Characterization of microRNA Levels in Synovial Fluid from Knee Osteoarthritis and Anterior Cruciate Ligament Tears
Abstract
:1. Introduction
2. Materials and Methods
2.1. Subjects
2.2. Samples
2.3. The microRNA Extraction, cDNA Synthesis of microRNA, and Real-Time PCR
2.4. Statistical Analysis
3. Results
3.1. Expression of microRNA
3.2. Expression of microRNA in Knee OA Group and ACL Tears Group
3.3. Gender Influence on microRNA Expression
3.4. Duration of the Disease Influence on microRNAs Expression
3.5. Correlation between microRNAs
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Haq, S.A.; Davatchi, F. Osteoarthritis of the Knees in the COPCORD World. Int. J. Rheum. Dis. 2011, 14, 122–129. [Google Scholar] [CrossRef] [PubMed]
- Rezuş, E.; Burlui, A.; Cardoneanu, A.; Macovei, L.A.; Tamba, B.I.; Rezuş, C. From Pathogenesis to Therapy in Knee Osteoarthritis: Bench-to-Bedside. Int. J. Mol. Sci. 2021, 22, 2697. [Google Scholar] [CrossRef] [PubMed]
- Friel, N.A.; Chu, C.R. The Role of ACL Injury in the Development of Posttraumatic Knee Osteoarthritis. Clin. Sports Med. 2013, 32, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Lohmander, L.S.; Ostenberg, A.; Englund, M.; Roos, H. High Prevalence of Knee Osteoarthritis, Pain, and Functional Limitations in Female Soccer Players Twelve Years after Anterior Cruciate Ligament Injury. Arthritis Rheum. 2004, 50, 3145–3152. [Google Scholar] [CrossRef]
- Papaioannou, G.; Inloes, J.B.; Nakamura, Y.; Paltrinieri, E.; Kobayashi, T. Let-7 and MiR-140 MicroRNAs Coordinately Regulate Skeletal Development. Proc. Natl. Acad. Sci. USA 2013, 110, E3291–E3300. [Google Scholar] [CrossRef] [Green Version]
- Musahl, V.; Karlsson, J. Anterior Cruciate Ligament Tear. N. Engl. J. Med. 2019, 380, 2341–2348. [Google Scholar] [CrossRef]
- Schilaty, N.D.; Martin, R.K.; Ueno, R.; Rigamonti, L.; Bates, N.A. Mechanics of Cadaveric Anterior Cruciate Ligament Reconstructions during Simulated Jump Landing Tasks: Lessons Learned from a Pilot Investigation. Clin. Biomech. 2021, 86, 105372. [Google Scholar] [CrossRef]
- Turati, M.; Maggioni, D.; Zanchi, N.; Gandolla, M.; Gorla, M.; Sacerdote, P.; Franchi, S.; Rizzi, L.; Pedrocchi, A.; Omeljaniuk, R.J.; et al. Characterization of Synovial Cytokine Patterns in Bucket-Handle and Posterior Horn Meniscal Tears. Mediat. Inflamm. 2020, 2020, 5071934. [Google Scholar] [CrossRef]
- Bigoni, M.; Turati, M.; Zatti, G.; Gandolla, M.; Sacerdote, P.; Piatti, M.; Castelnuovo, A.; Rigamonti, L.; Munegato, D.; Franchi, S.; et al. Intra-Articular Cytokine Levels in Adolescent Patients after Anterior Cruciate Ligament Tear. Mediat. Inflamm. 2018, 2018, 4210593. [Google Scholar] [CrossRef]
- Bigoni, M.; Zanchi, N.; Omeljaniuk, R.J.; Zatti, G.; Locatelli, V.; Torsello, A.; Turati, M. Role of Interleukin-10 in the Synovial Fluid of the Anterior Cruciate Ligament Injured Knee. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 932–940. [Google Scholar] [CrossRef]
- Bigoni, M.; Zanchi, N.; Turati, M. Healing Potential and Surgical Treatment of Anterior Cruciate Ligament Rupture in Pediatric Population. Sport Sci. Health 2017, 13, 645–646. [Google Scholar] [CrossRef]
- Alonso, B.; Bravo, B.; Mediavilla, L.; Gortazar, A.R.; Forriol, F.; Vaquero, J.; Guisasola, M.C. Osteoarthritis-Related Biomarkers Profile in Chronic Anterior Cruciate Ligament Injured Knee. Knee 2020, 27, 51–60. [Google Scholar] [CrossRef] [PubMed]
- Jones, S.W.; Watkins, G.; Le Good, N.; Roberts, S.; Murphy, C.L.; Brockbank, S.M.V.; Needham, M.R.C.; Read, S.J.; Newham, P. The Identification of Differentially Expressed MicroRNA in Osteoarthritic Tissue That Modulate the Production of TNF-Alpha and MMP13. Osteoarthr. Cartil. 2009, 17, 464–472. [Google Scholar] [CrossRef] [Green Version]
- Beyer, C.; Zampetaki, A.; Lin, N.-Y.; Kleyer, A.; Perricone, C.; Iagnocco, A.; Distler, A.; Langley, S.R.; Gelse, K.; Sesselmann, S.; et al. Signature of Circulating MicroRNAs in Osteoarthritis. Ann. Rheum. Dis. 2015, 74, e18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carbone, A.; Rodeo, S. Review of Current Understanding of Post-Traumatic Osteoarthritis Resulting from Sports Injuries. J. Orthop. Res. 2017, 35, 397–405. [Google Scholar] [CrossRef] [Green Version]
- Kellgren, J.H.; Lawrence, J.S. Radiological Assessment of Osteo-Arthrosis. Ann. Rheum. Dis. 1957, 16, 494–502. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sawyer, S.M.; Azzopardi, P.S.; Wickremarathne, D.; Patton, G.C. The Age of Adolescence. Lancet Child Adolesc. Health 2018, 2, 223–228. [Google Scholar] [CrossRef]
- Nakamura, Y.; Inloes, J.B.; Katagiri, T.; Kobayashi, T. Chondrocyte-Specific MicroRNA-140 Regulates Endochondral Bone Development and Targets Dnpep to Modulate Bone Morphogenetic Protein Signaling. Mol. Cell. Biol. 2011, 31, 3019–3028. [Google Scholar] [CrossRef] [Green Version]
- Nakamura, Y.; He, X.; Kato, H.; Wakitani, S.; Kobayashi, T.; Watanabe, S.; Iida, A.; Tahara, H.; Warman, M.L.; Watanapokasin, R.; et al. Sox9 Is Upstream of MicroRNA-140 in Cartilage. Appl. Biochem. Biotechnol. 2012, 166, 64–71. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Li, H.; Tanaka, K.; Tsumaki, N.; Yamada, Y. Identification of an Enhancer Sequence within the First Intron Required for Cartilage-Specific Transcription of the Alpha2(XI) Collagen Gene. J. Biol. Chem. 2000, 275, 12712–12718. [Google Scholar] [CrossRef]
- Miyaki, S.; Sato, T.; Inoue, A.; Otsuki, S.; Ito, Y.; Yokoyama, S.; Kato, Y.; Takemoto, F.; Nakasa, T.; Yamashita, S.; et al. MicroRNA-140 Plays Dual Roles in Both Cartilage Development and Homeostasis. Genes Dev. 2010, 24, 1173–1185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, W.; Su, W.; Xia, H.; Wang, Z.; Su, C.; Su, B. Synovial Fluid MicroRNA-210 as a Potential Biomarker for Early Prediction of Osteoarthritis. Biomed. Res. Int. 2019, 2019, 7165406. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.-H.; Tavallaee, G.; Tokar, T.; Nakamura, A.; Sundararajan, K.; Weston, A.; Sharma, A.; Mahomed, N.N.; Gandhi, R.; Jurisica, I.; et al. Identification of Synovial Fluid MicroRNA Signature in Knee Osteoarthritis: Differentiating Early- and Late-Stage Knee Osteoarthritis. Osteoarthr. Cartil. 2016, 24, 1577–1586. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rasheed, Z.; Al-Shobaili, H.A.; Rasheed, N.; Mahmood, A.; Khan, M.I. MicroRNA-26a-5p Regulates the Expression of Inducible Nitric Oxide Synthase via Activation of NF-ΚB Pathway in Human Osteoarthritis Chondrocytes. Arch. Biochem. Biophys. 2016, 594, 61–67. [Google Scholar] [CrossRef] [PubMed]
- Luzi, E.; Marini, F.; Sala, S.C.; Tognarini, I.; Galli, G.; Brandi, M.L. Osteogenic Differentiation of Human Adipose Tissue-Derived Stem Cells Is Modulated by the MiR-26a Targeting of the SMAD1 Transcription Factor. J. Bone Miner. Res. 2008, 23, 287–295. [Google Scholar] [CrossRef]
- Deniaud, E.; Baguet, J.; Chalard, R.; Blanquier, B.; Brinza, L.; Meunier, J.; Michallet, M.-C.; Laugraud, A.; Ah-Soon, C.; Wierinckx, A.; et al. Overexpression of Transcription Factor Sp1 Leads to Gene Expression Perturbations and Cell Cycle Inhibition. PLoS ONE 2009, 4, e7035. [Google Scholar] [CrossRef]
- Li, L.; Yang, C.; Liu, X.; Yang, S.; Ye, S.; Jia, J.; Liu, W.; Zhang, Y. Elevated Expression of MicroRNA-30b in Osteoarthritis and Its Role in ERG Regulation of Chondrocyte. Biomed. Pharmacother. 2015, 76, 94–99. [Google Scholar] [CrossRef]
- Mizuno, Y.; Tokuzawa, Y.; Ninomiya, Y.; Yagi, K.; Yatsuka-Kanesaki, Y.; Suda, T.; Fukuda, T.; Katagiri, T.; Kondoh, Y.; Amemiya, T.; et al. MiR-210 Promotes Osteoblastic Differentiation through Inhibition of AcvR1b. FEBS Lett. 2009, 583, 2263–2268. [Google Scholar] [CrossRef] [Green Version]
- Yin, X.; Wang, J.-Q.; Yan, S.-Y. Reduced MiR-26a and MiR-26b Expression Contributes to the Pathogenesis of Osteoarthritis via the Promotion of P65 Translocation. Mol. Med. Rep. 2017, 15, 551–558. [Google Scholar] [CrossRef] [Green Version]
- Hu, J.; Wang, Z.; Pan, Y.; Ma, J.; Miao, X.; Qi, X.; Zhou, H.; Jia, L. MiR-26a and MiR-26b Mediate Osteoarthritis Progression by Targeting FUT4 via NF-ΚB Signaling Pathway. Int. J. Biochem. Cell Biol. 2018, 94, 79–88. [Google Scholar] [CrossRef]
- Zhao, Z.; Dai, X.-S.; Wang, Z.-Y.; Bao, Z.-Q.; Guan, J.-Z. MicroRNA-26a Reduces Synovial Inflammation and Cartilage Injury in Osteoarthritis of Knee Joints through Impairing the NF-ΚB Signaling Pathway. Biosci. Rep. 2019, 39, BSR20182025. [Google Scholar] [CrossRef] [Green Version]
- Turati, M.; Boerci, L.; Piatti, M.; Zanchi, N.; Zatti, G.; Accadbled, F.; Bigoni, M. What’s New about Etiopathogenesis of Musculoskeletal Injuries in Adolescent Athletes? Minerva Pediatr. 2020. [Google Scholar] [CrossRef]
- Magee, C.; Nurminskaya, M.; Faverman, L.; Galera, P.; Linsenmayer, T.F. SP3/SP1 Transcription Activity Regulates Specific Expression of Collagen Type X in Hypertrophic Chondrocytes. J. Biol. Chem. 2005, 280, 25331–25338. [Google Scholar] [CrossRef] [Green Version]
- Willard, K.; Mannion, S.; Saunders, C.J.; Collins, M.; September, A.V. The Interaction of Polymorphisms in Extracellular Matrix Genes and Underlying MiRNA Motifs That Modulate Susceptibility to Anterior Cruciate Ligament Rupture. J. Sci. Med. Sport 2018, 21, 22–28. [Google Scholar] [CrossRef] [PubMed]
- Si, H.; Liang, M.; Cheng, J.; Shen, B. Effects of cartilage progenitor cells and microRNA-140 on repair of osteoarthritic cartilage injury. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi 2019, 33, 650–658. [Google Scholar] [CrossRef]
- Swingler, T.E.; Niu, L.; Smith, P.; Paddy, P.; Le, L.; Barter, M.J.; Young, D.A.; Clark, I.M. The Function of MicroRNAs in Cartilage and Osteoarthritis. Clin. Exp. Rheumatol. 2019, 37 (Suppl. 120), 40–47. [Google Scholar] [PubMed]
- Posthumus, M.; September, A.V.; O’Cuinneagain, D.; van der Merwe, W.; Schwellnus, M.P.; Collins, M. The COL5A1 Gene Is Associated with Increased Risk of Anterior Cruciate Ligament Ruptures in Female Participants. Am. J. Sports Med. 2009, 37, 2234–2240. [Google Scholar] [CrossRef]
- Kolhe, R.; Hunter, M.; Liu, S.; Jadeja, R.N.; Pundkar, C.; Mondal, A.K.; Mendhe, B.; Drewry, M.; Rojiani, M.V.; Liu, Y.; et al. Gender-Specific Differential Expression of Exosomal MiRNA in Synovial Fluid of Patients with Osteoarthritis. Sci. Rep. 2017, 7, 2029. [Google Scholar] [CrossRef] [Green Version]
- Rousseau, J.-C.; Millet, M.; Croset, M.; Sornay-Rendu, E.; Borel, O.; Chapurlat, R. Association of Circulating MicroRNAs with Prevalent and Incident Knee Osteoarthritis in Women: The OFELY Study. Arthritis Res. Ther. 2020, 22, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turati, M.; Franchi, S.; Leone, G.; Piatti, M.; Zanchi, N.; Gandolla, M.; Rigamonti, L.; Sacerdote, P.; Rizzi, L.; Pedrocchi, A.; et al. Resolvin E1 and Cytokines Environment in Skeletally Immature and Adult ACL Tears. Front. Med. 2021, 8, 610866. [Google Scholar] [CrossRef]
- Asai, K.; Nakase, J.; Shimozaki, K.; Yoshimizu, R.; Kimura, M.; Tsuchiya, H. Skeletally Immature Patient Showed Lower Graft Maturity than Skeletally Mature Patient after ACL Reconstruction with a Rounded Rectangular Femoral Tunnel. Sci. Rep. 2021, 11, 19968. [Google Scholar] [CrossRef] [PubMed]
- Scheffler, S.U.; Unterhauser, F.N.; Weiler, A. Graft Remodeling and Ligamentization after Cruciate Ligament Reconstruction. Knee Surg. Sports Traumatol. Arthrosc. 2008, 16, 834–842. [Google Scholar] [CrossRef]
- Turati, M.; Rigamonti, L.; Zanchi, N.; Piatti, M.; Gaddi, D.; Gorla, M.; Omeljaniuk, R.J.; Courvoisier, A.; Bigoni, M. An Arthroscopic Repair Technique for Proximal Anterior Cruciate Tears in Children to Restore Active Function and Avoid Growth Disturbances. Knee Surg. Sports Traumatol. Arthrosc. 2021, 29, 3689–3696. [Google Scholar] [CrossRef] [PubMed]
- Gagliardi, A.G.; Carry, P.M.; Parikh, H.B.; Traver, J.L.; Howell, D.R.; Albright, J.C. ACL Repair with Suture Ligament Augmentation Is Associated with a High Failure Rate Among Adolescent Patients. Am. J. Sports Med. 2019, 47, 560–566. [Google Scholar] [CrossRef]
- Turati, M.; Rigamonti, L.; Giulivi, A.; Gaddi, D.; Accadbled, F.; Zanchi, N.; Bremond, N.; Catalano, M.; Gorla, M.; Omeljaniuk, R.J.; et al. Management of Anterior Cruciate Ligament Tears in Tanner Stage 1 and 2 Children: A Narrative Review and Treatment Algorithm Guided by ACL Tear Location. J. Sports Med. Phys. Fit. 2021. [Google Scholar] [CrossRef] [PubMed]
ACL | Gonarthosis | Total | ||
---|---|---|---|---|
Gender | male | 19 (11 adolescent) | 9 | 28 |
female | 11 (5 adolescent) | 9 | 20 | |
total | 30 | 18 | 48 | |
Age Median (IQR) | 18 (5.50) | 73 (11.0) | 28.5 (51.75) | |
Effusion | hydrarthrosis | 13 | 14 | 27 |
mild hemarthrosis | 2 | 1 | 3 | |
hemarthrosis | 15 | 3 | 18 | |
Timing | acute (0–2 days) | 6 (20%) | 0 (0%) | 6 (12.5%) |
early subacute (3–15 days) | 3 (10%) | 0 (0%) | 3 (6.25%) | |
late subacute (16–90 days) | 21 (70%) | 0 (0%) | 21 (43.75%) | |
chronic (>90 days) | 0 (0%) | 18 (100%) | 18 (37.5%) |
microRNA | Assay ID Number | Sequences |
---|---|---|
mirna 26a-5p | 477995_mir | UUCAAGUAAUCCAGGAUAGGCU |
mirna 27a-3p | 478384_mir | UUCACAGUGGCUAAGUUCCGC |
mirna let7a-5p | 478575_mir | UGAGGUAGUAGGUUGUAUAGUU |
mirna 140-5p | 477909_mir | CAGUGGUUUUACCCUAUGGUAG |
mirna 146-5p | 478513_mir | UGAGAACUGAAUUCCAUAGGCU |
mirna 155-5p | 483064_mir | UUAAUGCUAAUCGUGAUAGGGGUU |
mirna 16-5p | 477860_mir | UAGCAGCACGUAAAUAUUGGCG |
mirna 186-5p | 477940_mir | CAAAGAAUUCUCCUUUUGGGCU |
mirna 199a-3p | 477961_mir | ACAGUAGUCUGCACAUUGGUUA |
mirna 210-3p | 477970_mir | CUGUGCGUGUGACAGCGGCUGA |
mirna 205-5p | 477967_mir | UCCUUCAUUCCACCGGAGUCUG |
mirna 30b-5p | 478007_mir | UGUAAACAUCCUACACUCAGCU |
microRNA | Value = 0 (n) | Value > 0 (n) |
---|---|---|
mirna 26a-5p | 26 (54.2%) | 22 (45.8%) |
mirna 27a-3p | 39 (81.25%) | 9 (18.75%) |
mirna let7a-5p | 43 (89.6%) | 5 (10.4%) |
mirna 140-5p | 42 (87.5%) | 6 (12.5%) |
mirna 146-5p | 42 (87.5%) | 6 (12.5%) |
mirna 155-5p | 34 (70.8%) | 14 (29,2%) |
mirna 16-5p | 31 (64.6%) | 17 (35.4%) |
mirna 186-5p | 17 (35.4%) | 31 (64.6%) |
mirna 199a-3p | 45 (93.75%) | 3 (6.25%) |
mirna 210-3p | 43 (89.6%) | 5 (10.4%) |
mirna 205-5p | 43 (89.6%) | 5 (10.4%) |
mirna 30b-5p | 23 (47.9%) | 25 (52.1%) |
(A) | ||||
Mean (DS) | Median | Mean (DS) | Median | |
mirna 26a-5p | 3.04 (4.18) | 0.41 | 4.28 (8.09) | 0 |
mirna 27a-3p | 1.91 (5.28) | 0 | 5.60 (11.3) | 0 |
mirna let7a-5p | 1.27 (4.66) | 0 | 1.07 (3.38) | 0 |
mirna 140-5p | 0.62 (3.39) | 0 | 4.41 (8.59) | 0 |
mirna 146-5p | 1.69 (4.96) | 0 | 0.68 (2.43) | 0 |
mirna 155-5p | 1.92 (3.63) | 0 | 5.58 (9.35) | 0 |
mirna 16-5p | 2.55 (3.90) | 0 | 3.26 (5.42) | 0 |
mirna 186-5p | 5.69 (5.87) | 6.00 | 9.18 (7.11) | 9.47 |
mirna 199a-3p | 0.19 (0.82) | 0 | 0.47 (2.00) | 0 |
mirna 210-3p | 1.20 (6.57) | 0 | 3.87 (9.26) | 0 |
mirna 205-5p | 0.62 (2.01) | 0 | 3.19 (9.30) | 0 |
(B) | ||||
ACL (n = 30) | Gonarthrosis (n = 18) | |||
Value = 0 | Value > 0 | Value = 0 | Value > 0 | |
mirna 26a-5p | 15 (50%) | 15 (50%) | 11 (61.1%) | 7 (38.9%) |
mirna 27a-3p | 26 (86.7%) | 4 (13.3%) | 13 (72.2%) | 5 (27.8%) |
mirna let7a-5p | 27 (90%) | 3 (10%) | 16 (88.9%) | 2 (11.1%) |
mirna 140-5p | 29 (96.7%) | 1 (3.3%) | 13 (72.2%) | 5 (27.8%) |
mirna 146-5p | 26 (86.7%) | 4 (13.3%) | 16 (88.9%) | 2 (11.1%) |
mirna 155-5p | 23 (76.7%) | 7 (23.3%) | 11 (61.1%) | 7 (38.9%) |
mirna 16-5p | 19 (63.3%) | 11 (36.7%) | 12 (66.7%) | 6 (33.3%) |
mirna 186-5p | 13 (43.3%) | 17 (56.7%) | 4 (22.2%) | 14 (77.8%) |
mirna 199a-3p | 28 (93.3%) | 2 (6.7%) | 17 (94.5%) | 1 (5.5%) |
mirna 210-3p | 29 (96.7%) | 1 (3.3%) | 14 (77.8%) | 4 (22.2%) |
mirna 205-5p | 27 (90%) | 3 (10%) | 16 (88.9%) | 2 (11.1%) |
mirna 30b-5p | 17 (56.7%) | 13 (43.3%) | 6 (33.3%) | 12 (66.7%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rizzi, L.; Turati, M.; Bresciani, E.; Anghilieri, F.M.; Meanti, R.; Molteni, L.; Piatti, M.; Zanchi, N.; Coco, S.; Buonanotte, F.; et al. Characterization of microRNA Levels in Synovial Fluid from Knee Osteoarthritis and Anterior Cruciate Ligament Tears. Biomedicines 2022, 10, 2909. https://doi.org/10.3390/biomedicines10112909
Rizzi L, Turati M, Bresciani E, Anghilieri FM, Meanti R, Molteni L, Piatti M, Zanchi N, Coco S, Buonanotte F, et al. Characterization of microRNA Levels in Synovial Fluid from Knee Osteoarthritis and Anterior Cruciate Ligament Tears. Biomedicines. 2022; 10(11):2909. https://doi.org/10.3390/biomedicines10112909
Chicago/Turabian StyleRizzi, Laura, Marco Turati, Elena Bresciani, Filippo Maria Anghilieri, Ramona Meanti, Laura Molteni, Massimiliano Piatti, Nicolò Zanchi, Silvia Coco, Francesco Buonanotte, and et al. 2022. "Characterization of microRNA Levels in Synovial Fluid from Knee Osteoarthritis and Anterior Cruciate Ligament Tears" Biomedicines 10, no. 11: 2909. https://doi.org/10.3390/biomedicines10112909