160224AIREautoimmune regulator1.4901.30 × 10−2immune response
ENSG00000169508GPR183G protein-coupled receptor 1832.5932.80 × 10−3immune response
ENSG00000198805PNPpurine nucleoside phosphorylase 1.3971.63 × 10−4immune response
ENSG00000105088OLFM2olfactomedin 2 1.7946.44 × 10−9immune response
ENSG00000243509TNFRSF6BTNF receptor superfamily member 6b1.8753.16 × 10−5immune response
ENSG00000113070HBEGFheparin binding EGF like growth factor 1.2374.11 × 10−2immune response
ENSG00000122861PLAUplasminogen activator, urokinase 1.8725.61 × 10−35immune response
ENSG00000284337AC013271.1LIM and senescent cell antigen-like-containing domain protein 31.8356.10 × 10−4immune response
ENSG00000198535C2CD4AC2 calcium dependent domain containing 4A 2.2602.90 × 10−7immune response
ENSG00000237264 FTH1P11ferritin heavy chain 1 pseudogene 11 4.4684.70 × 10−2immune response
ENSG00000219507FTH1P8ferritin heavy chain 1 pseudogene 8 6.3171.68 × 10−2immune response
ENSG00000160223ICOSLGinducible T-cell costimulator ligand 1.2261.85 × 10−2immune response
ENSG00000211772TRBC2T-cell receptor beta constant 21.1851.65 × 10−2immune response
ENSG00000110031LPXNleupaxin2.0689.53 × 10−12immune response
ENSG00000028277POU2F2POU class 2 homeobox 2 1.4477.46 × 10−21immune response
ENSG00000076641PAG1phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1.3968.91 × 10−7immune response
ENSG00000173457PPP1R14Bprotein phosphatase 1 regulatory inhibitor subunit 14B1.4762.28 × 10−2immune response
ENSG00000131187F12coagulation factor XII1.8084.49 × 10−2immune response
ENSG00000131015ULBP2UL16 binding protein 21.1693.47 × 10−2immune response
ENSG00000069702TGFBR3transforming growth factor beta receptor 3 −1.0744.18 × 10−3Immune response
ENSG00000138735PDE5Aphosphodiesterase 5A−1.7543.76 × 10−13Immune response
ENSG00000164764SBSPONsomatomedin B and thrombospondin type 1 domain containing −1.9733.06 × 10−3Immune response
ENSG00000089127OAS12′-5′-oligoadenylate synthetase 1 −1.3994.55 × 10−4Immune response
ENSG00000066735 KIF26Akinesin family member 26A −1.7431.91 × 10−4Immune response
ENSG00000120885CLUclusterin −1.3461.07 × 10−11Immune response
ENSG00000136869TLR4toll like receptor 4−1.9897.89 × 10−6Immune response
ENSG00000164342TLR3toll like receptor 3−2.0642.85 × 10−4Immune response
ENSG00000159403C1Rcomplement C1r −1.4766.54 × 10−10Immune response
ENSG00000182326C1Scomplement C1s −1.3316.39 × 10−14Immune response
ENSG00000120899PTK2Bprotein tyrosine kinase 2 beta −2.9706.43 × 10−31Immune response
ENSG00000130303BST2bone marrow stromal cell antigen 2−1.1127.88 × 10−3Immune response
ENSG00000158270COLEC12collectin subfamily member 12−1.3822.11 × 10−7Immune response
ENSG00000244731C4Acomplement C4A (Rodgers blood group) −2.2483.26 × 10−6Immune response
ENSG00000224389C4Bcomplement C4B (Chido blood group)−1.6432.40 × 10−3Immune response
ENSG00000205403CFIcomplement factor I −1.3197.62 × 10−5Immune response
ENSG00000243649CFBcomplement factor B −2.2211.40 × 10−26Immune response
ENSG00000197766CFDcomplement factor D −1.6572.00 × 10−2Immune response
ENSG00000000971CFHcomplement factor H−1.1061.44 × 10−12Immune response
ENSG00000125730C3complement C3 −1.1903.38 × 10−4Immune response
ENSG00000185745IFIT1interferon induced protein with tetratricopeptide repeats 1 −1.3932.81 × 10−7Immune response
ENSG00000091972CD200CD200 molecule−1.6942.28 × 10−3Immune response
ENSG00000111331OAS32′-5′-oligoadenylate synthetase 3 −1.2463.53 × 10−2Immune response
ENSG00000101347SAMHD1SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1−1.0481.57 × 10−2Immune response
ENSG00000154188ANGPT1angiopoietin 1−1.6487.33 × 10−9Immune response
ENSG00000107562CXCL12C-X-C motif chemokine ligand 12 −2.7985.70 × 10−42Immune response
ENSG00000142910TINAGL1tubulointerstitial nephritis antigen like 1 −3.2177.01 × 10−25Immune response
ENSG00000106537TSPAN13tetraspanin 13 1.2283.73 × 10−2Transport
ENSG00000108932SLC16A6solute carrier family 16 member 6 1.4471.76 × 10−8Transport
ENSG00000134955SLC37A2solute carrier family 37 member 2 1.4886.86 × 10−5Transport
ENSG00000139508SLC46A3solute carrier family 46 member31.0073.41 × 10−5Transport
ENSG00000101187SLCO4A1solute carrier organic anion transporter family member 4A1 1.3541.02 × 10−7Transport
ENSG00000188643S100A16S100 calcium binding protein A16 1.0236.96 × 10−3Transport
ENSG00000157445CACNA2D3calcium voltage-gated channel auxiliary subunit alpha2delta 31.6591.37 × 10−2Transport
ENSG00000069849ATP1B3ATPase Na+/K+ transporting subunit beta 3 1.1003.43 × 10−2Transport
ENSG00000166592RRADRRAD, Ras related glycolysis inhibitor and calcium channel regulator 1.2622.60 × 10−3Transport
ENSG00000159199ATP5G1ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) 1.3294.87 × 10−2Transport
ENSG00000166510CCDC68coiled-coil domain containing 68 1.0721.66 × 10−4Transport
ENSG00000157551KCNJ15potassium voltage-gated channel subfamily J member 151.9931.26 × 10−3Transport
ENSG00000157542KCNJ6potassium voltage-gated channel subfamily J member 6 2.3913.83 × 10−5Transport
ENSG00000173114LRRN3leucine rich repeat neuronal 3 1.5157.22 × 10−8Transport
ENSG00000171246NPTX1neuronal pentraxin 12.0291.12 × 10−7Transport
ENSG00000259863SH3RF3-AS1SH3RF3 antisense RNA 12.0136.87 × 10−7Transport
ENSG00000102287GABREgamma-aminobutyric acid type A receptor epsilon subunit−1.2962.76 × 10−6Transport
ENSG00000198691ABCA4ATP binding cassette subfamily A member 4−1.7401.07 × 10−11Transport
ENSG00000221955SLC12A8solute carrier family 12 member 8 −1.4245.81 × 10−7Transport
ENSG00000162383SLC1A7solute carrier family 1 member 7 −1.5881.17 × 10−3Transport
ENSG00000146411SLC2A12solute carrier family 2 member 12 −1.8071.49 × 10−6Transport
ENSG00000169507SLC38A11solute carrier family 38 member 11 −2.2357.62 × 10−10Transport
ENSG00000139209SLC38A4solute carrier family 38 member 4 −1.6381.79 × 10−4Transport
ENSG00000138821SLC39A8solute carrier family 39 member 8 −1.0536.51 × 10−7Transport
ENSG00000138449SLC40A1solute carrier family 40 member 1 −1.4797.54 × 10−8Transport
ENSG00000013293SLC7A14solute carrier family 7 member 14 −1.8492.46 × 10−6Transport
ENSG00000181804SLC9A9solute carrier family 9 member A9 −1.0184.45 × 10−3Transport
ENSG00000168356SCN11Asodium voltage-gated channel alpha subunit 11 −1.6374.59 × 10−2Transport
ENSG00000144285SCN1Asodium voltage-gated channel alpha subunit 1 −4.9791.95 × 10−3Transport
ENSG00000151572ANO4anoctamin 4−1.3085.69 × 10−11Transport
ENSG00000145362ANK2ankyrin 2−2.0023.71 × 10−6Transport
ENSG00000111859NEDD9neural precursor cell expressed, developmentally down-regulated 9 −1.1185.58 × 10−6Transport
ENSG00000144645OSBPL10oxysterol binding protein like 10 −1.0971.63 × 10−4Transport
ENSG00000162687KCNT2potassium sodium-activated channel subfamily T member 2−2.3481.96 × 10−3Transport
ENSG00000135643KCNMB4potassium calcium-activated channel subfamily M regulatory beta subunit 4−1.2421.75 × 10−4Transport
ENSG00000143028SYPL2synaptophysin like 2−1.1972.42 × 10−5Transport
ENSG00000089472HEPHhephaestin −1.2502.79 × 10−6Transport
ENSG00000166473PKD1L2polycystin 1 like 2 (gene/pseudogene) −1.7961.07 × 10−11Transport
ENSG00000143416SELENBP1selenium binding protein 1−1.4111.75 × 10−19Transport
ENSG00000175538KCNE3potassium voltage-gated channel subfamily E regulatory subunit 3−2.4051.46 × 10−5Transport
ENSG00000055732MCOLN3mucolipin 3 −1.0271.32 × 10−3Transport
ENSG00000172548NIPAL4NIPA like domain containing 4−1.9994.27 × 10−2Transport
ENSG00000003137CYP26B1cytochrome P450 family 26 subfamily B member 11.2179.43 × 10−5Intracellular and extracellular matrix
ENSG00000058085LAMC2laminin subunit gamma 21.4841.02 × 10−4Intracellular and extracellular matrix
ENSG00000138316ADAMTS14ADAM metallopeptidase with thrombospondin type 1 motif 14 1.5013.47 × 10−5Intracellular and extracellular matrix
ENSG00000135346CGAglycoprotein hormones, alpha polypeptide3.0142.16 × 10−5Intracellular and extracellular matrix
ENSG00000163347CLDN1claudin 11.0651.97 × 10−6Intracellular and extracellular matrix
ENSG00000123500COL10A1collagen type X alpha 1 chain 1.2064.22 × 10−2Intracellular and extracellular matrix
ENSG00000197467COL13A1collagen type XIII alpha 1 chain1.2992.71 × 10−7Intracellular and extracellular matrix
ENSG00000080573COL5A3collagen type V alpha 3 chain 1.5353.48 × 10−7Intracellular and extracellular matrix
ENSG00000143127ITGA10integrin subunit alpha 10 1.5969.82 × 10−5Intracellular and extracellular matrix
ENSG00000137809ITGA11integrin subunit alpha 111.2842.46 × 10−3Intracellular and extracellular matrix
ENSG00000164171ITGA2integrin subunit alpha 21.0349.75 × 10−3Intracellular and extracellular matrix
ENSG00000005884ITGA3integrin subunit alpha 31.0653.37 × 10−6Intracellular and extracellular matrix
ENSG00000196611MMP1matrix metallopeptidase 1 2.7133.61 × 10−68Intracellular and extracellular matrix
ENSG00000166670MMP10matrix metallopeptidase 10 3.1912.09 × 10−4Intracellular and extracellular matrix
ENSG00000156103MMP16matrix metallopeptidase 16 1.2298.60 × 10−6Intracellular and extracellular matrix
ENSG00000149968MMP3matrix metallopeptidase 33.0769.37 × 10−44Intracellular and extracellular matrix
ENSG00000104368PLATplasminogen activator, tissue type 1.6921.03 × 10−32Intracellular and extracellular matrix
ENSG00000196581AJAP1adherens junctions associated protein 1 1.0328.97 × 10−5Intracellular and extracellular matrix
ENSG00000182667NTMneurotrimin 2.1602.03 × 10−25Intracellular and extracellular matrix
ENSG00000261371PECAM1platelet and endothelial cell adhesion molecule 12.9651.05 × 10−7Intracellular and extracellular matrix
ENSG00000235649MXRA5Ymatrix remodeling associated 5, Y-linked (pseudogene) −1.8493.32 × 10−2Cellular and extracellular matrix
ENSG00000124749COL21A1collagen type XXI alpha 1 chain −3.2047.20 × 10−22Cellular and extracellular matrix
ENSG00000049089COL9A2collagen type IX alpha 2 chain−1.6061.01 × 10−3Cellular and extracellular matrix
ENSG00000060718COL11A1collagen type XI alpha 1 chain−1.5771.44 × 10−4Cellular and extracellular matrix
ENSG00000187955COL14A1collagen type XIV alpha 1 chain −2.2888.17 × 10−16Cellular and extracellular matrix
ENSG00000168077SCARA3scavenger receptor class A member 3 −1.4221.51 × 10−18Cellular and extracellular matrix
ENSG00000106823ECM2extracellular matrix protein 2−2.6123.11 × 10−3Cellular and extracellular matrix
ENSG00000242600MBL1Pmannose binding lectin 1, pseudogene −1.9411.06 × 10−2Cellular and extracellular matrix
ENSG00000166482MFAP4microfibrillar associated protein 4 −1.9661.51 × 10−26Cellular and extracellular matrix
ENSG00000165272AQP3aquaporin 3 (Gill blood group)−1.7894.63 × 10−11Cellular and extracellular matrix
ENSG00000138829FBN2fibrillin 2−1.0361.55 × 10−2Cellular and extracellular matrix
ENSG00000123243ITIH5inter-alpha-trypsin inhibitor heavy chain family member 5 −1.3127.45 × 10−4Cellular and extracellular matrix
ENSG00000049540ELNelastin−1.2712.11 × 10−4Cellular and extracellular matrix
ENSG00000183798EMILIN3elastin microfibril interfacer 3−1.6268.81 × 10−4Cellular and extracellular matrix
ENSG00000091986CCDC80coiled-coil domain containing 80 −1.6069.31 × 10−7Cellular and extracellular matrix
ENSG00000135424ITGA7integrin subunit alpha 7−1.0241.29 × 10−4Cellular and extracellular matrix
ENSG00000196569LAMA2laminin subunit alpha 2 −1.8401.50 × 10−5Cellular and extracellular matrix
ENSG00000132470ITGB4integrin subunit beta 4 −1.7921.98 × 10−11Cellular and extracellular matrix
ENSG00000105855ITGB8integrin subunit beta 8−1.3901.53 × 10−6Cellular and extracellular matrix
ENSG00000205221VITvitrin −2.6754.97 × 10−3Cellular and extracellular matrix
ENSG00000122707RECKreversion inducing cysteine rich protein with kazal motifs −1.0667.99 × 10−6Cellular and extracellular matrix
ENSG00000169908TM4SF1transmembrane 4 L six family member 1 1.5094.14 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000157064NMNAT2nicotinamide nucleotide adenylyltransferase 2 1.1595.85 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000165891E2F7E2F transcription factor 7 1.2764.50 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000128965CHAC1ChaC glutathione specific gamma-glutamylcyclotransferase 11.6671.34 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000185697MYBL1MYB proto-oncogene like 1 1.3939.20 × 10−12Metabolism/Cell Proliferation/Regulation
ENSG00000168405CMAHPcytidine monophospho-N-acetylneuraminic acid hydroxylase, pseudogene 1.1201.46 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000137331IER3immediate early response 31.3904.21 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000124802EEF1E1eukaryotic translation elongation factor 1 epsilon 1 1.3252.52 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000170498KISS1KiSS-1 metastasis-suppressor2.9541.23 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000118523CTGFconnective tissue growth factor1.0106.38 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000140379BCL2A1BCL2 related protein A11.8982.86 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000169372CRADDCASP2 and RIPK1 domain containing adaptor with death domain 1.1861.22 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000160013PTGIRprostaglandin I2 (prostacyclin) receptor (IP)1.1623.31 × 10−18Metabolism/Cell Proliferation/Regulation
ENSG00000183691NOGnoggin 2.2259.39 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000124762CDKN1Acyclin dependent kinase inhibitor 1A 1.0738.29 × 10−11Metabolism/Cell Proliferation/Regulation
ENSG00000232977LINC00327long intergenic non-protein coding RNA 3271.3566.49 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000255073ZFP91-CNTFZFP91-CNTF readthrough (NMD candidate) 1.2843.17 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000179862CITED4Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2.5196.13 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000128917DLL4delta like canonical Notch ligand 4 1.3563.41 × 10−9Metabolism/Cell Proliferation/Regulation
ENSG00000205683DPF3double PHD fingers 3 1.2921.03 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000006468ETV1ETS variant 1 1.2298.84 × 10−14Metabolism/Cell Proliferation/Regulation
ENSG00000175592FOSL1FOS like 1, AP-1 transcription factor subunit 1.1455.17 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000164379FOXQ1forkhead box Q1 1.3951.63 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000134363FSTfollistatin 1.1743.03 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000177283FZD8frizzled class receptor 81.4957.35 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000114315HES1hes family bHLH transcription factor 1 2.0751.27 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000188290HES4hes family bHLH transcription factor 4 1.5631.16 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000164683HEY1hes related family bHLH transcription factor with YRPW motif 11.4615.80 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000163909HEYLhes related family bHLH transcription factor with YRPW motif-like1.6495.79 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000187837HIST1H1Chistone cluster 1 H1 family member c 1.0752.17 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000137309HMGA1high mobility group AT-hook 1 1.2992.87 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000115274INO80BINO80 complex subunit B1.3183.48 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000108551RASD1ras related dexamethasone induced 1 1.1684.82 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000196460RFX8RFX family member 8, lacking RFX DNA binding domain1.0593.06 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000147509RGS20regulator of G protein signaling 20 1.4092.83 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000095752IL11interleukin 111.5111.46 × 10−12Metabolism/Cell Proliferation/Regulation
ENSG00000133169BEX1brain expressed X-linked 11.5791.14 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000168621GDNFglial cell derived neurotrophic factor 1.0291.69 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000122641INHBAinhibin beta A subunit1.1886.30 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000254858MPV17L2MPV17 mitochondrial inner membrane protein like 2 1.0604.39 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000169994MYO7Bmyosin VIIB2.1212.99 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000239672NME1NME/NM23 nucleoside diphosphate kinase 1 1.3002.18 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000139289PHLDA1pleckstrin homology like domain family A member 11.1134.84 × 10−11Metabolism/Cell Proliferation/Regulation
ENSG00000181649PHLDA2pleckstrin homology like domain family A member 2 1.6791.79 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000176641RNF152ring finger protein 152 1.8007.61 × 10−16Metabolism/Cell Proliferation/Regulation
ENSG00000154133ROBO4roundabout guidance receptor 4 2.3822.98 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000197632SERPINB2serpin family B member 21.2633.41 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000006327TNFRSF12ATNF receptor superfamily member 12A 1.1685.04 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000130513GDF15growth differentiation factor 151.9305.16 × 10−10Metabolism/Cell Proliferation/Regulation
ENSG00000092345DAZLdeleted in azoospermia like1.5162.85 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000268439EMG1EMG1, N1-specific pseudouridine methyltransferase 1.0482.25 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000003249DBNDD1dysbindin domain containing 1 1.2671.40 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000077348EXOSC5exosome component 51.2752.99 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000162669HFM1HFM1, ATP dependent DNA helicase homolog 2.0209.62 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000156265MAP3K7CLMAP3K7 C-terminal like 1.0403.11 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000158747NBL1neuroblastoma 1, DAN family BMP antagonist 1.0651.69 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000135919SERPINE2serpin family E member 21.2457.42 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000128805ARHGAP22Rho GTPase activating protein 22 1.1873.55 × 10−11Metabolism/Cell Proliferation/Regulation
ENSG00000130702LAMA5laminin subunit alpha 5−1.3256.48 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000110455ACCS1-aminocyclopropane-1-carboxylate synthase homolog (inactive)−1.4352.85 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000138772ANXA3annexin A3−1.9228.29 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000151632AKR1C2aldo-keto reductase family 1 member C2 −1.6081.64 × 10−10Metabolism/Cell Proliferation/Regulation
ENSG00000170962PDGFDplatelet derived growth factor D−1.7901.64 × 10−43Metabolism/Cell Proliferation/Regulation
ENSG00000128606LRRC17leucine rich repeat containing 17 −1.3325.81 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000102466FGF14fibroblast growth factor 14−1.3333.65 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000109339MAPK10mitogen-activated protein kinase 10 −1.3291.44 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000108984MAP2K6mitogen-activated protein kinase kinase 6 −1.9541.33 × 10−9Metabolism/Cell Proliferation/Regulation
ENSG00000064687ABCA7ATP binding cassette subfamily A member 7−1.6031.39 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000173706HEG1heart development protein with EGF like domains 1−1.5241.95 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000174348PODNpodocan−1.8914.35 × 10−10Metabolism/Cell Proliferation/Regulation
ENSG00000003096KLHL13kelch like family member 13 −2.8554.79 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000146021KLHL3kelch like family member 3−1.0142.99 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000145819ARHGAP26Rho GTPase activating protein 26−2.1552.00 × 10−13Metabolism/Cell Proliferation/Regulation
ENSG00000139354GAS2L3growth arrest specific 2 like 3 −1.5785.53 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000198796ALPK2alpha kinase 2−1.0182.28 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000082438COBLL1cordon-bleu WH2 repeat protein like 1 −1.5761.97 × 10−8Metabolism/Cell Proliferation/Regulation
ENSG00000176971FIBINfin bud initiation factor homolog (zebrafish) −1.3829.25 × 10−10Metabolism/Cell Proliferation/Regulation
ENSG00000183098GPC6glypican 6 −1.0373.16 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000139263LRIG3leucine rich repeats and immunoglobulin like domains 3−1.0842.12 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000170500LONRF2LON peptidase N-terminal domain and ring finger 2−2.0633.13 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000163017ACTG2actin, gamma 2, smooth muscle, enteric−1.6995.71 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000111684LPCAT3lysophosphatidylcholine acyltransferase 3 −1.0211.61 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000182575NXPH3neurexophilin 3 −1.4517.04 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000243970PPIELpeptidylprolyl isomerase E like pseudogene −1.0191.09 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000113231PDE8Bphosphodiesterase 8B−1.1136.47 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000185483ROR1receptor tyrosine kinase like orphan receptor 1 −1.3446.02 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000187164SHTN1shootin 1−1.0802.96 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000177409SAMD9Lsterile alpha motif domain containing 9 like −1.0031.80 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000196562SULF2sulfatase 2−1.2182.03 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000186854TRABD2ATraB domain containing 2A−1.3869.04 × 10−9Metabolism/Cell Proliferation/Regulation
ENSG00000182179UBA7ubiquitin like modifier activating enzyme 7 −1.2347.71 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000112303VNN2vanin 2 −3.0822.31 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000115339GALNT3polypeptide N-acetylgalactosaminyltransferase 3−1.2842.38 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000167311ART5ADP-ribosyltransferase 5 −1.8263.84 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000088882CPXM1carboxypeptidase X, M14 family member 1 −1.2781.34 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000138180CEP55centrosomal protein 55 −1.2721.45 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000064886CHI3L2chitinase 3 like 2−1.3542.34 × 10−11Metabolism/Cell Proliferation/Regulation
ENSG00000115468EFHD1EF-hand domain family member D1 −1.7525.70 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000106565TMEM176Btransmembrane protein 176B−1.5594.58 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000143869GDF7growth differentiation factor 7−2.0472.63 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000139269INHBEinhibin beta E subunit −2.4667.03 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000105989WNT2Wnt family member 2−3.1332.67 × 10−32Metabolism/Cell Proliferation/Regulation
ENSG00000139304PTPRQprotein tyrosine phosphatase, receptor type Q −2.7905.05 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000128045RASL11BRAS like family 11 member B−2.5771.04 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000138615CILPcartilage intermediate layer protein −1.8543.03 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000002933TMEM176Atransmembrane protein 176A −1.6604.32 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000121858TNFSF10TNF superfamily member 10 −1.7909.42 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000171462DLK2delta like non-canonical Notch ligand 2 −1.3291.62 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000178662CSRNP3cysteine and serine rich nuclear protein 3 −2.3928.91 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000090006LTBP4latent transforming growth factor beta binding protein 4 −1.1221.82 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000100626GALNT16polypeptide N-acetylgalactosaminyltransferase 16 −1.7802.60 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000168453HRHR, lysine demethylase and nuclear receptor corepressor−2.6861.55 × 10−18Metabolism/Cell Proliferation/Regulation
ENSG00000054654SYNE2spectrin repeat containing nuclear envelope protein 2−1.4979.55 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000064692SNCAIPsynuclein alpha interacting protein −1.9933.08 × 10−20Metabolism/Cell Proliferation/Regulation
ENSG00000101938CHRDL1chordin like 1−1.6221.48 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000132846ZBED3zinc finger BED-type containing 3 −1.5012.00 × 10−13Metabolism/Cell Proliferation/Regulation
ENSG00000187764SEMA4Dsemaphorin 4D−1.1421.53 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000104081BMFBcl2 modifying factor−1.0677.29 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000170214ADRA1Badrenoceptor alpha 1B−3.3244.07 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000151692RNF144Aring finger protein 144A−1.3431.09 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000111885MAN1A1mannosidase alpha class 1A member 1 −1.1171.09 × 10−10Metabolism/Cell Proliferation/Regulation
ENSG00000048740CELF2CUGBP Elav-like family member 2 −1.5452.49 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000134245WNT2BWnt family member 2B−1.4675.53 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000136859ANGPTL2angiopoietin like 2−1.7079.06 × 10−22Metabolism/Cell Proliferation/Regulation
ENSG00000170624SGCDsarcoglycan delta −1.3008.69 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000135472FAIM2Fas apoptotic inhibitory molecule 2 −1.5312.10 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000065717TLE2transducin like enhancer of split 2 −1.2752.37 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000064205WISP2WNT1 inducible signaling pathway protein 2 −2.0295.00 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000184347SLIT3slit guidance ligand 3−1.8357.13 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000137834SMAD6SMAD family member 6−1.5459.50 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000178573MAFMAF bZIP transcription factor −1.0772.32 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000248746ACTN3actinin alpha 3 (gene/pseudogene) −1.9871.15 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000154734ADAMTS1ADAM metallopeptidase with thrombospondin type 1 motif 1 −1.6674.48 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000166106ADAMTS15ADAM metallopeptidase with thrombospondin type 1 motif 15−1.3952.83 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000158555GDPD5glycerophosphodiester phosphodiesterase domain containing 5−2.2751.82 × 10−8Metabolism/Cell Proliferation/Regulation
ENSG00000173599PCpyruvate carboxylase −1.1234.07 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000122877EGR2early growth response 2 −2.4303.34 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000179388EGR3early growth response 3−1.9461.08 × 10−10Metabolism/Cell Proliferation/Regulation
ENSG00000052850ALX4ALX homeobox 4−1.1884.54 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000168502MTCL1microtubule crosslinking factor 1 −1.1443.19 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000276600RAB7BRAB7B, member RAS oncogene family −1.7491.91 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000118849RARRES1retinoic acid receptor responder 1 −1.0417.15 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000213626LBHlimb bud and heart development −1.8901.54 × 10−25Metabolism/Cell Proliferation/Regulation
ENSG00000169744LDB2LIM domain binding 2−1.1151.09 × 10−9Metabolism/Cell Proliferation/Regulation
ENSG00000071282LMCD1LIM and cysteine rich domains 1 −1.7471.80 × 10−22Metabolism/Cell Proliferation/Regulation
ENSG00000163431LMOD1leiomodin 1 −1.0481.94 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000170312CDK1cyclin dependent kinase 1−1.1044.72 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000123080CDKN2Ccyclin dependent kinase inhibitor 2C−1.2471.27 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000066279ASPMabnormal spindle microtubule assembly−1.5977.20 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000116741RGS2regulator of G protein signaling 2 −1.0237.35 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000128482RNF112ring finger protein 112−1.2585.99 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000137193PIM1Pim-1 proto-oncogene, serine/threonine kinase −1.0806.87 × 10−11Metabolism/Cell Proliferation/Regulation
ENSG00000116133DHCR2424-dehydrocholesterol reductase −1.0422.13 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000148773MKI67marker of proliferation Ki-67−1.2554.78 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000092621PHGDHphosphoglycerate dehydrogenase −1.4085.84 × 10−11Metabolism/Cell Proliferation/Regulation
ENSG00000108387SEPT4septin 4 −1.2743.41 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000125354SEPT6septin 6−1.0034.95 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000136531SCN2Asodium voltage-gated channel alpha subunit 2 −1.8281.68 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000139211AMIGO2adhesion molecule with Ig like domain 2 −1.1271.26 × 10−11Metabolism/Cell Proliferation/Regulation
ENSG00000120738EGR1early growth response 1−1.3444.50 × 10−16Metabolism/Cell Proliferation/Regulation
ENSG00000165959CLMNcalmin −2.1821.51 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000090539CHRDchordin−1.0014.24 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000106003LFNGLFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase −1.0293.52 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000164920OSR2odd-skipped related transciption factor 2 −1.2493.36 × 10−8Metabolism/Cell Proliferation/Regulation
ENSG00000115252PDE1Aphosphodiesterase 1A−2.9891.15 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000111341MGPmatrix Gla protein−1.6732.70 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000187098MITFmelanogenesis associated transcription factor −1.7411.10 × 10−16Metabolism/Cell Proliferation/Regulation
ENSG00000169184MN1MN1 proto-oncogene, transcriptional regulator −1.8573.34 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000120278PLEKHG1pleckstrin homology and RhoGEF domain containing G1 −1.3082.49 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000240694PNMA2paraneoplastic Ma antigen 2−1.2841.77 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000143125PROK1prokineticin 1−1.3521.04 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000106772PRUNE2prune homolog 2−1.7921.75 × 10−10Metabolism/Cell Proliferation/Regulation
ENSG00000160801PTH1Rparathyroid hormone 1 receptor−1.4423.49 × 10−7Metabolism/Cell Proliferation/Regulation
ENSG00000107551RASSF4Ras association domain family member 4 −1.4576.36 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000141068KSR1kinase suppressor of ras 1 −1.1572.05 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000117155SSX2IPSSX family member 2 interacting protein −1.1902.62 × 10−16Metabolism/Cell Proliferation/Regulation
ENSG00000162595DIRAS3DIRAS family GTPase 3−1.3716.86 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000179981TSHZ1teashirt zinc finger homeobox 1 −1.0943.79 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000088756ARHGAP28Rho GTPase activating protein 28−1.4253.47 × 10−23Metabolism/Cell Proliferation/Regulation
ENSG00000137727ARHGAP20Rho GTPase activating protein 20−2.1011.84 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000172346CSDC2cold shock domain containing C2 −2.1392.20 × 10−14Metabolism/Cell Proliferation/Regulation
ENSG00000181444ZNF467zinc finger protein 467−1.2102.94 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000206538VGLL3vestigial like family member 3−1.0529.47 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000112246SIM1single-minded family bHLH transcription factor 1 −1.0951.58 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000173227SYT12synaptotagmin 12−2.1601.04 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000258818RNASE4ribonuclease A family member 4 −1.0504.07 × 10−3Metabolism/Cell Proliferation/Regulation
ENSG00000153993SEMA3Dsemaphorin 3D−1.4889.82 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000012171SEMA3Bsemaphorin 3B −1.5155.39 × 10−11Metabolism/Cell Proliferation/Regulation
ENSG00000182175RGMArepulsive guidance molecule family member a −1.2258.69 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000120693SMAD9SMAD family member 9−1.3598.99 × 10−5Metabolism/Cell Proliferation/Regulation
ENSG00000112984KIF20Akinesin family member 20A−1.6071.70 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000211448DIO2iodothyronine deiodinase 2 −1.2497.48 × 10−6Metabolism/Cell Proliferation/Regulation
ENSG00000197406DIO3iodothyronine deiodinase 3 −1.5933.51 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000010932FMO1flavin containing monooxygenase 1 −3.4301.99 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000076258FMO4flavin containing monooxygenase 4 −1.8251.53 × 10−9Metabolism/Cell Proliferation/Regulation
ENSG00000131781FMO5flavin containing monooxygenase 5 −1.2184.49 × 10−2Metabolism/Cell Proliferation/Regulation
ENSG00000162496DHRS3dehydrogenase/reductase 3 −1.4891.03 × 10−4Metabolism/Cell Proliferation/Regulation
ENSG00000159167STC1stanniocalcin 11.2497.50 × 10−13Response to stimulus
ENSG00000133805AMPD3adenosine monophosphate deaminase 3 1.0878.42 × 10−9Response to stimulus
ENSG00000143786CNIH3cornichon family AMPA receptor auxiliary protein 3 1.3804.64 × 10−7Response to stimulus
ENSG00000170373CST1cystatin SN2.7213.26 × 10−6Response to stimulus
ENSG00000134769DTNAdystrobrevin alpha 1.1184.90 × 10−7Response to stimulus
ENSG00000120875DUSP4dual specificity phosphatase 41.0403.70 × 10−11Response to stimulus
ENSG00000060558GNA15G protein subunit alpha 15 1.7252.90 × 10−2Response to stimulus
ENSG00000181773GPR3G protein-coupled receptor 3 1.3454.88 × 10−4Response to stimulus
ENSG00000180875GREM2gremlin 2, DAN family BMP antagonist 1.3518.05 × 10−7Response to stimulus
ENSG00000148834GSTO1glutathione S-transferase omega 1 1.6531.22 × 10−3Response to stimulus
ENSG00000128285MCHR1melanin concentrating hormone receptor 1 2.2943.65 × 10−2Response to stimulus
ENSG00000169715MT1Emetallothionein 1E1.7316.29 × 10−3Response to stimulus
ENSG00000104490NCALDneurocalcin delta1.4281.58 × 10−2Response to stimulus
ENSG00000171208NETO2neuropilin and tolloid like 21.2722.96 × 10−8Response to stimulus
ENSG00000154217PITPNC1phosphatidylinositol transfer protein, cytoplasmic 11.2572.90 × 10−5Response to stimulus
ENSG00000087494PTHLHparathyroid hormone like hormone 1.4589.51 × 10−5Response to stimulus
ENSG00000041353RAB27BRAB27B, member RAS oncogene family 1.3852.72 × 10−6Response to stimulus
ENSG00000136237RAPGEF5Rap guanine nucleotide exchange factor 5 1.6592.41 × 10−2Response to stimulus
ENSG00000181625SLX1BSLX1 homolog B, structure-specific endonuclease subunit1.4103.68 × 10−3Response to stimulus
ENSG00000101463SYNDIG1synapse differentiation inducing 1 1.1627.33 × 10−4Response to stimulus
ENSG00000011347SYT7synaptotagmin 71.6781.56 × 10−2Response to stimulus
ENSG00000184292TACSTD2tumor associated calcium signal transducer 2 1.2291.93 × 10−2Response to stimulus
ENSG00000105825TFPI2tissue factor pathway inhibitor 2 1.9402.13 × 10−7Response to stimulus
ENSG00000178726THBDthrombomodulin 2.3112.52 × 10−4Response to stimulus
ENSG00000147573TRIM55tripartite motif containing 55 2.2272.68 × 10−6Response to stimulus
ENSG00000081181ARG2arginase 2 1.3983.08 × 10−2Response to stimulus
ENSG00000169627BOLA2BbolA family member 2B1.2893.05 × 10−2Response to stimulus
ENSG00000144476ACKR3atypical chemokine receptor 3 −2.2203.17 × 10−14Response to stimulus
ENSG00000114698PLSCR4phospholipid scramblase 4−1.1016.91 × 10−15Response to stimulus
ENSG00000137959IFI44Linterferon induced protein 44 like −1.6661.47 × 10−8Response to stimulus
ENSG00000069431ABCC9ATP binding cassette subfamily C member 9−1.2797.83 × 10−6Response to stimulus
ENSG00000132561MATN2matrilin 2−1.9665.43 × 10−21Response to stimulus
ENSG00000162551ALPLalkaline phosphatase, liver/bone/kidney −2.4948.25 × 10−25Response to stimulus
ENSG00000184979USP18ubiquitin specific peptidase 18−1.0573.81 × 10−2Response to stimulus
ENSG00000172264MACROD2MACRO domain containing 2−2.6456.64 × 10−3Response to stimulus
ENSG00000250722SELENOPselenoprotein P−2.8051.50 × 10−36Response to stimulus
ENSG00000069482GALgalanin and GMAP prepropeptide2.3353.68 × 10−3Inflammatory process
ENSG00000151651ADAM8ADAM metallopeptidase domain 8 1.2515.04 × 10−7Inflammatory process
ENSG00000011201ANOS1anosmin 1 1.8779.50 × 10−16Inflammatory process
ENSG00000108691CCL2C-C motif chemokine ligand 21.3395.92 × 10−3Inflammatory process
ENSG00000164400CSF2colony stimulating factor 2 2.5203.09 × 10−5Inflammatory process
ENSG00000108342CSF3colony stimulating factor 32.3723.36 × 10−17Inflammatory process
ENSG00000163739CXCL1C-X-C motif chemokine ligand 1 1.6121.83 × 10−5Inflammatory process
ENSG00000081041CXCL2C-X-C motif chemokine ligand 2 1.7138.35 × 10−5Inflammatory process
ENSG00000163734CXCL3C-X-C motif chemokine ligand 3 1.1497.49 × 10−6Inflammatory process
ENSG00000163735CXCL5C-X-C motif chemokine ligand 5 2.1073.74 × 10−36Inflammatory process
ENSG00000169429CXCL8C-X-C motif chemokine ligand 8 2.3403.78 × 10−17Inflammatory process
ENSG00000123496IL13RA2interleukin 13 receptor subunit alpha 2 1.3249.69 × 10−6Inflammatory process
ENSG00000125538IL1Binterleukin 1 beta1.9402.34 × 10−14Inflammatory process
ENSG00000162892IL24interleukin 24 3.1052.62 × 10−16Inflammatory process
ENSG00000136244IL6interleukin 61.6542.51 × 10−6Inflammatory process
ENSG00000134070IRAK2interleukin 1 receptor associated kinase 2 1.4461.34 × 10−24Inflammatory process
ENSG00000119714GPR68G protein-coupled receptor 681.8395.85 × 10−6Inflammatory process
ENSG00000175040CHST2carbohydrate sulfotransferase 2 1.0461.22 × 10−9Inflammatory process
ENSG00000271605MILR1mast cell immunoglobulin like receptor 1 1.3398.66 × 10−4Inflammatory process
ENSG00000130203APOEapolipoprotein E−1.0924.88 × 10−9Inflammatory process
ENSG00000196639HRH1histamine receptor H1−1.4946.54 × 10−10Inflammatory process
ENSG00000172156CCL11C-C motif chemokine ligand 11 −1.4164.72 × 10−2Inflammatory process
ENSG00000168952STXBP6syntaxin binding protein 6 −1.2833.40 × 10−3Inflammatory process
ENSG00000129009ISLRimmunoglobulin superfamily containing leucine rich repeat−1.5019.35 × 10−20Inflammatory process
ENSG00000170989S1PR1sphingosine-1-phosphate receptor 1 −1.6833.54 × 10−8Inflammatory process
ENSG00000235568NFAM1NFAT activating protein with ITAM motif 1 −2.5463.56 × 10−4Inflammatory process
ENSG00000124212PTGISprostaglandin I2 synthase−2.4221.80 × 10−22Inflammatory process
ENSG00000185432METTL7Amethyltransferase like 7A −1.5237.00 × 10−10Inflammatory process
ENSG00000169432SCN9Asodium voltage-gated channel alpha subunit 9 −1.2451.42 × 10−4Inflammatory process
ENSG00000163701IL17REinterleukin 17 receptor E −1.4212.73 × 10−2Inflammatory process
ENSG00000167191GPRC5BG protein-coupled receptor class C group 5 member B −1.6501.14 × 10−9Inflammatory process
ENSG00000162645GBP2guanylate binding protein 2 −2.3612.44 × 10−34Inflammatory process
ENSG00000170323FABP4fatty acid binding protein 4−4.6204.47 × 10−6Inflammatory process
ENSG00000162692VCAM1vascular cell adhesion molecule 1 −2.9907.32 × 10−9Inflammatory process
ENSG00000144730IL17RDinterleukin 17 receptor D−1.1574.32 × 10−2Inflammatory process
ENSG00000116106EPHA4EPH receptor A4 −1.8152.62 × 10−7Inflammatory process
ENSG00000182580EPHB3EPH receptor B3−1.2646.89 × 10−5Inflammatory process
ENSG00000106123EPHB6EPH receptor B6 −1.3671.33 × 10−10Inflammatory process
ENSG00000238271IFNWP19interferon omega 1 pseudogene 19 −1.6124.34 × 10−2Inflammatory process
ENSG00000133056PIK3C2Bphosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta−1.4492.38 × 10−2Inflammatory process
ENSG00000145675PIK3R1phosphoinositide-3-kinase regulatory subunit 1 −1.0171.15 × 10−2Inflammatory process
ENSG00000164099PRSS12protease, serine 12 −1.0811.70 × 10−4Inflammatory process
ENSG00000090889KIF4Akinesin family member 4A −1.5603.32 × 10−2Inflammatory process
ENSG00000099998GGT5gamma-glutamyltransferase 51.0099.64 × 10−14Response to oxidative stress
ENSG00000148834GSTO1glutathione S-transferase omega 1 1.6531.22 × 10−3Response to oxidative stress
ENSG00000198763MT-ND2mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 2 1.1183.23 × 10−2Response to oxidative stress
ENSG00000086991NOX4NADPH oxidase 41.6042.24 × 10−5Response to oxidative stress
ENSG00000158125XDHxanthine dehydrogenase 1.3172.20 × 10−4Response to oxidative stress
ENSG00000122378FAM213Afamily with sequence similarity 213 member A 1.0549.19 × 10−7Response to oxidative stress
ENSG00000117592PRDX6peroxiredoxin 61.0141.90 × 10−2Response to oxidative stress
ENSG00000188906LRRK2leucine rich repeat kinase 2 −1.0822.49 × 10−2Response to oxidative stress
ENSG00000196139AKR1C3aldo-keto reductase family 1 member C3−1.4423.29 × 10−7Response to oxidative stress
ENSG00000123453SARDHsarcosine dehydrogenase −1.4451.03 × 10−2Response to oxidative stress
ENSG00000196616ADH1Balcohol dehydrogenase 1B (class I), beta polypeptide−3.2971.15 × 10−47Response to oxidative stress
ENSG00000165092ALDH1A1aldehyde dehydrogenase 1 family member A1 −1.8117.67 × 10−56Response to oxidative stress
ENSG00000109819PPARGC1APPARG coactivator 1 alpha −1.0622.51 × 10−6Response to oxidative stress
ENSG00000155962CLIC2chloride intracellular channel 2−1.5952.65 × 10−2Response to oxidative stress
ENSG00000240069GPAA1P1glycosylphosphatidylinositol anchor attachment 1 pseudogene 12.7885.44 × 10−4Communication
ENSG00000230596GPAA1P2glycosylphosphatidylinositol anchor attachment 1 pseudogene 22.3602.70 × 10−3Communication
ENSG00000115756HPCAL1hippocalcin like 11.0113.56 × 10−3Communication
ENSG00000180332KCTD4potassium channel tetramerization domain containing 4 2.1995.29 × 10−4Communication
ENSG00000166562SEC11CSEC11 homolog C, signal peptidase complex subunit1.5361.19 × 10−3Communication
ENSG00000139364TMEM132Btransmembrane protein 132B1.4651.59 × 10−7Communication
ENSG00000249992TMEM158transmembrane protein 158 (gene/pseudogene) 3.0512.25 × 10−6Communication
ENSG00000157111TMEM171transmembrane protein 1711.5404.72 × 10−2Communication
ENSG00000095209TMEM38Btransmembrane protein 38B1.1521.87 × 10−5Communication
ENSG00000179431FJX1four jointed box 1 1.4322.05 × 10−4Communication
ENSG00000143341HMCN1hemicentin 1−2.0931.63 × 10−6Communication
ENSG00000144681STACSH3 and cysteine rich domain −3.2413.30 × 10−12Communication
ENSG00000171992SYNPOsynaptopodin−1.4002.83 × 10−3Communication
ENSG00000172403SYNPO2synaptopodin 2 −3.0169.64 × 10−14Communication
ENSG00000111452ADGRD1adhesion G protein-coupled receptor D1−1.3901.36 × 10−3Communication
ENSG00000126016AMOTangiomotin−2.1524.31 × 10−12Communication
ENSG00000113209PCDHB5protocadherin beta 5 −1.1914.99 × 10−2Communication
ENSG00000113212PCDHB7protocadherin beta 7 −1.4281.70 × 10−2Communication
ENSG00000163531NFASCneurofascin−1.1831.11 × 10−2Communication
ENSG00000007944MYLIPmyosin regulatory light chain interacting protein −1.0781.18 × 10−6Communication
ENSG00000169760NLGN1neuroligin 1−1.5233.37 × 10−5Communication
ENSG00000144857BOCBOC cell adhesion associated, oncogene regulated−1.2226.43 × 10−5Communication
ENSG00000162849KIF26Bkinesin family member 26B −1.8495.18 × 10−6Communication
ENSG00000226237GAS1RRGAS1 adjacent regulatory RNA −1.9234.31 × 10−3Communication
ENSG00000185565LSAMPlimbic system-associated membrane protein −1.7332.28 × 10−3Communication
ENSG00000158258CLSTN2calsyntenin 2 −2.2513.02 × 10−8Communication
ENSG00000163520FBLN2fibulin 2−1.1358.04 × 10−5Communication
ENSG00000153707PTPRDprotein tyrosine phosphatase, receptor type D −1.5491.33 × 10−4Communication
ENSG00000175356SCUBE2signal peptide, CUB domain and EGF like domain containing 2 −1.3358.72 × 10−4Communication
ENSG00000182010RTKN2rhotekin 2 −2.2483.82 × 10−3Communication
ENSG00000068831RASGRP2RAS guanyl releasing protein 2 −1.1881.22 × 10−2Communication
ENSG00000171408PDE7Bphosphodiesterase 7B −1.0711.94 × 10−3Communication
ENSG00000103710RASL12RAS like family 12−1.1892.06 × 10−6Communication
ENSG00000145934TENM2teneurin transmembrane protein 2 −1.5276.39 × 10−3Communication
ENSG00000166448TMEM130transmembrane protein 130−2.2675.15 × 10−6Communication
ENSG00000178401DNAJC22DnaJ heat shock protein family (Hsp40) member C22 −1.3571.14 × 10−4Communication
ENSG00000185442FAM174Bfamily with sequence similarity 174 member B −1.1412.79 × 10−7Communication
ENSG00000177363LRRN4CLLRRN4 C-terminal like−1.0722.24 × 10−5Communication
ENSG00000170153RNF150ring finger protein 150−2.2083.10 × 10−13Communication
ENSG00000185561TLCD2TLC domain containing 2−1.1342.38 × 10−5Communication
ENSG00000151690MFSD6major facilitator superfamily domain containing 6−1.0242.12 × 10−7Communication
ENSG00000226887ERVMER34-1endogenous retrovirus group MER34 member 1, envelope −2.3725.16 × 10−3Communication
ENSG00000005379TSPOAP1TSPO associated protein 1 −2.0171.32 × 10−5Communication
ENSG00000013297CLDN11claudin 11 −1.2631.23 × 10−5Communication
ENSG00000172348RCAN2regulator of calcineurin 2 −2.2409.99 × 10−8Communication
ENSG00000198542ITGBL1integrin subunit beta like 1−1.0451.55 × 10−8Communication
ENSG00000113805CNTN3contactin 3 −1.2851.94 × 10−4Communication
ENSG00000165124SVEP1sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1−1.5461.36 × 10−4Communication
ENSG00000162804SNED1sushi, nidogen and EGF like domains 1 −1.1638.26 × 10−4Communication
ENSG00000187244BCAMbasal cell adhesion molecule (Lutheran blood group) −1.0883.79 × 10−5Communication
ENSG00000064309CDONcell adhesion associated, oncogene regulated−2.0332.00 × 10−13Communication
ENSG00000095203EPB41L4Berythrocyte membrane protein band 4.1 like 4B −1.3896.09 × 10−3Communication
ENSG00000157193LRP8LDL receptor related protein 81.4489.21 × 10−4Lipids(barrier function)
ENSG00000073756PTGS2prostaglandin-endoperoxide synthase 21.2741.20 × 10−8Lipids(barrier function)
ENSG00000123689G0S2G0/G1 switch 2 1.3827.06 × 10−5Lipids(barrier function)
ENSG00000176170SPHK1sphingosine kinase 11.0142.42 × 10−4Lipids(barrier function)
ENSG00000105499PLA2G4Cphospholipase A2 group IVC1.1457.84 × 10−11Lipids(barrier function)
ENSG00000101188NTSR1neurotensin receptor 11.8952.44 × 10−2Lipids(barrier function)
ENSG00000076555ACACBacetyl-CoA carboxylase beta−1.4053.86 × 10−3Lipids(barrier function)
ENSG00000100342APOL1apolipoprotein L1−1.8412.88 × 10−4Lipids(barrier function)
ENSG00000157399ARSEarylsulfatase E (chondrodysplasia punctata 1)−1.2301.09 × 10−3Lipids(barrier function)
ENSG00000106484MESTmesoderm specific transcript −1.8296.91 × 10−15Lipids(barrier function)
ENSG00000169255B3GALNT1beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)−1.0719.26 × 10−4Lipids(barrier function)
ENSG00000120915EPHX2epoxide hydrolase 2−1.7441.48 × 10−3Lipids(barrier function)
ENSG00000169174PCSK9proprotein convertase subtilisin/kexin type 9 −2.3683.78 × 10−2Lipids(barrier function)
ENSG00000162407PLPP3phospholipid phosphatase 3 −1.4081.06 × 10−15Lipids(barrier function)
ENSG00000133321RARRES3retinoic acid receptor responder 3 −1.8921.00 × 10−2Lipids(barrier function)
ENSG00000137642SORL1sortilin related receptor 1 −1.8482.32 × 10−2Lipids(barrier function)
ENSG00000172296SPTLC3serine palmitoyltransferase long chain base subunit 3 −2.6123.34 × 10−5Lipids(barrier function)
ENSG00000129951PLPPR3phospholipid phosphatase related 3 −1.6392.62 × 10−2Lipids(barrier function)
ENSG00000134343ANO3anoctamin 3−3.4135.11 × 10−5Lipids(barrier function)
ENSG00000172594SMPDL3Asphingomyelin phosphodiesterase acid like 3A −1.3319.50 × 10−5Lipids(barrier function)
ENSG00000147465STARsteroidogenic acute regulatory protein −1.1074.63 × 10−2Lipids(barrier function)
ENSG00000099204ABLIM1actin binding LIM protein 1−1.2992.25 × 10−6Cytoskeleton organization
ENSG00000167549CORO6coronin 6 −1.2564.91 × 10−4Cytoskeleton organization
ENSG00000146122DAAM2dishevelled associated activator of morphogenesis 2 −1.1583.78 × 10−2Cytoskeleton organization
ENSG00000139734DIAPH3diaphanous related formin 3−1.2232.20 × 10−2Cytoskeleton organization
ENSG00000082397EPB41L3erythrocyte membrane protein band 4.1 like 3 −1.2962.38 × 10−8Cytoskeleton organization
ENSG00000078018MAP2microtubule associated protein 2 −3.1021.25 × 10−11Cytoskeleton organization
ENSG00000116141MARK1microtubule affinity regulating kinase 1 −1.2919.50 × 10−5Cytoskeleton organization
ENSG00000133026MYH10myosin heavy chain 10−1.2972.58 × 10−3Cytoskeleton organization
ENSG00000099864PALMparalemmin−1.2553.72 × 10−9Cytoskeleton organization
ENSG00000118898PPLperiplakin −2.8584.50 × 10−16Cytoskeleton organization
ENSG00000126785RHOJras homolog family member J −1.1841.02 × 10−2Cytoskeleton organization
ENSG00000168477TNXBtenascin XB−1.4311.19 × 10−3Cytoskeleton organization
ENSG00000137285TUBB2Btubulin beta 2B class IIb−1.4604.75 × 10−9Cytoskeleton organization
ENSG00000148700ADD3adducin 3−1.0092.68 × 10−6Cytoskeleton organization
ENSG00000231789PIK3CD-AS2PIK3CD antisense RNA 2 −1.3951.54 × 10−2Cytoskeleton organization
ENSG00000152527PLEKHH2pleckstrin homology, MyTH4 and FERM domain containing H2−1.0174.84 × 10−3Cytoskeleton organization
ENSG00000188783PRELPproline and arginine rich end leucine rich repeat protein −1.5942.61 × 10−29Cytoskeleton organization
ENSG00000222047C10orf55chromosome 10 open reading frame 55 1.7124.81 × 10−3Unknown
ENSG00000163814CDCP1CUB domain containing protein 1 1.6212.86 × 10−17Unknown
ENSG00000154319FAM167Afamily with sequence similarity 167 member A 1.0825.30 × 10−10Unknown
ENSG00000166578IQCDIQ motif containing D1.6371.34 × 10−6Unknown
ENSG00000253522MIR3142HGMIR3142 host gene 1.5551.41 × 10−2Unknown
ENSG00000164929BAALCbrain and acute leukemia, cytoplasmic 1.2151.50 × 10−2Unknown
ENSG00000239704CDRT4CMT1A duplicated region transcript 4 3.4432.85 × 10−2Unknown
ENSG00000260549MT1Lmetallothionein 1L, pseudogene 2.5826.86 × 10−5Unknown
ENSG00000187193MT1Xmetallothionein 1X 1.3494.34 × 10−2Unknown
ENSG00000125148MT2Ametallothionein 2A 2.4084.51 × 10−5Unknown
ENSG00000217930PAM16presequence translocase associated motor 16 homolog 1.4003.06 × 10−2Unknown
ENSG00000241749RPSAP52ribosomal protein SA pseudogene 52 1.4718.60 × 10−6Unknown
ENSG00000186577SMIM29small integral membrane protein 29 1.0773.37 × 10−2Unknown
ENSG00000157111TMEM171transmembrane protein 171 1.5404.72 × 10−2Unknown
ENSG00000185262UBALD2UBA like domain containing 2 1.3292.38 × 10−3Unknown
ENSG00000240476LINC00973long intergenic non-protein coding RNA 9732.3265.72 × 10−3Unknown
ENSG00000257219LINC02407long intergenic non-protein coding RNA 24072.3017.04 × 10−3Unknown
ENSG00000235385LINC02154long intergenic non-protein coding RNA 21542.1772.30 × 10−3Unknown
ENSG00000164236ANKRD33Bankyrin repeat domain 33B−1.2403.89 × 10−3Unknown
ENSG00000264230ANXA8L1annexin A8 like 1 −2.8134.43 × 10−4Unknown
ENSG00000198624CCDC69coiled-coil domain containing 69−1.3206.43 × 10−13Unknown
ENSG00000055813CCDC85Acoiled-coil domain containing 85A−2.7211.19 × 10−2Unknown
ENSG00000105516DBPD-box binding PAR bZIP transcription factor −1.3553.37 × 10−2Unknown
ENSG00000258498DIO3OSDIO3 opposite strand/antisense RNA (head to head) −1.0352.02 × 10−3Unknown
ENSG00000229847EMX2OSEMX2 opposite strand/antisense RNA −1.0161.90 × 10−4Unknown
ENSG00000133106EPSTI1epithelial stromal interaction 1 −1.1843.04 × 10−13Unknown
ENSG00000162636FAM102Bfamily with sequence similarity 102 member B −1.0243.21 × 10−4Unknown
ENSG00000255052FAM66Dfamily with sequence similarity 66 member D −1.5994.85 × 10−3Unknown
ENSG00000265962GACAT2gastric cancer associated transcript 2 (non-protein coding) −1.7887.03 × 10−3Unknown
ENSG00000072163LIMS2LIM zinc finger domain containing 2 −1.5013.09 × 10−17Unknown
ENSG00000225783MIATmyocardial infarction associated transcript (non-protein coding)−2.9244.61 × 10−11Unknown
ENSG00000220785MTMR9LPmyotubularin related protein 9-like, pseudogene −1.1533.36 × 10−3Unknown
ENSG00000183486MX2MX dynamin like GTPase 2−1.4751.38 × 10−4Unknown
ENSG00000143850PLEKHA6pleckstrin homology domain containing A6 −1.1904.27 × 10−3Unknown
ENSG00000230487PSMG3-AS1PSMG3 antisense RNA 1 (head to head) −1.0082.36 × 10−3Unknown
ENSG00000203727SAMD5sterile alpha motif domain containing 5 −2.6632.06 × 10−14Unknown
ENSG00000111907TPD52L1tumor protein D52 like 1−1.7431.79 × 10−2Unknown
ENSG00000183801OLFML1olfactomedin like 1 −2.3886.30 × 10−18Unknown
ENSG00000116774OLFML3olfactomedin like 3 −1.8133.10 × 10−27Unknown
ENSG00000103145HCFC1R1host cell factor C1 regulator 1−1.2549.23 × 10−4Unknown
ENSG00000156042CFAP70cilia and flagella associated protein 70 −1.3354.93 × 10−2Unknown
ENSG00000147642SYBUsyntabulin−1.6332.50 × 10−2Unknown
ENSG00000165507C10orf10chromosome 10 open reading frame 10−1.0721.75 × 10−6Unknown
ENSG00000110002VWA5Avon Willebrand factor A domain containing 5A −1.1823.26 × 10−7Unknown
ENSG00000082497SERTAD4SERTA domain containing 4 −1.6868.66 × 10−9Unknown
ENSG00000130518KIAA1683KIAA1683 −1.0071.23 × 10−2Unknown
ENSG00000152217SETBP1SET binding protein 1−1.2537.10 × 10−4Unknown
ENSG00000198846TOXthymocyte selection associated high mobility group box−1.7921.29 × 10−4Unknown
ENSG00000139714MORN3MORN repeat containing 3 −1.5404.27 × 10−2Unknown
ENSG00000164309CMYA5cardiomyopathy associated 5 −1.3443.12 × 10−2Unknown
ENSG00000072952MRVI1murine retrovirus integration site 1 homolog −1.2517.52 × 10−5Unknown
ENSG00000204789ZNF204Pzinc finger protein 204, pseudogene −2.0324.81 × 10−3Unknown
ENSG00000116667C1orf21chromosome 1 open reading frame 21 −1.2193.04 × 10−12Unknown
ENSG00000120262CCDC170coiled-coil domain containing 170 −1.9218.42 × 10−9Unknown
ENSG00000204396VWA7von Willebrand factor A domain containing 7 −2.1051.73 × 10−2Unknown
Notes: FC, fold change. The differential expressed genes (DEGs) in the H2O2-induced oxidative damage study were screened using the criteria of |log2FC| > 2 and P-adjust < 0.05. The DEGs were functionally annotated using Blast2go (Version 2.5) and goatools (Version 0.6.5) for gene ontology (GO) annotation and clustering analysis.
Table
Table 5. Contents of total and reduction sugars and phenolic compounds analyzed by spectrophotometric methods by RFB, HBFB, OFB.
Table 5. Contents of total and reduction sugars and phenolic compounds analyzed by spectrophotometric methods by RFB, HBFB, OFB.
SamplesRFBHBFBOFB
Matter Content (%)
Total sugar43.36 ± 0.1412.16 ± 0.119.69 ± 0.17
Reducing sugar3.18 ± 0.010.91 ± 0.030.12 ± 0.02
β-glucan0.78 ± 0.050.84 ± 0.082.74 ± 0.04
Flavonoids1.11 ± 0.011.31 ± 0.061.17 ± 0.01
Total phenol1.46 ± 0.091.84 ± 0.051.75 ± 0.03
Table
Table 6. The substance content of RFB, HBFB, OFB.
Table 6. The substance content of RFB, HBFB, OFB.
SamplesRFBHBFBOFB
Matter Content (%)
Fat0.61.10.9
Protein proportion7.8314.927.3
Ash0.354.04.6
Moisture7.36.717.95
Carbohydrate83.973.359.2
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cheng, W.; Shi, X.; Zhang, J.; Li, L.; Di, F.; Li, M.; Wang, C.; An, Q.; Zhao, D. Role of PI3K-AKT Pathway in Ultraviolet Ray and Hydrogen Peroxide-Induced Oxidative Damage and Its Repair by Grain Ferments. Foods 2023, 12, 806. https://doi.org/10.3390/foods12040806

AMA Style

Cheng W, Shi X, Zhang J, Li L, Di F, Li M, Wang C, An Q, Zhao D. Role of PI3K-AKT Pathway in Ultraviolet Ray and Hydrogen Peroxide-Induced Oxidative Damage and Its Repair by Grain Ferments. Foods. 2023; 12(4):806. https://doi.org/10.3390/foods12040806

Chicago/Turabian Style

Cheng, Wenjing, Xiuqin Shi, Jiachan Zhang, Luyao Li, Feiqian Di, Meng Li, Changtao Wang, Quan An, and Dan Zhao. 2023. "Role of PI3K-AKT Pathway in Ultraviolet Ray and Hydrogen Peroxide-Induced Oxidative Damage and Its Repair by Grain Ferments" Foods 12, no. 4: 806. https://doi.org/10.3390/foods12040806

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop