Next Article in Journal
Molecular and Cellular Mechanisms of Inflammation and Tissue Regeneration
Next Article in Special Issue
Diagnosis and Management of Mucopolysaccharidosis Type II (Hunter Syndrome) in Poland
Previous Article in Journal
Animal Models for Heart Transplantation Focusing on the Pathological Conditions
Previous Article in Special Issue
What to Do if the qPCR Test for SARS-CoV-2 or Other Pathogen Lacks Endogenous Internal Control? A Simple Test on Housekeeping Genes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 11
Issue 5
10.3390/biomedicines11051415
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Association of the rs3039851 Insertion/Deletion in the Gene PPP3R1, Which Encodes the Regulatory Calcineurin Subunit B Type 1, with Left Ventricular Mass in Polish Full-Term Newborns

by
Iwona Gorący
1,†,
Beata Łoniewska
2,†,
Klaudyna Lewandowska
1,
Agnieszka Boroń
1,
Małgorzata Grzegorczyk
1,
Robert Nowak
3,4,
Jeremy Simon C. Clark
1 and
Andrzej Ciechanowicz
1,*
1
Department of Clinical and Molecular Biochemistry, Pomeranian Medical University, 70-111 Szczecin, Poland
2
Department of Neonatal Diseases, Pomeranian Medical University, 70-111 Szczecin, Poland
3
Institute of Physical Culture Sciences, University of Szczecin, 71-650 Szczecin, Poland
4
Department of Pathology, Pomeranian Medical University, 70-111 Szczecin, Poland
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Biomedicines 2023, 11(5), 1415; https://doi.org/10.3390/biomedicines11051415
Submission received: 30 March 2023 / Revised: 2 May 2023 / Accepted: 8 May 2023 / Published: 10 May 2023
(This article belongs to the Special Issue State-of-the-Art Molecular and Translational Medicine in Poland)
Browse Figure
Versions Notes

Abstract

:
Background: The five base-pair (bp) insertion/deletion (rs3039851) polymorphism in the PPP3R1 gene, which encodes calcineurin subunit B type 1, has been found to be associated with left ventricular hypertrophy (LVH) in hypertensive patients and in athletes. The aim of this study is to analyze the possible association between PPP3R1:rs3039851 polymorphism and left ventricular mass (LVM) in full-term healthy newborns. Methods: The study group consisted of 162 consecutive, full-term, healthy newborns. Two-dimensional M-mode echocardiography was used to assess LVM. The PPP3R1:rs3039851 polymorphism was identified by PCR-RFLP in genomic DNA extracted from cord blood leukocytes. Results: No significant differences were found between newborns homozygous for the reference allele (5I/5I, n = 135) and newborns carrying at least one 5D allele (n = 27) for LVM standardized for body mass, body length or body surface area (LVM/BM, LVM/BL or LVM/BSA, respectively). However, the frequency of PPP3R1:rs3039851 genotypes with a 5D allele (5I/5D + 5D/5D) among newborns with the largest LVM/BM or LVM/BSA (upper tertile) was statistically significantly higher compared with the prevalence in individuals with the lowest values of both indices (lower tertile). Conclusions: Our results suggest that the PPP3R1:rs3039851 polymorphism may contribute to subtle variation in left ventricular mass at birth.

1. Introduction

Left ventricular hypertrophy (LVH) and increased left ventricular mass (LVM) are strong risk factors for cardiovascular disease and morbidity [1]. Cardiac hypertrophy is characterized by increased cell size, cardiac remodeling of myofilaments and increased expression of fetal genes [2]. Using twin [3,4] and population studies [5,6], genetic factors are estimated to be responsible for between 30% and 70% of cardiac mass variability [7]. Calcium (Ca2+) is the most important messenger in cardiac muscle and plays a central role in regulating contractility, gene expression, apoptosis and hypertrophy. Ca2+ transient movements regulate the transcription and gene expression that characterize the hypertrophic response of cardiomyocytes [8].
Calcineurin, a heterodimer composed of a 60 kDa catalytic subunit A (Serine/threonine-protein phosphatase; UNIPROT: A0A0S2Z4C6, P16298 or P48454; from genes PPP3CA, PPP3CB or PPP3CC, respectively) and a 19 kDa regulatory subunit B (Calcineurin subunit B; UNIPROT: P63098 or Q96LZ3; from genes PPP3R1 or PPP3R2), is a calcium- and calmodulin-dependent serine/threonine phosphatase that becomes activated in the presence of increased intracellular Ca2+ levels [9]. The exact ways in which changes in calcineurin subunit B could be critical for development of left ventricular mass in full-term healthy newborns have not been fully defined. It is widely recognized that changes in calcineurin activity in the heart contribute to the determination of cardiovascular phenotypes including pathological hypertrophic remodeling and the progression to failure (Table 1).
Of the two genes which encode regulatory B subunits, only the PPP3R1 gene, which encodes for subunit B type 1, is expressed in the heart (i.e., PPP3R2 is not expressed in the heart) [20]. In 2005, Tang et al. identified the polymorphism rs3039851 as an insertion (allele 5I) or deletion (allele 5D) of 5 base-pairs (TTAAA) at sequence positions from −1059 to −1063 relative to the transcription start site of the PPP3R1 gene transcript available at the time (Genbank accession no. NT022184-12; now replaced) [21]. Tang et al. found no association of PPP3R1:rs3039851 with traditionally defined LVH in 368 severely hypertensive participants (including 197 African-Americans) in the Hypertension Genetic Epidemiology Network (HyperGEN) study. However, the PPP3R1 5D allele in HyperGEN patients was associated with “inappropriately-high” LVM, defined as greater than 128% (which is the upper 90% confidence limit) of the quotient of actual and expected LVM, and this association was independent of age, sex, body mass index, heart rate, prevalent coronary heart disease and/or diabetes and antihypertensive medications [21]. Three years later, Ahmetov et al. reported that the PPP3R1:rs3039851 polymorphism was associated with the risk of left ventricular hypertrophy in Russian athletes [22]. However, no current data could be found concerning a possible association between the PPP3R1:rs3039851 polymorphism and LVM variance in human subjects not exposed to long-term hypertension or sports training, i.e., environmental factors with a documented ability to activate calcineurin and induce myocardial hypertrophy. Therefore, the aim of this study is to assess possible association between the PPP3R1:rs3039851 polymorphism and left ventricular mass measured in full-term healthy newborns.

2. Materials and Methods

2.1. Newborns

The studied cohort consisted of 162 healthy Polish newborns (71 females and 91 males), born after the end of the 37th week of gestation (from 38 to 40 weeks) to healthy women with uncomplicated pregnancies. Newborns in this study were of appropriate size for their gestational age (defined as birth mass above the 10th centile). Exclusion criteria were the following: twins, intrauterine growth restriction, chromosomal aberrations and/or congenital malformations; congenital malformations of the heart were excluded on the basis of ultrasound images. At birth, newborn cord blood (500 μL) was obtained for isolation of genomic DNA. The sex of the newborn, body mass (BM, kg) and body length (BL, m) were taken from standard hospital records. Body surface area (BSA, m2) was calculated using the Mosteller formula [23]:
BSA = 0.0167 × (100 × BL)0.5 × BM0.5
The study was approved by the Bioethics Committee at the Pomeranian Medical University, Szczecin, Poland; parents gave informed consent, and the study was performed according to the latest Declaration of Helsinki (2013).

2.2. Echocardiographic Measurements

Echocardiographic measurements in newborns, on the third day after delivery, were made by one pediatric cardiologist. Two-dimensional M-mode echocardiography was performed (using an Acuson Sequoia 512 unit, Siemens Healthineers, Erlangen, Germany; equipped with a 2–4 MHz imaging transducer). Measurement techniques were consistent with American Society of Echocardiography conventions. Left ventricular masses (LVMs) were estimated from the echocardiographic left ventricular dimension measurements using the Penn convention, with the equation modified by Huwez et al. [24] as follows:
LVM [g] = 1.04 × [(IVST [mm] + LVPWT [mm] + LVID [mm])3 − LVID [mm]3]
where IVST, LVPWT and LVID denote Interventricular Septal Thickness, Left Ventricular Posterior Wall Thickness and Left Ventricular Internal Dimension, respectively. To give standardized parameters, the left ventricular mass was divided by body mass (LVM/BM, g/kg), body length (LVM/BL, g/m) or body surface area (LVM/BSA, g/m2).

2.3. PPP3R1 Genotyping

Genomic DNA from cord blood was isolated (using a QIAamp Blood DNA Mini Kit; QIAGEN, Dusseldorf, Germany), according to the manufacturer’s protocol. For the analysis of the PPP3R1:rs3039851 (NC_000002.12:g.68218182_68218190: TTAATTTAA, referred to here as the major or 5I allele; NC_000002.12:g.68218186_68218190del: delTTTAA, referred to here as the minor or 5D allele and NC_000002.12:g.68218186_68218190dup: dupTTTAA, a very rare allele) polymorphism, a polymerase chain reaction-restriction fragment length polymorphism (PCR/RFLP) method was applied with the following primer pair: forward: 5′-GAGTTTAAAAGCCAGCCAGTCAT-3′, and reverse: 5′-AAAACAGTAA TATCTCAAGTAGTA-3′ (from TIB MOL BIOL, Poznań, Poland). The PPP3R1 amplicons were subsequently digested with the VspI (AseI) restriction enzyme (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was cut into fragments of 201 base pairs (bp) and 103 bp in the presence of the 5I allele or remained uncut in the presence of the 5D allele (with an amplicon of 299 bp in length). Restriction products in each case were electrophoretically separated and visualized by staining (using Midori Green; Nippon Genetics Europe, Duren, Germany) in 3% agarose gels. To verify the results, DNA samples from 16 (10%) randomly chosen newborns were sequenced. Briefly, PCR amplification products were purified using Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher Scientific) according to manufacturer procedures. The products were sequenced (using BigDye® Terminator v3.1 Cycle Sequencing Kits; Applied Biosystems, Life Technologies Polska, Warsaw, Poland). Electrophoresis and analyses were performed according to manufacturer procedures (using an ABI PRISM 3100-Avant machine; Data Collection Software v2.0, Sequencing Analysis Software v5.4; Applied Biosystems). In each case, the result obtained by sequencing was as expected from the PCR-RFLP results. All DNA samples were genotyped blind, i.e., the samples were anonymously labeled by one person and then genotyped by a second person.

2.4. Statistical Analyses

Quantitative data were tested for normality using Kolmogorov–Smirnov or Lilliefors tests. As most quantitative variables were not normally distributed, all are presented as medians with minimum and maximum values. Quantitative data were compared, e.g., between PPP3R1 genotype groups (5I/5I vs. 5I/5D + 5D/5D), using Mann–Whitney tests. Categorical data and the divergence of PPP3R1:rs3039851 genotype frequencies from Hardy–Weinberg equilibrium were assessed using chi-squared tests. Statistical significance was defined as p < 0.05. All data were analyzed using a data analysis software system (Statistica, version 13, TIBCO software, Palo Alto, CA, USA, accessed on 14 November 2022).

3. Results

In the sample there were 135 (83.3%) reference (5I/5I) homozygotes, 26 (16.1%) 5I/5D heterozygotes and 1 (0.6%) 5D/5D homozygote. The frequency of the minor PPP3R1 5D allele was 8.6%. In the female subgroup (n = 71), there were 56 (78.9%) 5I/5I homozygotes, 14 (19.7%) heterozygotes and 1 (1.4%) 5D/5D homozygote. The frequency of the minor 5D allele in female newborns was 11.3%. In the male subgroup (n = 91), there were 79 (86.8%) 5I/5I homozygotes and 12 (13.2%) 5I/5D heterozygotes, and the frequency of the minor 5D allele was 6.6%. The distributions of PPP3R1 genotypes or alleles between both subgroups (female newborns versus male newborns) were not significantly different (p = 0.178 for genotypes and p = 0.137 for alleles), and the PPP3R1:rs3039851 genotype distribution was consistent with the Hardy–Weinberg equilibrium in the whole group (p = 0.834) as well as in female newborns (p = 0.907) and in male newborns (p = 0.501).
Characteristics of the newborn cohort with regard to sex are shown in Table 2. There were no significant differences between female newborns and male newborns in the values of body length, left ventricular dimensions (IVST, LVPWT and LVID) or LVM and LVM indices (LVM/BM, LVM/BL and LVM/BSA). Body mass and BSA in male newborns were significantly higher as compared to females.
There were no significant differences with regard to PPP3R1:rs3039851 genotype (5I/5I versus 5I/5D + 5D/5D) in the values of clinical variables, left ventricular dimensions or in LVM and LVM indices (Table 3).
There were also no significant differences in the distributions of PPP3R1 genotypes between newborns with the highest (above median) or with the lowest (below median) values of LVM indices (Table 4). In addition, we compared the PPP3R1 polymorphism distribution between newborns in the lower tertile (LT) and newborns in the upper tertile (UT) for LVM indices (Table 5). The frequency of PPP3R1 genotypes with at least one 5D allele (5I/5D + 5D/5D genotypes) was significantly higher for LVM/BM and LVM/BSA in newborns from the upper tertile as compared with lower tertile subjects.

4. Discussion

Left ventricular mass is a continuous quantitative trait that is modulated by a complex interaction between genetic and environmental factors [25]. Previously, it has been pointed out that healthy full-term newborns, due to the lack of confounding environmental factors such as diet, lifestyle, smoking, coexisting diseases or medication, are the optimal population group for identifying genetic variants determining (or modulating) cardiovascular phenotypes [26]. Despite this, there are very few reports on this issue in relation to left ventricular mass [25,27,28,29].
Our study reports on the frequency of PPP3R1:rs3039851 genotypes in healthy full-term newborn Poles with respect to left ventricular mass. We have studied newborns born in Szczecin who are descendants of people who moved to Polish West Pomerania after World War II from many parts of the former Poland [30,31]. This migration is considered to be the main reason why contemporary inhabitants of this region are considered a representative sample for the entire Polish population [32,33]. Therefore, the frequency of the PPP3R1 5D allele determined in newborns from Szczecin, at 8.6%, can be treated as a value likely corresponding to the actual prevalence of this genetic variant among Poles. In addition, a very similar 5D frequency (8.8%) was found by Akhmetov et al. in another group of Slavic people consisting of 1073 young healthy Russians [22]. Tang et al.’s study found that the frequency of the PPP3R1 5D allele in people of European descent was 7.6%, and among African Americans as high as 23.9% [21]. Similar differences in the prevalence of the PPP3R1 5D allele were also noticed by Hand et al. who, in a group of white people in the USA, determined the frequency of this variant at 7% and in a group of African-Americans (n = 33) at 24% [34]. In addition, the PPP3R1 5D allele frequency in Polish newborns is consistent with the results of rs3039851 genotyping in populations of European descent included in the 1000 Genomes (1KG) Project (ensembl.org).
Previous studies have associated the PPP3R1 5I/5D polymorphism with left ventricular mass in adults exposed either to the long-term effects of hypertension [21] or to sports training [22], i.e., environmental factors with a documented ability to both activate calcineurin and induce myocardial hypertrophy [9,20,35,36]. The results of our study have shown that the PPP3R1 5I/5D polymorphism is also likely to be associated with left ventricular mass in healthy subjects not exposed to these risk factors.
Evidence for a significant role of calcineurin in developmental mechanisms determining normal heart mass was provided in 2002 [14]. Bueno et al., in transgenic mice lacking the gene encoding the beta isoform of the calcineurin catalytic subunit, showed that at eight weeks after birth, the heart mass of these young animals was significantly (12%) lower compared to mice of the same age without a defect in the gene [14].
Tang et al. indicated that the deletion of 5 nucleotides (5D allele) in the PPP3R1 promoter results in the abolition of a potential binding site of the transcription factor NKX-2, which plays an important role in the regulation of myogenesis and myocardial development [37,38]. In addition, Schott et al. and Benson et al. have shown that mutations in the NKX2-5 gene cause congenital heart defects in humans [39,40]. Therefore, Tang et al. hypothesized that the NKX-2 motif is an important binding site for a repressor or inhibitor of Calcineurin subunit B type 1 transcription at or near the promoter region, and the deletion of 5 nucleotides in this region leads to increased expression of this gene and, consequently, increased calcineurin activity [21].
However, this hypothesis now apparently conflicts with the evidence from the three Ensembl transcripts (the reference/canonical transcript: ENST00000234310.8 plus ENST00000409752.5 and ENST00000409377.1, referred to here as A, B and C, respectively) (Figure 1).
All of these transcripts are assigned a promoter further upstream giving an additional exon, exon 1, with numbers of amino acids predicted to be translated from this exon: A, 1; B, 20, C, 0. The PPP3R1:rs3039851 Indel is therefore assigned as being in Intron 1–2 and not, therefore, at or near a promoter region.
There are various ways in which the above conflict could be resolved, and all include re-evaluation of available transcripts and, possibly, the addition of missing, alternative haplotype transcripts. It is rather unlikely that Transcript A is incorrect as it has been given a high-fidelity transcript tag by Ensembl (tsl1; meaning “all splice junctions of the transcript are supported by at least one non-suspect mRNA”). However, perhaps the first exon does not form part of transcript C (which has tag tsl3: “The only support is from a single EST”)? This would then give transcripts which would conform to the situation predicted by Tang et al. The 5I allele would then have a predicted TATA-box promoter region containing the Indel: the Eukaryotic Neural Network Promoter Prediction tool, NNPP, at https://www.fruitfly.org/seq_tools/promoter.html (accessed 22 February 2023) gave a score of 0.92 for the region: aagatatatatttaaatatgcccatgttaattgtacacttAaattaatag (Indel and duplication underlined) and a higher score of 0.95 for the 5D allele: aagatatatatttaaatatgcccatgtt aattgtacacttAatagcaact, which might also indicate, together with the lack of an NKX-2 binding site, a propensity for higher expression, as suggested by Tang et al.
Re-evaluation of transcripts, collection of new transcripts and prevalence of the three different PPP3R1 polypeptides with lengths: A, 170; B, 189 and C, 160 amino acids, produced by the splice variants, are now urgently needed. Further, we are not able to rule out whether the Indel affects transcription from an intronic location, or, as previously stated by Tang et al. [11], whether the PPP3R1:rs3039851 polymorphism is only in close linkage disequilibrium with some, as yet unidentified, variant of real functional importance. This hypothesis seems to be strongly supported by Alsheikh et al., who indicated an urgent need to assess the actual functional significance of genetic polymorphisms associated with predisposition to specific diseases identified in genome-wide association studies, of which as many as 90% are non-coding variants [42].
We are fully aware that a major limitation of our study is its relatively low statistical power. This results mainly from the low prevalence of the PPP3R1:rs3039851 polymorphism in studied newborns (8.6%) and from a relatively small sample size (n = 162). Data from the 1KG Project (https://www.internationalgenome.org/) clearly confirm that the frequency of the PPP3R1 5D variant, at <10%, is typical for populations of European descent and is about three times lower than in subjects of relatively recent African descent. In addition, by using the Open Epi (www.openepi.com) tool, a free and open source software for epidemiologic statistics, we have computed the minimum sample size for 80% statistical power and 5% type I error rate: assuming a ratio of PPP3R1 5I/5I homozygotes to carriers of at least one 5D allele (5D+) equal to 5.0 (135/27) and LVM/BL higher than the median in 15 of 27 (56%) 5D+ newborns and in 66 of 135 (49%) 5I/5I newborns. Under the above assumptions, the minimum sample size necessary varied from 3113 to 3220 (519–537 of 5D+ and 2594–2683 of 5I/5I newborns). On the other hand, Tang et al. showed a significant association between the PPP3R1 polymorphism with inappropriately high LVM by studying 197 African-American patients only, but 35% of these were carriers of at least one 5D allele [21].

5. Conclusions

Our results suggest that the PPP3R1:rs3039851 polymorphism may account for subtle variation in left ventricular mass in full-term healthy newborns.

Author Contributions

Conceptualization, I.G., B.Ł. and A.C.; formal analysis, R.N. and J.S.C.C.; investigation, I.G., B.Ł., K.L., M.G. and A.B.; methodology, I.G., B.Ł. and A.B.; supervision, A.C.; writing—original draft, A.C.; writing—review and editing, J.S.C.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

This study was approved by the bioethics committee at the Pomeranian Medical University, Szczecin, Poland (decision No. BN-001/57/05).

Informed Consent Statement

Informed consent was obtained from parents of all newborns involved in the study.

Data Availability Statement

The data are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Levy, D.; Garrison, R.J.; Savage, D.D.; Kannel, W.B.; Castelli, W.P. Prognostic implications of echocardiographically determined left ventricular mass in the Framingham Heart Study. N. Engl. J. Med. 1990, 322, 1561–1566. [Google Scholar] [CrossRef] [PubMed]
  2. Frey, N.; Olson, E.N. Cardiac hypertrophy: The good, the bad, and the ugly. Annu. Rev. Physiol. 2003, 65, 45–79. [Google Scholar] [CrossRef] [PubMed]
  3. Swan, L.; Birnie, D.H.; Padmanabhan, S.; Inglis, G.; Connell, J.M.; Hillis, W.S. The genetic determination of left ventricular mass in healthy adults. Eur. Heart J. 2003, 24, 577–582. [Google Scholar] [CrossRef] [PubMed]
  4. Sharma, P.; Middelberg, R.P.; Andrew, T.; Johnson, M.R.; Christley, H.; Brown, M.J. Heritability of left ventricular mass in a large cohort of twins. J. Hypertens. 2006, 24, 321–324. [Google Scholar] [CrossRef]
  5. Bella, J.N.; MacCluer, J.W.; Roman, M.J.; Almasy, L.; North, K.E.; Best, L.G.; Lee, E.T.; Fabsitz, R.R.; Howard, B.V.; Devereux, R.B. Heritability of left ventricular dimensions and mass in American Indians: The Strong Heart Study. J. Hypertens. 2004, 22, 281–286. [Google Scholar] [CrossRef]
  6. Assimes, T.L.; Narasimhan, B.; Seto, T.B.; Yoon, S.; Curb, J.D.; Olshen, R.A.; Quertermous, T. Heritability of left ventricular mass in Japanese families living in Hawaii: The SAPPHIRe Study. J. Hypertens. 2007, 25, 985–992. [Google Scholar] [CrossRef]
  7. Verhaaren, H.A.; Schieken, R.M.; Mosteller, M.; Hewitt, J.K.; Eaves, L.J.; Nance, W.E. Bivariate genetic analysis of left ventricular mass and weight in pubertal twins (the Medical College of Virginia twin study). Am. J. Cardiol. 1991, 68, 661–668. [Google Scholar] [CrossRef]
  8. Hardingham, G.E.; Bading, H. Nuclear calcium: A key regulator of gene expression. Biometals 1998, 11, 345–358. [Google Scholar] [CrossRef]
  9. Chen, L.; Song, M.; Yao, C. Calcineurin in development and disease. Genes Dis. 2022, 9, 915–927. [Google Scholar] [CrossRef]
  10. Sakaue, S.; Kanai, M.; Tanigawa, Y.; Karjalainen, J.; Kurki, M.; Koshiba, S.; Narita, A.; Konuma, T.; Yamamoto, K.; Akiyama, M.; et al. A cross-population atlas of genetic associations for 220 human phenotypes. Nat. Genet. 2021, 53, 1415–1424. [Google Scholar] [CrossRef]
  11. Surendran, P.; Feofanova, E.V.; Lahrouchi, N.; Ntalla, I.; Karthikeyan, S.; Cook, J.; Chen, L.; Mifsud, B.; Yao, C.; Kraja, A.T.; et al. Discovery of rare variants associated with blood pressure regulation through meta-analysis of 1.3 million individuals. Nat. Genet. 2020, 52, 1314–1332. [Google Scholar] [CrossRef]
  12. Plotnikov, D.; Huang, Y.; Khawaja, A.P.; Foster, P.J.; Zhu, Z.; Guggenheim, J.A.; He, M. High Blood Pressure and Intraocular Pressure: A Mendelian Randomization Study. Investig. Ophthalmol. Vis. Sci. 2022, 63, 29. [Google Scholar] [CrossRef]
  13. Molkentin, J.D.; Lu, J.R.; Antos, C.L.; Markham, B.; Richardson, J.; Robbins, J.; Grant, S.R.; Olson, E.N. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 1998, 93, 215–228. [Google Scholar] [CrossRef]
  14. Bueno, O.F.; Wilkins, B.J.; Tymitz, K.M.; Glascock, B.J.; Kimball, T.F.; Lorenz, J.N.; Molkentin, J.D. Impaired cardiac hypertrophic response in Calcineurin Abeta -deficient mice. Proc. Natl. Acad. Sci. USA 2002, 99, 4586–4591. [Google Scholar] [CrossRef]
  15. Felkin, L.E.; Narita, T.; Germack, R.; Shintani, Y.; Takahashi, K.; Sarathchandra, P.; López-Olañeta, M.M.; Gómez-Salinero, J.M.; Suzuki, K.; Barton, P.J.; et al. Calcineurin splicing variant calcineurin Aβ1 improves cardiac function after myocardial infarction without inducing hypertrophy. Circulation 2011, 123, 2838–2847. [Google Scholar] [CrossRef]
  16. Kichaev, G.; Bhatia, G.; Loh, P.R.; Gazal, S.; Burch, K.; Freund, M.K.; Schoech, A.; Pasaniuc, B.; Price, A.L. Leveraging Polygenic Functional Enrichment to Improve GWAS Power. Am. J. Human Genet. 2019, 104, 65–75. [Google Scholar] [CrossRef]
  17. Giri, A.; Hellwege, J.N.; Keaton, J.M.; Park, J.; Qiu, C.; Warren, H.R.; Torstenson, E.S.; Kovesdy, C.P.; Sun, Y.V.; Wilson, O.D.; et al. Trans-ethnic association study of blood pressure determinants in over 750,000 individuals. Nat. Genet. 2019, 51, 51–62. [Google Scholar] [CrossRef]
  18. Maillet, M.; Davis, J.; Auger-Messier, M.; York, A.; Osinska, H.; Piquereau, J.; Lorenz, J.N.; Robbins, J.; Ventura-Clapier, R.; Molkentin, J.D. Heart-specific deletion of CnB1 reveals multiple mechanisms whereby calcineurin regulates cardiac growth and function. J. Biol. Chem. 2010, 285, 6716–6724. [Google Scholar] [CrossRef]
  19. Schaeffer, P.J.; Desantiago, J.; Yang, J.; Flagg, T.P.; Kovacs, A.; Weinheimer, C.J.; Courtois, M.; Leone, T.C.; Nichols, C.G.; Bers, D.M.; et al. Impaired contractile function and calcium handling in hearts of cardiac-specific calcineurin b1-deficient mice. Am. J. Physiol. Heart Circ. Physiol. 2009, 297, H1263–H1273. [Google Scholar] [CrossRef]
  20. Parra, V.; Rothermel, B.A. Calcineurin signaling in the heart: The importance of time and place. J. Mol. Cell Cardiol. 2017, 103, 121–136. [Google Scholar] [CrossRef]
  21. Tang, W.; Arnett, D.K.; Devereux, R.B.; Panagiotou, D.; Province, M.A.; Miller, M.B.; de Simone, G.; Gu, C.; Ferrell, R.E. Identification of a novel 5-base pair deletion in calcineurin B (PPP3R1) promoter region and its association with left ventricular hypertrophy. Am. Heart J. 2005, 150, 845–851. [Google Scholar] [CrossRef] [PubMed]
  22. Ahmetov, I.I.; Linde, E.V.; Popov, D.V.; Shihova, J.V.; Missina, S.S.; Vinogradova, O.L.; Rogozkin, V.A. The influence of calcineurin gene polymorphism on morphofunctional characteristics of cardiovascular system of athletes. Rus. J. Physiol. 2008, 94, 915–922. [Google Scholar]
  23. Mosteller, R.D. Simplified calculation of body-surface area. N. Engl. J. Med. 1987, 317, 1098. [Google Scholar] [PubMed]
  24. Huwez, F.U.; Houston, A.B.; Watson, J.; McLaughlin, S.; Macfarlane, P.W. Age and body surface area related normal upper and lower limits of M mode echocardiographic measurements and left ventricular volume and mass from infancy to early adulthood. Br. Heart J. 1994, 72, 276–280. [Google Scholar] [CrossRef]
  25. Gorący, I.; Gorący, J.; Skonieczna-Żydecka, K.; Kaczmarczyk, M.; Dawid, G.; Ciechanowicz, A. Association of genetic variation in calmodulin and left ventricular mass in full-term newborns. Int. J. Genom. 2013, 2013, 410407. [Google Scholar] [CrossRef]
  26. Han, T.; Wang, X.; Cui, Y.; Ye, H.; Tong, X.; Piao, M. Relationship between angiotensin-converting enzyme gene insertion or deletion polymorphism and insulin sensitivity in healthy newborns. Pediatrics 2007, 19, 1089–1094. [Google Scholar] [CrossRef]
  27. Gorący, I.; Safranow, K.; Dawid, G.; Skonieczna-Żydecka, K.; Kaczmarczyk, M.; Gorący, J.; Loniewska, B.; Ciechanowicz, A. Common genetic variants of the BMP4, BMPR1A, BMPR1B, and ACVR1 genes, left ventricular mass, and other parameters of the heart in newborns. Genet. Test. Mol. Biomark. 2012, 16, 1309–1316. [Google Scholar] [CrossRef]
  28. Gorący, I.; Dawid, G.; Łoniewska, B.; Gorący, J.; Ciechanowicz, A. Genetics of the renin-angiotensin system with respect to cardiac and blood pressure phenotypes in healthy newborn infants. J. Renin Angiotensin Aldosterone Syst. 2013, 14, 337–347. [Google Scholar] [CrossRef]
  29. Gorący, I.; Dawid, G.; Skonieczna-Żydecka, K.; Kaczmarczyk, M.; Łoniewska, B.; Gorący, J. Association of genetic variation in the natriuretic peptide system and left ventricular mass and blood pressure in newborns. Kardiol. Pol. 2015, 73, 366–372. [Google Scholar] [CrossRef]
  30. Ploski, R.; Wozniak, M.; Pawlowski, R.; Monies, D.M.; Branicki, W.; Kupiec, T.; Kloosterman, A.; Dobosz, T.; Bosch, E.; Nowak, M.; et al. Homogeneity and distinctiveness of Polish paternal lineages revealed by Y chromosome microsatellite haplotype analysis. Human Genet. 2002, 110, 592–600. [Google Scholar] [CrossRef]
  31. Kayser, M.; Lao, O.; Anslinger, K.; Augustin, C.; Bargel, G.; Edelmann, J.; Elias, S.; Heinrich, M.; Henke, J.; Henke, L.; et al. Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis. Human Genet. 2005, 117, 428–443. [Google Scholar] [CrossRef]
  32. Debniak, T.; Scott, R.J.; Huzarski, T.; Byrski, T.; Rozmiarek, A.; Debniak, B.; Załuga, E.; Maleszka, R.; Kładny, J.; Górski, B.; et al. CDKN2A common variants and their association with melanoma risk: A population-based study. Cancer Res. 2005, 65, 835–839. [Google Scholar] [CrossRef]
  33. Adler, G.; Łoniewska, B.; Parczewski, M.; Kordek, A.; Ciechanowicz, A. Frequency of common CYP3A5 gene variants in healthy Polish newborn infants. Pharmacol. Rep. 2009, 61, 947–951. [Google Scholar] [CrossRef]
  34. Hand, B.D.; Kostek, M.C.; Ferrell, R.E.; Delmonico, M.J.; Douglass, L.W.; Roth, S.M.; Hagberg, J.M.; Hurley, B.F. Influence of promoter region variants of insulin-like growth factor pathway genes on the strength-training response of muscle phenotypes in older adults. J. Appl. Physiol. 2007, 103, 1678–1687. [Google Scholar] [CrossRef]
  35. Pitoulis, F.G.; Terracciano, C.M. Heart Plasticity in Response to Pressure- and Volume-Overload: A Review of Findings in Compensated and Decompensated Phenotypes. Front. Physiol. 2020, 11, 92. [Google Scholar] [CrossRef]
  36. Ritchie, J.A.; Ng, J.Q.; Kemi, O.J. When one says yes and the other says no; does calcineurin participate in physiologic cardiac hypertrophy? Adv. Physiol. Educ. 2022, 46, 84–95. [Google Scholar] [CrossRef]
  37. Bär, H.; Kreuzer, J.; Cojoc, A.; Jahn, L. Upregulation of embryonic transcription factors in right ventricular hypertrophy. Basic Res. Cardiol. 2003, 98, 285–294. [Google Scholar] [CrossRef]
  38. Nishida, W.; Nakamura, M.; Mori, S.; Takahashi, M.; Ohkawa, Y.; Tadokoro, S.; Yoshida, K.; Hiwada, K.; Hayashi, K.; Sobue, K. A triad of serum response factor and the GATA and NK families governs the transcription of smooth and cardiac muscle genes. J. Biol. Chem. 2002, 277, 7308–7317. [Google Scholar] [CrossRef]
  39. Schott, J.J.; Benson, D.W.; Basson, C.T.; Pease, W.; Silberbach, G.M.; Moak, J.P.; Maron, B.J.; Seidman, C.E.; Seidman, J.G. Congenital heart disease caused by mutations in the transcription factor NKX2-5. Science 1998, 281, 108–111. [Google Scholar] [CrossRef]
  40. Benson, D.W.; Silberbach, G.M.; Kavanaugh-McHugh, A.; Cottrill, C.; Zhang, Y.; Riggs, S.; Smalls, O.; Johnson, M.C.; Watson, M.S.; Seidman, J.G.; et al. Mutations in the cardiac transcription factor NKX2.5 affect diverse cardiac developmental pathways. J. Clin. Investig. 1999, 104, 1567–1573. [Google Scholar] [CrossRef]
  41. Cunningham, F.; Allen, J.E.; Allen, J.; Alvarez-Jarreta, J.; Amode, M.R.; Armean, I.M.; Austine-Orimoloye, O.; Azov, A.G.; Barnes, I.; Bennett, R.; et al. Ensembl 2022. Nucleic Acids Res. 2022, 50, D988–D995. [Google Scholar] [CrossRef] [PubMed]
  42. Alsheikh, A.J.; Wollenhaupt, S.; King, E.A.; Reeb, J.; Ghosh, S.; Stolzenburg, L.R.; Tamim, S.; Lazar, J.; Davis, J.W.; Jacob, H.J. The landscape of GWAS validation; systematic review identifying 309 validated non-coding variants across 130 human diseases. BMC Med. Genom. 2022, 15, 74. [Google Scholar] [CrossRef] [PubMed]
Biomedicines 11 01415 g001 550
Figure 1. Genetic annotation of PPP3R1 (for full details, see Ensembl: ENSG00000221823). Showing transcript relationships including a promoter region. The location of the rs3039851 insertion/deletion is shown by the thick vertical black line in the first intron (PPP3R1 is reverse strand, so this and the promoter are on the right-hand side). Source of image: modified from Ensembl version 109 [41].
Figure 1. Genetic annotation of PPP3R1 (for full details, see Ensembl: ENSG00000221823). Showing transcript relationships including a promoter region. The location of the rs3039851 insertion/deletion is shown by the thick vertical black line in the first intron (PPP3R1 is reverse strand, so this and the promoter are on the right-hand side). Source of image: modified from Ensembl version 109 [41].
Biomedicines 11 01415 g001
Table
Table 1. Calcineurin-subunit-dependent cardiovascular phenotypes, based on mouse homologs.
Table 1. Calcineurin-subunit-dependent cardiovascular phenotypes, based on mouse homologs.
Calcineurin Subunit Abbreviation
(Recommended Name: Human)
UNIPROT References: Human/Mouse		Human Gene
(locus)
Mouse Homolog		Cardiovascular Phenotypes [Reference]
CnAα
(Protein phosphatase 3 catalytic subunit alpha)
Q08209/P63328		PPP3CA
(4: 101,023,409–101,348,278)
Ppp3ca		Association of rs3017892, rs1441433, rs12116679 and rs1527351 with blood pressure [10,11,12].
Cardiac hypertrophy and development of heart failure within the first few weeks of age in transgenic mice overexpressing a constitutively active form of CnAα [13].
CnAβ
(Serine/threonine-protein phosphatase 2B catalytic subunit beta isoform)
P16298/P48453		PPP3CB
(10: 73,436,433–73,496,024)
Ppp3cb		Association of 12,644 with systolic blood pressure [11].
A 80% decrease in calcineurin enzymatic activity associated with a 12% reduction in basal heart size in CnAβ-deficient mice [14].
No induction of cardiac hypertrophy but improvement of cardiac function and reduction of scar formation after myocardial infarction in transgenic mice with overexpression of CnAβ1 isoform (splicing variant of CnAβ gene with unique C-terminal region) in postnatal cardiomyocytes [15].
CnAγ
(Serine/threonine-protein phosphatase 2B catalytic subunit gamma isoform)
P48454/P48455		PPP3CC
(8: 22,440,819–22,541,142)
Ppp3cc		Association of 73,227,871 with SBP [16].
CnB1
(Calcineurin subunit B type 1)
P63098/Q63810		PPP3R1
(2: 68,178,857–68,256,237)
Ppp3r1		Association of rs6731373 with SBP and with pulse pressure [17].
Lethality at 1 day after birth due to altered right ventricular morphogenesis, reduced ventricular trabeculation, septal defects and valvular overgrowth in mice with the cardiomyocyte-specific deletion of CnB1 in embryonic development. Lethality in early mid adulthood with reduction in cardiac contractility, severe arrhythmia and reduced cardiomyocyte content in mice with postnatal-deletion of CnB1 [18].
Lethal cardiomyopathy, partially characterized by impairment of postnatal growth of cardiac-specific CnB1-deficient mice [19].
CnB2
(Protein phosphatase 3 regulatory subunit B, beta)		PPP3R2
(9: 101,591,604–101,595,021)
Ppp3r2		No data.
Table
Table 2. Clinical and echocardiographic characteristics of the newborns with regard to sex.
Table 2. Clinical and echocardiographic characteristics of the newborns with regard to sex.
VariableFemale Newborns (n = 71)Male Newborns (n = 91)p
Median (Minimum–Maximum)
BM [kg]3.32 (2.64–4.30)3.56 (2.65–5.09)0.014
BL [m]0.55 (0.51–0.63)0.56 (0.47–0.63)0.311
BSA [m2]0.230 (0.195–0.270)0.234 (0.199–0.289)0.037
IVST [mm]3.9 (2.4–6.3)3.7 (2.4–5.1)0.139
LVPWT [mm]2.7 (1.1–5.8)2.8 (2.0–4.0)0.307
LVID [mm]18.3 (16.0–25.0)18.1 (15.0–23.2)0.402
LVM [g]9.4 (4.9–21.9)9.7 (5.4–17.6)0.552
LVM/BM [g/kg]2.8 (1.5–6.4)2.9 (1.8–5.6)0.962
LVM/BL [g/m]16.8 (9.0–35.9)17.8 (10.0–32.1)0.790
LVM/BSA [g/m2]53.3 (29.0–116.0)55.9 (34.5–106.3)0.869
Legend: BM = Body Mass; BL = Body Length; BSA = Body Surface Area; IVST = Interventricular Septal Thickness; LVPWT = Left Ventricular Posterior Wall Thickness; LVID = Left Ventricular Internal Dimension, LVM = Left Ventricular Mass. p values are from Mann–Whitney tests.
Table
Table 3. Clinical and echocardiographic characteristics of the newborns in regard to PPP3R1 genotype (5I/5I or 5I/5D + 5D/5D).
Table 3. Clinical and echocardiographic characteristics of the newborns in regard to PPP3R1 genotype (5I/5I or 5I/5D + 5D/5D).
Variable5I/5I (n = 135)5I/5D + 5D/5D (n = 26 + 1)p
Median, Minimum–Maximum
BM [kg]3.37, 2.64–4.483.47, 2.84–5.090.432
BL [m]0.56, 0.47–0.630.56, 0.50–0.600.572
BSA [m2]0.230, 0.195–0.2760.232, 0.203–0.2890.643
IVST [mm]3.8, 2.4–6.13.8, 2.8–6.30.955
LVPWT [mm]2.8, 1.1–5.83.0, 1.6–5.00.317
LVID [mm]18.4, 15.0–25.018.1, 15.0–22.00.579
LVM [g]9.7, 4.9–21.99.4, 6.0–19.50.946
LVM/BM [g/kg]2.8, 1.5–6.43.0, 1.9–5.20.590
LVM/BL [g/m]17.4, 9.0–35.918.3, 11.0–33.30.794
LVM/BSA [g/m2]42.0, 22.3–90.644.7, 27.9–78.80.650
Legend: For abbreviations see Table 1. p values are from Mann–Whitney tests.
Table
Table 4. Frequency distributions of PPP3R1 genotypes (5I/5I or 5I/5D + 5D/5D) in newborns with regard to left ventricular mass indices.
Table 4. Frequency distributions of PPP3R1 genotypes (5I/5I or 5I/5D + 5D/5D) in newborns with regard to left ventricular mass indices.
VariableMedianGroup5I/5I
n (%)		5I/5D + 5D/5D
n (%)		p
<2.868 (83.9)13 (16.1)
LVM/BM [g/kg]2.8 0.833
>2.867 (82.7)14 (17.3)
<17.569 (85.2)12 (14.8)
LVM/BL [g/m]17.5 0.527
>17.566 (81.5)15 (18.5)
<42.268 (83.9)13 (16.1)
LVM/BSA [g/m2]42.2 0.833
>42.267 (82.7)14 (17.3)
Legend: For abbreviations see Table 1. p values are from chi-squared tests.
Table
Table 5. Frequency distributions of PPP3R1 genotypes (5I/5I or 5I/5D + 5D/5D) in newborns from lower or upper tertiles of left ventricular mass indices.
Table 5. Frequency distributions of PPP3R1 genotypes (5I/5I or 5I/5D + 5D/5D) in newborns from lower or upper tertiles of left ventricular mass indices.
VariableTertile5I/5I
n (%)		5I/5D + 5D/5D
n (%)		p
Lower: ≤2.649 (90.7)5 (9.3)
LVM/BM [g/kg] 0.007
Upper: ≥3.138 (70.4)16 (29.6)
Lower: ≤15.547 (87.0)7 (13.0)
LVM/BL [g/m] 0.056
Upper: ≥19.439 (72.2)15 (27.8)
Lower: ≤38.448 (88.9)6 (11.1)
LVM/BSA [g/m2] 0.029
Upper: ≥45.839 (72.2)15 (27.8)
Legend: For abbreviations see Table 1. p values are from chi-squared tests.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gorący, I.; Łoniewska, B.; Lewandowska, K.; Boroń, A.; Grzegorczyk, M.; Nowak, R.; Clark, J.S.C.; Ciechanowicz, A. Association of the rs3039851 Insertion/Deletion in the Gene PPP3R1, Which Encodes the Regulatory Calcineurin Subunit B Type 1, with Left Ventricular Mass in Polish Full-Term Newborns. Biomedicines 2023, 11, 1415. https://doi.org/10.3390/biomedicines11051415

AMA Style

Gorący I, Łoniewska B, Lewandowska K, Boroń A, Grzegorczyk M, Nowak R, Clark JSC, Ciechanowicz A. Association of the rs3039851 Insertion/Deletion in the Gene PPP3R1, Which Encodes the Regulatory Calcineurin Subunit B Type 1, with Left Ventricular Mass in Polish Full-Term Newborns. Biomedicines. 2023; 11(5):1415. https://doi.org/10.3390/biomedicines11051415

Chicago/Turabian Style

Gorący, Iwona, Beata Łoniewska, Klaudyna Lewandowska, Agnieszka Boroń, Małgorzata Grzegorczyk, Robert Nowak, Jeremy Simon C. Clark, and Andrzej Ciechanowicz. 2023. "Association of the rs3039851 Insertion/Deletion in the Gene PPP3R1, Which Encodes the Regulatory Calcineurin Subunit B Type 1, with Left Ventricular Mass in Polish Full-Term Newborns" Biomedicines 11, no. 5: 1415. https://doi.org/10.3390/biomedicines11051415

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop