Next Article in Journal
Radiation Interception, Conversion and Partitioning Efficiency in Potato Landraces: How Far Are We from the Optimum?
Next Article in Special Issue
Effects of Soil Fertilization on Terpenoids and Other Carbon-Based Secondary Metabolites in Rosmarinus officinalis Plants: A Comparative Study
Previous Article in Journal
Comparative Functional Analysis of Class II Potassium Transporters, SvHKT2;1, SvHKT2;2, and HvHKT2;1, on Ionic Transport and Salt Tolerance in Transgenic Arabidopsis
Previous Article in Special Issue
Identification and Molecular Characterization of Geranyl Diphosphate Synthase (GPPS) Genes in Wintersweet Flower
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 9
Issue 6
10.3390/plants9060785
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Cloning and Functional Characterization of CpMYC2 and CpBHLH13 Transcription Factors from Wintersweet (Chimonanthus praecox L.)

by
Muhammad Zeshan Aslam
1,
Xiang Lin
1,
Xiang Li
1,
Nan Yang
2 and
Longqing Chen
2,*
1
Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture and Forestry Science, Huazhong Agricultural University, Wuhan 430070, China
2
Southwest Research Centre for Engineering Technology of Landscape Architecture (State Forestry and Grassland Administration), Southwest Forestry University, Kunming 650224, China
*
Author to whom correspondence should be addressed.
Plants 2020, 9(6), 785; https://doi.org/10.3390/plants9060785
Submission received: 25 April 2020 / Revised: 17 June 2020 / Accepted: 19 June 2020 / Published: 23 June 2020
(This article belongs to the Special Issue Biosynthesis and Functions of Terpenoids in Plants)
Browse Figures
Versions Notes

Abstract

:
Wintersweet (Chimonanthus praecox L.) is an ornamental and economically significant shrub known for its unique flowering characteristics, especially the emission of abundant floral volatile organic compounds. Thus, an understanding of the molecular mechanism of the production of these compounds is necessary to create new breeds with high volatile production. In this study, two bHLH transcription factors (CpMYC2 and CpbHLH13) of Wintersweet H29 were functionally characterized to illustrate their possible role in the production of volatile compounds. The qRT-PCR results showed that the expression of CpMYC2 and CpbHLH13 increased from the flower budding to full bloom stage, indicating that these two genes may play an essential role in blooming and aroma production in wintersweet. Gas chromatography-mass spectroscopy (GC-MS) analysis revealed that the overexpression of CpMYC2 in arabidopsis (Arabidopsis thaliana) AtMYC2-2 mutant (Salk_083483) and tobacco (Nicotiana tabaccum) genotype Petit Havana SR1 significantly increased floral volatile monoterpene, especially linalool, while the overexpression of CpbHLH13 in Arabidopsis thaliana ecotype Columbia-0 (Col-0) and tobacco genotype SR1 increased floral sesquiterpene β-caryophyllene production in both types of transgenic plants respectively. High expression of terpene synthase (TPS) genes in transgenic A. thaliana along with high expression of CpMYC2 and CpbHLH13 in transgenic plants was also observed. The application of a combination of methyl jasmonic acid (MeJA) and gibberellic acid (GA3) showed an increment in linalool production in CpMYC2-overexpressing arabidopsis plants, and the high transcript level of TPS genes also suggested the involvement of CpMYC2 in the jasmonic acid (JA) signaling pathway. These results indicate that both the CpMYC2 and CpbHLH13 transcription factors of wintersweet are possibly involved in the positive regulation and biosynthesis of monoterpene (linalool) and sesquiterpene (β-caryophyllene) in transgenic plants. This study also indicates the potential application of wintersweet as a valuable genomic material for the genetic modification of floral scent in other flowering plants that produce less volatile compounds.

1. Introduction

Plants produce a flower aroma that plays a significant role in their economic value and aesthetic properties [1]. Each plant has its own unique floral aroma, consisting of volatile organic compounds, which are mainly derivatives of fatty acids, terpenoids, and phenylpropanoids or benzoids. Thus, an understanding of the mechanism associated with the formation of these floral aromas is necessary to create new breeds, mainly in plants that produce less volatile compounds [2,3]. Two independent and separate pathways, methylerythritol phosphate (MEP) and mevalonic acid (MVA), are responsible for the synthesis of terpenoids [3]. The MVA pathway is involved in the biosynthesis of sesquiterpenes, which accounts for 28% of all floral terpenoids. In contrast, the MEP pathway is mainly involved in the biosynthesis of monoterpene and diterpene, producing approximately 53% and 1% of the total floral terpenoids, respectively [4]. To date, many flower-specific terpene syntheses have been isolated and characterized, such as linalool in Arabidopsis thaliana, Osmanthus fragrans, Antirrhinum majus, Clarkia breweri, and Hedychium coronarium [4,5,6,7]; myrcene in Alstroemeria peruviana and A. majus [8]; 1,8-cineole in Nicotiana suaveolens, Citrus unshiu, and H. coronarium [9,10]; E-(β)-ocimine in A. majus and H. coronarium [11,12,13]; sesquiterpene α-farnesene in Actinidia deliciosa and H. coronarium [14,15]; germacrene D in Rosa hybrid, A. deliciosa, and Vitus vinifera [13,16]; nerolidol in A. chinensis and A. majus [17]; valence in V. vinifera [16]; β-ylangene, β-copaene, β-cubenen, and α-bergamotene in Cnangaodorata var. fruticose [18], and β-caryophyllene in A. thaliana, Ocimum kilimandscharicum, and Daucus carota [19,20,21]. However, the regulatory mechanisms and the biosynthesis of the floral aroma, especially in woody ornamental plants, are mostly undiscovered.
Jasmonates (JAs), biologically active intermediates involved in the production pathways of jasmonic acid, are associated with a series of biological processes [22] including the ripening of fruits, the production of viable pollen, the growth of roots, tendril coiling, plant responses against the abiotic stress, wounds, and defense against insect pests [23,24,25,26,27,28,29]. JAs are also released as volatile organic compounds (VOCs) and help as a communicator between plants in response to mutual dangers [30]. JAs induce the expression of terpene synthase genes, which results in the release of more terpenoides [31]. The upregulation of terpene synthase (TPS) genes is also related to the development of flowers in plants [32]. In this content, methyl jasmonic acid (MeJA) treatment increases the production of monoterpene (E)-β-ocimine and linalool in tobacco [33]. JAs treatment upregulates the transcription of TPS03 (At4g16740), encoding (E)-β-ocimine synthase in arabidopsis [34]. The MYC family members are basic transcription factors of helix-loop-helix (bHLH) that have numerous functions and are very important in the regulation mechanisms of plants. One of the members of this family, MYC2, has been found to show a significant role in various plant developmental mechanisms including cold stress, insect pest attack, salt stress, salinity, drought, response to light conditions, anthocyanin production, terpene synthesis, and different signaling pathways such as jasmonic acid (JA), gibberellins (GAs), abscisic aid (ABA), auxin (IAA), and salicylic acid (SA) [2,20,21,26,27,35]. MYC2 has also been reported as one of the major players in the crosstalk between JA and GA signaling. It also plays a role as a signal integrator of the JA and GA pathways and was shown to be a positive important regulator of the induction of JA and GA and the expression of terpene synthase genes in Arabidopsis [20].
Wintersweet (Chimonanthus praecox L.), belonging to the family Calycanthaceae, is a well-known ornamental and economically significant woody plant, commonly known as “Làméi” in China [36,37]. Due to its unique flowering time and strong, pleasant fragrance, it is considered one of the most popular and essential ornamental flowering plants in China [36,38]. Its flowers and natural essential oils have been widely used in traditional Chinese medicine, cosmetics, perfumes, and aromatherapy [39,40]. These traits, along with other characteristics of wintersweet flowers, including flower development, biosynthesis, and aromatic emission, aging, and resistance against biological and abiological stress, make it an important commercial plant [41]. Wintersweet blooms mainly in winter, with a strong fragrance. Therefore, the molecular mechanism of flower development is different from that of plants or species that bloom in spring [39,40,41,42]. Although some attempts have been made to illustrate the molecular processes associated with important floral properties such as senescence, color, and aroma have been extensively investigated in several flowering plants such as A. majus, Rosa gallica, O. fragrans Lour., and carnation [43], genomic information on wintersweet plants is still limited [44]. Thus, the identification and characterization of functional genes through transcriptome and genome sequencing is vital to uncover the molecular mechanism behind flower fragrance production in wintersweet. Here, we studied two bHLH transcription factors (CpMYC2 and CpbHLH13), selected from a transcriptomic library developed from the fully open flower developmental stage of the Wintersweet H29 (Huazhong 29) genotype. The main objectives of this study were molecular cloning and investigating the function of CpMYC2 and CpbHLH13. The effect of these bHLH genes on the production of plant floral volatiles was also evaluated.

2. Results

2.1. Characterization of CpMYC2 and bHLH13

Using the Illumina RNA-Seq technique, a transcriptomic library (NCBI Sequence Read Archive (SRA) accession number PRJNA492170) was constructed from the full open flower stage of the Wintersweet H29 cultivar (Figure 1), and out of 16 identified members of the bHLH family, the desired sequence of two transcription factors CpMYC2 (2858 bp) and bHLH13 (2425 bp) was selected for further study [45]. Based on the NCBI ORF finder, the open reading frame of 1884 bp and 1779 bp nucleotide, encoding 628 and 593 amino acids, were observed in CpMYC2 and CpbHLH13, respectively. The theoretical isoelectric point (pI) and the molecular weight (Mw) of the CpMYC2 and CpbHLH13 proteins were Pi/Mw: 5.65/68707.29 and Pi/Mw: 6.43/65502.53, respectively. Multiple sequence alignment of wintersweet CpMYC2 and CpbHLH13 proteins with their homologous protein sequences in other species, especially A. thaliana, Nicotiana tabacum, V. vinifera, Cinnamomum micranthum, Solanum lycopersicum, and Zea mays revealed the presence of a basic helix-loop-helix DNA-binding domain (446–493 amino acids for CpMYC2 and 429–476 amino acids for CpbHLH13) with an MYC-N terminal, which is a common feature of MYC family proteins (Figure 2 and Figure 3). The three-dimensional protein structure of CpMYC2 and CpbHLH13 is shown in Supplementary Figures S1 and S2. Phylogenetic analysis demonstrated that CpMYC2 was closely related to the transcription factor Arabidopsis MYC2 (AT1G32640), whereas CpbHLH13 was most homologous to AtbHLH13 (AT1G01260), also known as JASMONATE-ASSOCIATED MYC2-like2 (JAM2) (Supplementary Figures S3 and S4). Further phylogenetic analysis with different species revealed that CpMYC2 had a close relationship with the predicted protein of Cinnamomum micranthum (CmMYC2) with 65.13% identity and A. thaliana (AtMYC2) with 54%, while CpbHLH13 was mostly homologous to C. micranthum (CmbHLH13) with 69.77% identity followed by Nelumbo nucifera (NnMYC2) with 62.46% identity and A. thaliana AtbHLH13 with 42% identity, although they were not in the same clade. Phylogenetic analyses revealed that CpbHLH13 had a close relationship with the A. thaliana AtbHLH13/JAM2 (At1g01260) and AtbHLH17/JAM1 (At2g46510) transcription factors (See Supplementary Figures S5 and S6). A summary of the homology of wintersweet CpMYC2 and CpbHLH13 with identity% and functions of the genes from various plants is described in Table 1 and Table 2.

2.2. CpMYC2 and CpbHLH13 Expression in Wintersweet

To determine whether CpMYC2 and CpbHLH13 expression was correlated with VOC biosynthesis during wintersweet inflorescence, the expression profile of CpMYC2 and CpbHLH13 was analyzed in five developing stages of the flower of H29: flower bud (FB) stage, display petal (DP) stage, partially-open flower (POF) stage, open flower (OF) stage and senescing flower (SF) stage (Figure 1) using qRT-PCR. The results indicated that the expression levels of CpMYC2 and CpbHLH13 increased from the budding stage of the flower to the fully-open flower stage and then gradually decreased in the senescing stage (Figure 4a,b). We also measured the expression level of both the genes in different tissues of wintersweet and found that the expression level of these genes was highest in flowers, followed by leaves and stems, and lowest in fruits (Figure 4c,d). This indicates their importance and possible involvement in producing VOCs during blooming, also indicating that these two genes may play an important role in blooming and aroma production.

2.3. Expression Analysis of the Terpene Synthase Genes in Wild-Type and Transgenic Plants

Real-time PCR (qRT-PCR) was used to measure the expression of terpene synthase genes in wild-type and transgenic plants. The results indicate that the expression of the linalool-producing gene At1g61680 was about one and a half times higher in the plants transformed by CpMYC2 than the other plants, while wild-type Col-0 plants, the mutant Salk_083483, and mutant plants transformed by the empty vector pCAMBIA2300S (2300S-Sk83) also showed lower expression of the At3g25810 gene as compared to 35S::CpMYC2 plants (Figure 5a). Similarly, the expression of the β-caryophyllene-producing genes At5g23960 and At5g44630 was almost threefold higher in the plants transformed by the CpbHLH13 gene than the wild-type arabidopsis plants (Col-0) and the plants transformed by the vector pCAMBIA2300S (Figure 5b). The expression of the CpMYC2 and CpbHLH13 genes in transgenic tobacco and arabidopsis plants was also measured (Supplementary Figure S7) and the plants with almost identical expression were used for further experimentation.

2.4. Overexpression of CpMYC2 and CpbHLH13 Induces VOC Emission

The positively selected plants obtained from T3 generation were used to detect the terpenes from the inflorescence of transgenic arabidopsis and tobacco plants using GC-MS. We analyzed the emission of terpenes in arabidopsis and tobacco transgenic plants overexpressed with the CpMYC2 and CpbHLH13 gene. The results indicate that linalool was the most abundant monoterpene (Figure 6a,b) and its emission was more than 1.5 and 2 times higher in transgenic arabidopsis and tobacco plants transformed by the CpMYC2 gene (35S::CpMYC2), respectively, compared to the wild type (Col-0 and SR1) and transgenic plants transformed by the vector pCAMBIA2300S (Figure 7a,b). Similarly, it was found that β-caryophyllene was the most abundant sesquiterpene produced in arabidopsis and tobacco plants transformed by the CpbHLH13 gene (Figure 6c,d). GC-MS analysis of linalool and β-caryophyllene emitted from the flowers of transformed A. thaliana and tobacco plants is shown in Figure 7 and Figure 8. The results also indicate that the emission of β-caryophyllene was about twofold higher in the plants transformed by the CpbHLH13 gene than the transgenic plants transformed by the vector pCAMBIA2300S and wild-type tobacco SR1 (Figure 8a,b).

2.5. Application of MeJA and GA3 on Overexpressed CpMYC2 Plants

Following MeJA and gibberellic acid (GA3) treatment, terpenoids were detected in the inflorescence of transgenic arabidopsis plants using GC-MS. The results again indicate that the emission of linalool was more than 1.5 times higher in the plants transformed by the CpMYC2 gene (35S::CpMYC2), while the mutant plants Salk_083483, mutant plants transformed by the vector pCAMBIA2300S (2300S-Sk83), and the Col-0 wild-type plants showed a lower amount of linalool emission compared to the wild-type (35S::CpMYC2) plants (Figure 9 and Figure 10). Further analysis using real-time PCR (qRT-PCR) indicated that the expression of the linalool-producing gene At1g61680 was about twofold higher in the plants transformed by CpMYC2 (35S::CpMYC2) than the other plants, while the wild-type Col-0, mutant plants Salk_083483, and mutant plants transformed by the vector pCAMBIA2300S (2300S-Sk83) showed a lower expression of the At3g25810 gene as compared to 35S::CpMYC2 plants (Figure 11).

2.6. Overexpression of CpbHLH13 Reduces Flower Pigmentation in Tobacco Plants

A few of the flowering transformed lines of CpbHLH13 also showed phenotypic changes in petal pigmentation. These transgenic plants showed a reduction in the pigmentation of flowers (Figure 12a). Anthocyanin contents from the inflorescence of these tobacco plants were measured by a spectrophotometer which showed a clear reduction in the anthocyanin concentration in 35S::CpbHLH13 plants compared with those of the wild type and those transformed by the empty vector pCAMBIA2300S (2300S-SR1) (Figure 12b,c). By measuring the anthocyanin contents in CpbHLH13 gene-transferred transgenic tobacco (35S::CpbHLH13) plants, we confirmed the reduction of anthocyanin contents in their inflorescence.

3. Discussion

Plants can store and release a wide range of volatile compounds through their specialized organs and tissues, which play a significant role in atmospheric composition [46]. These volatile compounds are also important for the formation of the characteristic floral scent in different plants which improves the aesthetic properties as well as the economic value of the plant [15]. However, the regulatory mechanisms behind the formation of the floral aroma in ornamental plants are poorly characterized. To date, no bHLH transcription factor has been identified and verified by its function in the ornamental and economically significant shrub “wintersweet”. A few attempts have been made to illustrate the transcriptomic analysis of these genes, but the functional characterization remains underestimated. This might be due to the lack of genetic resources as well as the difficulties in the transformation of the genes in wintersweet [9,47]. The present study was designed to decipher the molecular mechanism behind flower fragrance production in wintersweet. The motives behind the study were to identify and find out the role and function of the bHLH transcription factors CpMYC2 and CpbHLH13 in wintersweet.
Phylogenetic analysis demonstrates that CpMYC2 is closely related to Arabidopsis MYC2 (AT1G32640), whereas CpbHLH13 is most homologous to AtbHLH13 (AT1G01260), also known as JASMONATE-ASSOCIATED MYC2-like2 (JAM2). MYC2 was previously reported to promote and activate the sesquiterpene synthase genes TPS21 and TPS11 through interacting with the DELLA proteins (MYC2 interacts with DELLA proteins and regulates the expression of the sesquiterpene synthase gene). It has also been reported that MYC2 is directly involved in the induction of JA and GA in sesquiterpene biosynthesis [48] and induces monoterpene synthase in arabidopsis, which suggests that MYC2 endorses the biosynthesis of a wider range of terpenes [49], whereas JAM2 (AtbHLH13) is involved in the negative regulation of jasmonate signaling in plants [50]. They have also been reported as novel factors regulating various metabolic pathways in arabidopsis in JA signaling [51]. It has been reported that MYC2 is differentially regulated and induced during the flower opening of wintersweet, especially at the fully-open flower stage [37]. In the present study, high expression of both the genes was found at the fully-open flower stage compared to the other flower developmental stages along with the highest expression in flowers among the other developing tissues of the plant (leaves, stems, and fruits). This indicates the possible role of these genes in volatile production during flowering. MYC2 has been identified to enhance the production of volatile compounds, especially monoterpenes and sesquiterpenes, in plants [20,52]. The expression of the linalool- and β-caryophyllene-producing genes increases in plants transformed by CpMYC2 and CpbHLH13, respectively. This illustrates the role of the transcription factors CpMYC2 and CpBHLH13 in the production of monoterpenes and sesquiterpenes in wintersweet plants.
Our findings also indicate that the overexpression of CpMYC2 and CpbHLH13 in model plants shows an increase in the production of monoterpene, i.e., linalool as well as the sesquiterpene (E)-β-caryophyllene, respectively. It is possible that the significant increment in compounds could be provoked because it is a MYC2 transcription factor and part of the bHLH family, which is involved in the regulation of many regulatory functions of the plant and also involved in plant growth and the mechanism of flower development in plants [22,30,53,54]. The results also show that CpMYC2 possibly increases the production of linalool by inducing the expression of the linalool- and limonene-producing genes At1g61680 and At3g25810 in arabidopsis. Linalool itself is one of the main produced floral volatiles, and the sequestration of linalool derivatives and the derivatives of the isoteric monoterpene alcohol geraniol were experimentally proved to be present in the floral organs of several plant species.
The present study also indicates the possible involvement of wintersweet CpbHLH genes in the signaling pathways of JA and GA, leading to the production of volatile floral terpenes. A similar phenomenon was reported in other plant transcription factors such as AtPAP1 in Rosa hybrida, WRKY in cotton (Gossypium hirsutum), ORCA3 in Catharanthus roseus, EF1 and ERF2 in Atemisia annua, and AtMYC2 in arabidopsis [20,55,56,57,58]. These transcription factors regulate the TPS genes by interacting with the DELLA proteins. The DELLA proteins act as a repressor of the TPS gene and negatively regulate the JA and GA signaling pathways by interacting with MYC2. An increase in the concentration of JA and GA decreases the level of JAZ and DELLA proteins, thus releasing the MYC2 and inducing the TPS genes, which results in the production of more volatile compounds [20,59,60]. A combined application of JA and GA3 results in an increase in the expression of the TPS gene and volatile compound production in the transformed plants. Our findings are consistent with the previously reported experimental results where the application of MeJA induces monoterpene production and emits (E)-β-ocimine, β-myrcene, and a small increase in linalool in transgenic tobacco plants [60]. The plants transferred with the CpbHLH13 gene were found to increase sesquiterpene β-caryophyllene production in the arabidopsis and tobacco plants, and the expression of the genes At5g23960 and At5g44630, which are involved in the production of almost all the sesquiterpenes in the arabidopsis, was also higher than in non-transformed plants. It was previously reported that the arabidopsis gene At5g23960 is associated with the synthesis of humulene and β-caryophyllene, which together produce 43% of the terpene volatiles from the flower [49].
In addition to increase sesquiterpene (β-caryophyllene) production in the arabidopsis and tobacco plants, we also found a few transgenic tobacco plants (35S::CpbHLH13) showing reduced flower color compared with the wild type and those transformed by the empty vector pCAMBIA2300S (2300S-SR1). The results were also verified by measuring anthocyanin contents from the flower samples using a spectrophotometer. This significant decrease in anthocyanin production could be explained by the previously described function of the bHLH13 (JAM2) and bHLH17 (JAM1) transcription factors that act as the transcriptional repressors which negatively regulate JA responses resulting in anthocyanin reduction in transgenic plants [50,51,61,62,63]. Furthermore, it has also been reported that bHLH17 is a bHLH subgroup III transcription factor which acts as a transcriptional repressor after binding to the promoters of the target genes in the anthocyanin-regulating pathway [64], which antagonizes the activation function of MYC2 and TT8/MYB75 to negatively regulate JA responses including flowering and anthocyanin accumulation [61].
It has also been elucidated by a functional study that JAZ interacts with transcriptional activators such as MYC2 and MYB75, along with the transcriptional repressors bHLH13 and bHLH17, to reduce its transcriptional functions [61]. The balance between activators and repressors leads to an adequate output of JA responsive genes, which results in a suitable level of JA responses such as plant defense and anthocyanin accumulation.
In this study, we characterized the functional aspects of two wintersweet bHLH transcription factors, CpMYC2 and CpbHLH13, for the production of volatile organic compounds. The results show that CpMYC2 could increase the production of monoterpenes such as linalool, and CpbHLH13 could increase the production of sesquiterpenes such as β-caryophyllene in transgenic plants by enhancing the activity of terpene-producing genes. The application of the MeJA with GA3 could promote the production of linalool and linalool-producing genes in arabidopsis. Taken together, the findings from this study reveal that bHLH transcription factors (CpMYC2 and CpbHLH13) play an essential role in the production of aroma in wintersweet. This study also indicates the future potential application of wintersweet as a valuable genomic material for the genetic modification of floral scent in other flowering plants that produce small amounts of volatile organic compounds.

4. Materials and Methods

4.1. Selection and Analysis of Candidate Genes

The sequences of two bHLH candidate genes predicted as MYC2 and bHLH13 were obtained from a transcriptomic library (NCBI Sequence Read Archive (SRA) accession number PRJNA492170) constructed from the fully open flower of the Wintersweet (C. praecox L.) H29 (Huazhong 29) genotype situated in the garden of Huazhong Agricultural University, Wuhan, China [45]. Moreover, these genes were verified as full-length coding sequences (CDS) from the genomic data of the H29 cultivar (unpublished data) with no introns inside the sequences using BioEdit 7.0 [65] and UltraEdit software [66]. The nucleotide sequences of both candidate genes are shown in supplementary data (Sequences S1 and S2). Multiple sequence alignment of selected bHLH transcription factors of Wintersweet and other plants was performed using the CLUSTALW program with default parameters [67]. The phylogenetic tree was constructed using the neighbor-joining method with 1000 bootstrap replicates using MEGA X software [68]. These candidate genes were confirmed as transcription factors and named CpMYC2 and CpbHLH13 as per their homology with the typical MYC2 and bHLH13 transcription factor proteins of other plants. The homology of the gene sequence with arabidopsis was also confirmed by the arabidopsis information resource (TAIR) database (https://www.arabidopsis.org/Blast/index.jsp). The conserved domain of the CpMYC2 and CpbHLH13 gene was observed (https://www.ncbi.nlm.nih.gov/guide/domains-structures) using Pfam (http://pfam.xfam.org/search/sequence), and protein structure was predicted using Swissmodel (https://swissmodel.expasy.org/interactive). The Compute pI/Mw calculation tool on the ExPASy server (https://web.expasy.org/compute_pi) was used to predict the theoretical isoelectric point (pI) and the molecular weight (Mw).

4.2. Plant Materials

Flowers of the Wintersweet H29 plant were collected from the garden of Huazhong Agriculture University in Wuhan, China. Plants of the Arabidopsis thaliana ecotype Columbia (Col-0), the T-DNA inserted homozygous myc2-2 (Salk_083483) mutant [69] obtained from the SALK institute and ABRC (Arabidopsis Biological Resource Center, Columbus, OH, USA), and the Nottingham Arabidopsis Stock Centre and tobacco (Nicotiana tabacum) cv Petit Havana SR1 [70] were used as the planting and gene-transforming material. The homozygosity of the myc2-2 (Salk_083483) mutant arabidopsis plants was detected by the specific primers listed in Table 3. Plants were grown in half-strength Murashige and Skoog (MS) media under a 16-h photoperiod in the plant growth chamber.

4.3. Total RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR (qRT-PCR) Analysis

Total RNA was extracted from 0.20g frozen flowers using TRIzol reagent (CoWin Biotech Co., Ltd., Beijing, China) as per the manufacturer’s instructions. DNA contamination was removed by treating the total RNA with the DNase I enzyme. cDNA was synthesized using a one-step gDNA removal and cDNA synthesis supermix (Transgene, Wuhan, China) according to the manufacturer’s instructions. The synthetic first-strand cDNAs were diluted 10-fold for gene expression analysis. The gene expression of CpMYC2 and bHLH13 was studied by qRT-PCR in 5 developing stages of the flower of H29, i.e., FB (flower bud), DP (display petal), POF (partially-open flower), OF (open flower stage), and SF (senescing flower) (Figure 1) on an Applied Biosystems 7500 Fast Real-Time PCR platform with the SYBR Premix Ex TaqTM II mix (Takara Biotechnology Co., Ltd., Dalian, China), according to the manufacturer’s instructions, and the results were analyzed using the Applied Biosystems 7500 software (Applied Biosystems Life Technologies). Three biological replicates were tested, and reactions carried out in triplicate. Relative transcript levels were calculated by the 2−∆∆Ct method [71] using the previously reported most stable genes RPL8 and Tubulin (CpTublin) for wintersweet [72,73], NADH dehydrogenase (NtNADH) and chaperonin CPN60-2 (NtCPN60-2) for tobacco [74], and clathrin adaptor complex subunit (CACS) (AtCACS) and β-tubulin2 (AtTubulin) [20,75] for arabidopsis as the endogenous control genes for data normalization according to the recommendations [76] and described method [77]. The primers 35S F and 35S R were used for the expression of empty gene transformation. The transcript level of monoterpene-producing At1g61680 and At3g25810 along with the sesquiterpene-producing At5g23960 and At5g44630 genes in arabidopsis was also measured. Primer Premier 5 software was used to design the primers used in the experiments. The primers used for qRT-PCR analysis are listed in Table 4.

4.4. Isolation, Cloning, and Sequencing of Candidate Genes

The full-length open reading frame of CpMYC2 and CpbHLH13 was amplified by PCR from the cDNA of wintersweet flowers by using a specific pair of primers containing Kpn1 and Xba1 restriction sites (Table 5). The PCR conditions were 5 min, 95 °C; 30 s, 95 °C; 30 s, 60 °C, 30 cycles; 30 s, 72 °C; 5 min, 72 °C. The PCR product was purified using a Tiangen Midi Purification Kit (Tiangen, Wuhan, China) and cloned into a pEASY-T1 cloning vector (Transgene Wuhan, China), according to the manufacturer’s instructions, and three positive clones were selected and sequenced.

4.5. Expression Vector Construction and Transformation

The expression vector was constructed using full-length CpMYC2 and CpbHLH13 gene sequences on a modified pCAMBIA 2300S vector by double digestion using Kpn1 and Xba1 digestion enzymes under a CaMV 35S promoter (Supplementary Figure S8a,b); 35S::CpbHLH13 was introduced into Agrobacterium tumefaciens strain GV3101 by electroporation. The positively cloned agrobacteria were selected and transformed into tobacco by using the leaf disk method [78]. The empty vector pCAMBIA 2300S was also introduced into tobacco plants as a control. The shoots of emerged explants were transferred into rooting media as described previously [78]. These explants were incubated in a growth chamber at 25 °C under a 16 h/8 h photoperiod. Homozygous arabidopsis Salk_083483 mutant plants were transformed by CpMYC2, while CpbHLH13 was transferred into the arabidopsis Col-0 cultivar via Agrobacterium tumefaciens-mediated transformation [79]. The pots containing the wild-type and mutant arabidopsis plants were carefully inverted and immersed in the infiltration medium containing agrobacterium while stirring for 1 min. The seedlings were placed back on the shelf and covered by plastic bags. Three days after infiltration, the plastic bags were removed, and the seedlings were supported with sticks and allowed to grow till the first generation of seeds (T1). The seeds from the T1 generation of arabidopsis plants and the T0 generation from tobacco were grown in ½ MS media plates with 50 µM-mL-1 kanamycin for screening the positive seedlings. The surviving plants were transferred to soil pots, and their positivity was also confirmed by PCR with gene-specific primers using plant cDNA as a template (Table 5). These plants were self-crossed, and at least three plants from tobacco and 3 groups of 6 plants from arabidopsis of the T3 generation with the highest gene expression were used for further experiments.

4.6. Volatile Organic Compounds Analysis

The released floral volatiles from tobacco plants were collected by solid-phase microextraction (SPME) [43]. In triplicate, 2 g fresh flowers were placed into a 20 mL capped SPME vial and incubated at 25 ± 2 °C for 30 min. SPME fiber (50/30 μm DVB/CAR/PDMS on a 2 cm Stable Flex fiber, Supelco Inc., Bellefonte, PA, USA) was then exposed to the headspace of the capped vial for 30 min. The fiber was injected manually and desorbed in the injection port of the gas chromatograph (GC) with helium as the carrier gas. The fiber was desorbed for 5 min at 250 °C in splitless mode. Before each set of samples was assayed, the fiber was conditioned for 1 h at 250 °C in the injection port of the GC-MS and a fiber blank recorded. To measure the release of volatiles by arabidopsis plants, the closed-loop stripping method [80] was used in which the intact rosette plants with their root balls were wrapped with aluminum foil and placed in 3-L bell jars under controlled growth conditions as described previously [49]. VOCs were collected in daytime for 8 h using 1.5 mg activated charcoal and eluted with 40 μL of CH2Cl2. The eluted samples of 1μL were injected in splitless mode into a TRACE GC Ultra GC coupled to a DSQ II mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) equipped with an HP-5 MS fused-silica column (30 m × 0.25 mm × 0.25 μm) (Agilent Technologies, http://www.agilent.com). The GC-MS was performed according to the standard methods [43]. The relative quantification of the target compounds for emission was determined using standard curves which were generated by three repeats: y = 7969151.04x-4406492.42 and R2 = 0.97 for linalool and y = 50591253.45x-45934339.38 and R2 = 0.99 for β-caryophyllene (Supplementary Figure S9a,b).

4.7. Application of MeJA and GA3 to Arabidopsis Plants

We applied MeJA (50 µM) together with GA3 (50 µM) on the arabidopsis wild type (Col-0), mutant (Salk_083483), mutant plants transformed by the empty vector pCAMBIA2300S (2300S-SK83), and mutant plants transformed by the CpMYC2 gene (35S::CpMYC2). The pots, in which 5-week-old plants were growing (T3 generation), were soaked with MeJA (50 mM) and GA3 (50 mM) solutions, respectively, for an indicated time, accompanied with the spraying of aerial parts at intervals of 1 h. dH2O2 was used as a mock treatment. Inflorescences were harvested for RNA extraction. The hormone treatments for gene analysis were performed in the daytime for 4 h (10:00 to 14:00), and those for volatile analysis were 6 h (9:00 to 15:00).

4.8. Anthocyanin Contents Measurements

Total anthocyanin contents were measured by the method described [81]. Flower material (500 mg) from each treatment was crushed in a mortar with liquid nitrogen to obtain a fine powder. The anthocyanins were extracted by transferring the fine powder to an extraction solution (5 mL) containing a methanol/HCl mixture (99:1 v/v) (Sigma, St. Louis, MO, USA). The mixture was incubated at 4 °C for 24 h and then centrifuged at 13,000 rpm for 20 min at 4 °C. The supernatant was transferred to a fresh tube and the total anthocyanin was determined by measuring the OD at A530 (λmax for anthocyanin) and A657 (peak of absorption for chlorophyll) by using a spectrophotometer (Shimadzu, Kyoto, Japan). The quantification of anthocyanins was performed using the formula Qanthocyanins = (A530 − 0.25 × A657) × M−1, where Qanthocyanins is the amount of anthocyanins, and M is the weight (g) of the plant material used for extraction, as described earlier [82].

4.9. Statistical Analysis

All the statistical analysis was conducted using the Statistix 8.1 (FL, USA) software. One-way analysis of variation (ANOVA) followed by Tukey’s HSD multiple comparisons were used to compare the relative expression of transcripts. Three technical and biological repeats were selected separately for every experiment. p-value < 0.05 was considered as significant.

Supplementary Materials

The following are available online at https://www.mdpi.com/2223-7747/9/6/785/s1, Figure S1: Three-dimensional structure prediction of the protein encoded by the CpMYC2 gene. Figure S2: Three-dimensional structure prediction of the protein encoded by the CpbHLH13 gene. Figure S3: Phylogenetic analysis of wintersweet CpMYC2 with the 158 arabidopsis bHLH transcription factor gene family. Figure S4: Phylogenetic analysis of wintersweet CpbHLH13 with the arabidopsis bHLH transcription factor gene family. Figure S5: Phylogenetic analysis of Chimonanthus praecox CpMYC2 with different plant species. Figure S6: Phylogenetic analysis of Chimonanthus praecox CpbHLH13 with different plant species. Figure S7: Expression of the CpMYC2 and CpbHLH13 genes in plants. Figure S8: Partial diagram of the pCAMBIA 2300S transformation vector with CpMYC2 and CpbHLH13 genes. Figure S9: Standard curve of linalool and caryophyllene. Sequence S1: Nucleotide sequence of the CpMYC2 candidate gene. Sequence S2: Nucleotide sequence of the CpbHLH13 candidate gene.

Author Contributions

Conceptualization, X.L. and N.Y.; Funding acquisition, L.C.; Investigation, N.Y. Methodology, M.Z.A.; Project administration, L.C.; Resources, X.L. and L.C.; Supervision, X.L. and L.C.; Validation, X.L. and X.L.; Writing—original draft, M.Z.A.; Writing—review and editing, M.Z.A. and L.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (NSFC) (Project No. 31572165) and the “Thousand Talents Plan” of Yunan Province, “High-End Foreign Experts Project” (No. 000019).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Howe, G.A.; Major, I.T.; Koo, A.J. Modularity in Jasmonate Signaling for Multistress Resilience. Annu. Rev. Plant Biol. 2018, 69, 387–415. [Google Scholar] [CrossRef] [Green Version]
  2. Sharifi, R.; Lee, S.-M.; Ryu, C.-M. Microbe-induced plant volatiles. New Phytol. 2017, 220, 684–691. [Google Scholar] [CrossRef] [Green Version]
  3. Dudareva, N.; Klempien, A.; Muhlemann, K.; Kaplan, I.; Muhlemann, J.K.; Kaplan, I. Biosynthesis, function and metabolic engineering of plant volatile organic compounds. New Phytol. 2013, 198, 16–32. [Google Scholar] [CrossRef]
  4. Muhlemann, J.K.; Klempien, A.; Dudareva, N. Floral volatiles: From biosynthesis to function. Plant Cell Environ. 2014, 37, 1936–1949. [Google Scholar] [CrossRef] [PubMed]
  5. Nagegowda, D.A.; Gutensohn, M.; Wilkerson, C.G.; Dudareva, N. Two nearly identical terpene synthases catalyze the formation of nerolidol and linalool in snapdragon flowers. Plant J. 2008, 55, 224–239. [Google Scholar] [CrossRef] [PubMed]
  6. Ginglinger, J.-F.; Boachon, B.; Höfer, R.; Paetz, C.; Köllner, T.G.; Miesch, L.; Lugan, R.; Baltenweck, R.; Mutterer, J.; Ullmann, P.; et al. Gene coexpression analysis reveals complex metabolism of the monoterpene alcohol linalool in Arabidopsis flowers. Plant Cell 2013, 25, 4640–4657. [Google Scholar] [CrossRef] [Green Version]
  7. Han, Y.; Wang, H.; Wang, X.; Li, K.; Dong, M.; Li, Y.; Zhu, Q.; Shang, F. Mechanism of floral scent production in Osmanthus fragrans and the production and regulation of its key floral constituents, β-ionone and linalool. Hortic. Res. 2019, 6. [Google Scholar] [CrossRef] [Green Version]
  8. Aros, D.; Gonzalez, V.; Allemann, R.K.; Müller, C.T.; Rosati, C.; Rogers, H.J. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers. J. Exp. Bot. 2012, 63, 2739–2752. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Xiang, L.; Zhao, K.; Chen, L. Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids. Plant Physiol. Biochem. 2010, 48, 845–850. [Google Scholar] [CrossRef]
  10. Roeder, S.; Hartmann, A.-M.; Effmert, U.; Piechulla, B. Regulation of simultaneous synthesis of floral scent terpenoids by the 1, 8-cineole synthase of Nicotiana suaveolens. Plant Mol. Biol. 2007, 65, 107–124. [Google Scholar] [CrossRef]
  11. Fan, Y.P.; Yu, R.C.; Huang, Y.; Chen, Y.F. Studies on the essential constituent of Hedychium flavum and H. coronarium. Acta Hortic. Sin. 2003, 30, 475. [Google Scholar]
  12. Fan, Y.; Wang, X.; Yu, R.; Yang, P. Analysis on the aroma components in several species of Hedychium. Acta Hortic. Sin. 2007, 34, 231. [Google Scholar]
  13. Shimada, T.; Endo, T.; Fujii, H.; Hara, M.; Omura, M. Isolation and characterization of (E)-beta-ocimene and 1, 8 cineole synthases in Citrus unshiu Marc. Plant Sci. 2005, 168, 987–995. [Google Scholar] [CrossRef]
  14. Tholl, D.; Chen, F.; Petri, J.; Gershenzon, J.; Pichersky, E. Two sesquiterpene synthases are responsible for the complex mixture of sesquiterpenes emitted from Arabidopsis flowers. Plant J. 2005, 42, 757–771. [Google Scholar] [CrossRef]
  15. Yue, Y.; Yu, R.; Fan, Y. Transcriptome profiling provides new insights into the formation of floral scent in Hedychium coronarium. BMC Genom. 2015, 16, 470. [Google Scholar] [CrossRef] [Green Version]
  16. Lucker, J.; Schwab, W.; Franssen, M.C.R.; Van Der Plas, L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.; Lücker, J.; Schwab, W.; Franssen, M.C.R.; Van Der Plas, L.H.W.; et al. Metabolic engineering of monoterpene biosynthesis: Two-step production of (+)-trans-isopiperitenol by tobacco. Plant J. 2004, 39, 135–145. [Google Scholar] [CrossRef]
  17. Green, S.A.; Chen, X.; Nieuwenhuizen, N.J.; Matich, A.J.; Wang, M.Y.; Bunn, B.J.; Yauk, Y.-K.K.; Atkinson, R.G. Identification, functional characterization, and regulation of the enzyme responsible for floral (E)-nerolidol biosynthesis in kiwifruit (Actinidia chinensis). J. Exp. Bot. 2012, 63, 1951–1967. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Jin, J.; Kim, M.J.; Dhandapani, S.; Tjhang, J.G.; Yin, J.-L.; Wong, L.; Sarojam, R.; Chua, N.-H.; Jang, I.-C. The floral transcriptome of ylang ylang (Cananga odorata var. fruticosa) uncovers biosynthetic pathways for volatile organic compounds and a multifunctional and novel sesquiterpene synthase. J. Exp. Bot. 2015, 66, 3959–3975. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Jayaramaiah, R.H.; Anand, A.; Beedkar, S.D.; Dholakia, B.B.; Punekar, S.A.; Kalunke, R.M.; Gade, W.N.; Thulasiram, H.V.; Giri, A.P. Functional characterization and transient expression manipulation of a new sesquiterpene synthase involved in β-caryophyllene accumulation in Ocimum. Biochem. Biophys. Res. Commun. 2016, 473, 265–271. [Google Scholar] [CrossRef] [PubMed]
  20. Hong, G.-J.; Xue, X.-Y.; Mao, Y.-B.; Wang, L.-J.; Chen, X.-Y. Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression. Plant Cell 2012, 24, 2635–2648. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Yahyaa, M.; Tholl, D.; Cormier, G.; Jensen, R.; Simon, P.W.; Ibdah, M. Identification and characterization of terpene synthases potentially involved in the formation of volatile terpenes in carrot (Daucus carota L.) roots. J. Agric. Food Chem. 2015, 63, 4870–4878. [Google Scholar] [CrossRef] [PubMed]
  22. Wasternack, C.; Strnad, M. Jasmonates are signals in the biosynthesis of secondary metabolites—Pathways, transcription factors and applied aspects—A brief review. N. Biotechnol. 2017, 1–11. [Google Scholar] [CrossRef]
  23. Per, T.S.; Khan, M.I.R.; Anjum, N.A.; Masood, A.; Hussain, S.J.; Khan, N.A. Jasmonates in plants under abiotic stresses: Crosstalk with other phytohormones matters. Environ. Exp. Bot. 2018, 145, 104–120. [Google Scholar] [CrossRef]
  24. Wen, J.; Li, Y.; Qi, T.; Gao, H.; Liu, B.; Zhang, M.; Huang, H.; Song, S. The C-terminal domains of Arabidopsis GL3/EGL3/TT8 interact with JAZ proteins and mediate dimeric interactions. Plant Signal. Behav. 2018, 13, 1795–1814. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Miyamoto, K.; Kotake, T.; Boncela, A.J.; Saniewski, M.; Ueda, J. Hormonal regulation of gummosis and composition of gums from bulbs of hyacinth (Hyacinthus orientalis). J. Plant Physiol. 2015, 174, 1–4. [Google Scholar] [CrossRef]
  26. Kazan, K. Diverse roles of jasmonates and ethylene in abiotic stress tolerance. Trends Plant Sci. 2015, 20, 219–229. [Google Scholar] [CrossRef]
  27. Geetika, S.; Ruqia, M.; Poonam, S.; Harpreet, K.; Mudaser, A.M. Jasmonate Signaling and Stress Management in Plants. Mech. Plant Horm. Signal. Stress 2017, 143–171. [Google Scholar]
  28. Dar, T.A.; Uddin, M.; Khan, M.M.A.; Hakeem, K.R.; Jaleel, H. Jasmonates counter plant stress: A review. Environ. Exp. Bot. 2015, 115, 49–57. [Google Scholar] [CrossRef]
  29. Zhou, M.; Memelink, J. Jasmonate-responsive transcription factors regulating plant secondary metabolism. Biotechnol. Adv. 2016, 34, 441–449. [Google Scholar] [CrossRef]
  30. Zhang, X.; Luo, H.; Xu, Z.; Zhu, Y.; Ji, A.; Song, J.; Chen, S. Genome-wide characterisation and analysis of bHLH transcription factors related to tanshinone biosynthesis in Salvia miltiorrhiza. Sci. Rep. 2015, 5, 1–10. [Google Scholar] [CrossRef] [Green Version]
  31. Alquézar, B.; Volpe, H.X.L.; Magnani, R.F.; Miranda, M.P.; Santos, M.A.; Wulff, N.A.; Bento, J.M.S.; Parra, J.R.P.; Bouwmeester, H.; Peña, L. β-caryophyllene emitted from a transgenic Arabidopsis or chemical dispenser repels Diaphorina citri, vector of Candidatus liberibacters. Sci. Rep. 2017, 7, 5639. [Google Scholar] [CrossRef] [PubMed]
  32. Wang, Q.; Jia, M.; Huh, J.-H.; Muchlinski, A.; Peters, R.J.; Tholl, D. Identification of a dolabellane type diterpene synthase and other root-expressed diterpene synthases in Arabidopsis. Front. Plant Sci. 2016, 7, 1761. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Orlova, I.; Nagegowda, D.A.; Kish, C.M.; Gutensohn, M.; Maeda, H.; Varbanova, M.; Fridman, E.; Yamaguchi, S.; Hanada, A.; Kamiya, Y.; et al. The small subunit of snapdragon geranyl diphosphate synthase modifies the chain length specificity of tobacco geranylgeranyl diphosphate synthase in planta. Plant Cell 2009, 21, 4002–4017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Fäldt, J.; Arimura, G.I.; Gershenzon, J.; Takabayashi, J.; Bohlmann, J. Functional identification of AtTPS03 as (E)-beta-ocimene synthase: A monoterpene synthase catalyzing jasmonate- and wound-induced volatile formation in Arabidopsis thaliana. Planta 2003, 216, 745–751. [Google Scholar] [CrossRef]
  35. Cheng, Z.; Sun, L.; Qi, T.; Zhang, B.; Peng, W.; Liu, Y.; Xie, D. The bHLH transcription factor MYC3 interacts with the jasmonate ZIM-domain proteins to mediate jasmonate response in arabidopsis. Mol. Plant 2011, 4, 279–288. [Google Scholar] [CrossRef]
  36. Yang, J.; Dai, P.; Zhou, T.; Huang, Z.; Feng, L.; Su, H.; Liu, Z.; Zhao, G. Genetic diversity and structure of wintersweet (Chimonanthus praecox) revealed by EST-SSR markers. Sci. Hortic. (Amsterdam) 2013, 150, 1–10. [Google Scholar] [CrossRef]
  37. Liu, D.; Sui, S.; Ma, J.; Li, Z.; Guo, Y.; Luo, D.; Yang, J.; Li, M. Transcriptomic analysis of flower development in Wintersweet (Chimonanthus praecox). PLoS ONE 2014, 9. [Google Scholar] [CrossRef] [Green Version]
  38. Zhang, S.; Zhang, H.; Chen, L.; Xia, W.; Zhang, W. Phytochemical profiles and antioxidant activities of different varieties of Chimonanthus Praecox. Ind. Crops Prod. 2016, 85, 11–21. [Google Scholar] [CrossRef]
  39. Zhang, S.H.; Wei, Y.; Liu, J.L.; Yu, H.M.; Yin, J.H.; Pan, H.Y.; Baldwin, T.C. An apoplastic chitinase CpCHT1 isolated from the corolla of wintersweet exhibits both antifreeze and antifungal activities. Biol. Plant. 2011, 55, 141–148. [Google Scholar] [CrossRef]
  40. Dai, P.F.; Yang, J.; Zhou, T.H.; Huang, Z.H.; Feng, L.; Su, H.L.; Liu, Z.L.; Zhao, G.F. Genetic diversity and differentiation in Chimonanthus praecox and Ch. salicifolius (Calycanthaceae) as revealed by inter-simple sequence repeat (ISSR) markers. Biochem. Syst. Ecol. 2012, 44, 149–156. [Google Scholar] [CrossRef]
  41. Sui, S.; Luo, J.; Ma, J.; Zhu, Q.; Lei, X.; Li, M. Generation and analysis of expressed sequence tags from Chimonanthus praecox (Wintersweet) flowers for discovering stress-responsive and floral development-related genes. Comp. Funct. Genom. 2012, 2012, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Zhang, W.; Chen, Z. Polymer Monolith Microextraction Coupled with HPLC for Determination of Jasmonates in Wintersweet Flowers. Anal. Lett. 2012, 46, 74–86. [Google Scholar] [CrossRef]
  43. Zeng, X.; Liu, C.; Zheng, R.; Cai, X.; Luo, J.; Zou, J.; Wang, C. Emission and Accumulation of Monoterpene and the Key Terpene Synthase (TPS) Associated with Monoterpene Biosynthesis in Osmanthus fragrans Lour. Front. Plant Sci. 2016, 6, 1–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Wang, Y.; Park, J.; Sun, B.; Ahn, H.; Wang, G. Wintersweet-flower-like CoFe2O4/MWCNTs hybrid material for high-capacity reversible lithium storage. Chem. An Asian J. 2012, 7, 1940–1946. [Google Scholar] [CrossRef]
  45. Tian, J.-P.; Ma, Z.-Y.; Zhao, K.-G.; Zhang, J.; Xiang, L.; Chen, L.-Q. Transcriptomic and proteomic approaches to explore the differences in monoterpene and benzenoid biosynthesis between scented and unscented genotypes of wintersweet. Physiol. Plant. 2018. [Google Scholar] [CrossRef]
  46. Tholl, D.; Boland, W.; Hansel, A.; Loreto, F.; Röse, U.S.R.; Schnitzler, J.P. Practical approaches to plant volatile analysis. Plant J. 2006, 45, 540–560. [Google Scholar] [CrossRef] [PubMed]
  47. Zhao, K.G.; Zhou, M.Q.; Chen, L.Q.; Zhang, D.; Robert, G.W. Genetic diversity and discrimination of Chimonanthus praecox (L.) link germplasm using ISSR and RAPD markers. HortScience 2007, 42, 1144–1148. [Google Scholar] [CrossRef] [Green Version]
  48. Zhang, F.; Yao, J.; Ke, J.; Zhang, L.; Lam, V.Q.; Xin, X.F.; Zhou, X.E.; Chen, J.; Brunzelle, J.; Griffin, P.R.; et al. Structural basis of JAZ repression of MYC transcription factors in jasmonate signalling. Nature 2015, 525, 269–273. [Google Scholar] [CrossRef] [Green Version]
  49. Chen, F.; Tholl, D.; D’Auria, J.C.; Farooq, A.; Pichersky, E.; Gershenzon, J. Biosynthesis and Emission of Terpenoid Volatiles from Arabidopsis Flowers. Plant Cell 2003, 15, 481–494. [Google Scholar] [CrossRef] [Green Version]
  50. Nakata, M.; Mitsuda, N.; Herde, M.; Koo, A.J.K.K.; Moreno, J.E.; Suzuki, K.; Howe, G.A.; Ohme-takagi, M. A bHLH-type transcription factor, ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR/JA-ASSOCIATED MYC2-LIKE1, acts as a repressor to negatively regulate jasmonate signaling in arabidopsis. Plant Cell 2013, 25, 1641–1656. [Google Scholar] [CrossRef] [Green Version]
  51. Sasaki-Sekimoto, Y.; Jikumaru, Y.; Obayashi, T.; Saito, H.; Masuda, S.; Kamiya, Y.; Ohta, H.; Shirasu, K. Basic helix-loop-helix transcription factors JASMONATE-ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3 are negative regulators of jasmonate responses in Arabidopsis. Plant Physiol. 2013, 163, 291–304. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Song, S.; Huang, H.; Gao, H.; Wang, J.; Wu, D.; Liu, X.; Yang, S.; Zhai, Q.; Li, C.; Qi, T.; et al. Interaction between MYC2 and ETHYLENE INSENSITIVE3 modulates antagonism between jasmonate and ethylene signaling in Arabidopsis. Plant Cell 2014, 26, 263–279. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Yue, Y.; Yin, C.; Guo, R.; Peng, H.; Yang, Z. An anther-specific gene PhGRP is regulated by PhMYC2 and causes male sterility when overexpressed in petunia anthers. Plant Cell Rep. 2017. [Google Scholar] [CrossRef] [PubMed]
  54. Schweizer, F.; Colinas, M.; Pollier, J.; Van Moerkercke, A.; Bossche, R.V.; de Clercq, R.; Goossens, A. An engineered combinatorial module of transcription factors boosts production of monoterpenoid indole alkaloids in Catharanthus roseus. Metab. Eng. 2018. [Google Scholar] [CrossRef] [PubMed]
  55. Zvi, M.M.B.; Shklarman, E.; Masci, T.; Kalev, H.; Debener, T.; Shafir, S.; Ovadis, M.; Vainstein, A. PAP1 transcription factor enhances production of phenylpropanoid and terpenoid scent compounds in rose flowers. New Phytol. 2012, 195, 335–345. [Google Scholar] [CrossRef] [PubMed]
  56. Xu, Y.-H.; Wang, J.-Y.J.-W.; Wang, S.; Wang, J.-Y.J.-W.; Chen, X.-Y. Characterization of GaWRKY1, a cotton transcription factor that regulates the sesquiterpene synthase gene (+)-δ-cadinene synthase-A. Plant Physiol. 2004, 135, 507–515. [Google Scholar] [CrossRef] [Green Version]
  57. Van Der Fits, L.; Memelink, J. ORCA3, a jasmonate-responsive transcriptional regulator of plant primary and secondary metabolism. Science 2000, 289, 295–297. [Google Scholar] [CrossRef]
  58. Yu, Z.X.; Li, J.X.; Yang, C.Q.; Hu, W.L.; Wang, L.J.; Chen, X.Y. The jasmonate-responsive AP2/ERF transcription factors AaERF1 and AaERF2 positively regulate artemisinin biosynthesis in Artemisia annua L. Mol. Plant 2012, 5, 353–365. [Google Scholar] [CrossRef] [Green Version]
  59. Song, S.; Qi, T.; Wasternack, C.; Xie, D. Jasmonate signaling and crosstalk with gibberellin and ethylene. Curr. Opin. Plant Biol. 2014, 21, 112–119. [Google Scholar] [CrossRef]
  60. Schuman, M.C.; Palmer-Young, E.C.; Schmidt, A.; Gershenzon, J.; Baldwin, I.T. Ectopic Terpene Synthase Expression Enhances Sesquiterpene Emission in Nicotiana attenuata without Altering Defense or Development of Transgenic Plants or Neighbors. Plant Physiol. 2014, 166, 779–797. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  61. Song, S.; Qi, T.; Fan, M.; Zhang, X.; Gao, H.; Huang, H.; Wu, D.; Guo, H.; Xie, D. The bHLH subgroup IIId factors negatively regulate jasmonate-mediated plant defense and development. PLoS Genet. 2013, 9, e1003653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Nakata, M.; Ohme-Takagi, M. Two bHLH-type transcription factors, JA-ASSOCIATED MYC2-LIKE2 and JAM3, are transcriptional repressors and affect male fertility. Plant Signal. Behav. 2013, 8, e26473. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Sandra, F.; Patricia, F.-C.; Guillermo, M.F.; Monica, D.-D.; Selena, G.-I.; Irene, L.-V.; Marta, G.; Gemma, F.-B.; Jelle, V.L.; Geert, D.J.; et al. bHLH003, bHLH013 and bHLH017 are new targets of JAZ repressors negatively regulating JA responses. PLoS One 2014, 9, e86182. [Google Scholar] [CrossRef] [Green Version]
  64. Huang, H.; Gao, H.; Liu, B.; Fan, M.; Wang, J.; Wang, C.; Tian, H.; Wang, L.; Xie, C.; Wu, D.; et al. bHLH13 Regulates Jasmonate-Mediated Defense Responses and Growth. Evol. Bioinform. 2018, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Hall, T.; Biosciences, I.; Carlsbad, C. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
  66. Li, Y.X.; Chau, K.T.; Wei, K.T.; Kang, Q. Bin A comparative study on two XML editors (oxygon and ultraedit). In Proceedings of the 3rd International Conference on Cryptography, Security and Privacy, Kuala Lumpur, Malaysia, January 2019; pp. 284–288. [Google Scholar]
  67. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; Mcgettigan, P.A.; Mcwilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Green Version]
  68. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  69. Alonso, J.M.; Stepanova, A.N.; Leisse, T.J.; Kim, C.J.; Chen, H.; Shinn, P.; Stevenson, D.K.; Zimmerman, J.; Barajas, P.; Cheuk, R.; et al. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 2003, 301, 653–657. [Google Scholar] [CrossRef] [Green Version]
  70. Maliga, P.; BREZNOVITS, Á.S.; Marton, L. Streptomycin-resistant plants from callus culture of haploid tobacco. Nat. New Biol. 1973, 244, 29. [Google Scholar] [CrossRef]
  71. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  72. Yang, N.; Zhao, K.; Li, X.; Zhao, R.; z Aslam, M.; Yu, L.; Chen, L. Comprehensive analysis of wintersweet flower reveals key structural genes involved in flavonoid biosynthetic pathway. Gene 2018, 676, 279–289. [Google Scholar] [CrossRef] [PubMed]
  73. Ma, J.; Li, Z.; Wang, B.; Sui, S.; Li, M. Cloning of an expansin gene from Chimonanthus praecox flowers and its expression in flowers treated with ethephon or 1-methylcyclopropene. HortScience 2012, 47, 1472–1477. [Google Scholar] [CrossRef] [Green Version]
  74. Guo, Y.; Li, R.; Asgher, Z.; Shamsi, I.H.; Yu, S.; Zhao, J.; Ren, X. Genome-Wide Selection and Testing of Superior Reference Genes for Quantitative Gene Expression Normalization in Tobacco. Res. Rev. J. Microbiol. Biotechnol. 2016, 5, 68–75. [Google Scholar]
  75. Wang, H.; Wang, J.; Jiang, J.; Chen, S.; Guan, Z.; Liao, Y.; Chen, F. Reference genes for normalizing transcription in diploid and tetraploid Arabidopsis. Sci. Rep. 2014, 4, 6781. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Zmienko, A.; Samelak-Czajka, A.; Goralski, M.; Sobieszczuk-Nowicka, E.; Kozlowski, P.; Figlerowicz, M. Selection of Reference Genes for qPCR- And ddPCR-Based Analyses of Gene Expression in Senescing Barley Leaves. PLoS ONE 2015, 10, 1–16. [Google Scholar] [CrossRef]
  77. Kozera, B.; Rapacz, M. Reference genes in real-time PCR. J. Appl. Genet. 2013, 54, 391–406. [Google Scholar] [CrossRef] [Green Version]
  78. HOrsch, R.B.; Fry, J.E.; Hoffmann, N.L.; Eichholtz, D.; Rogers, S.G.; Fraley, R.T. A Simple and General Method for hybridization revealed the expected. Science 1985, 227, 1229–1231. [Google Scholar] [CrossRef]
  79. Clough, S.J.; Bent, A.F. Floral dip: A simplified method forAgrobacterium-mediated transformation ofArabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [Green Version]
  80. Donath, J.; Boland, W. Biosynthesis of acyclic homoterpenes: Enzyme selectivity and absolute configuration of the nerolidol precursor. Phytochemistry 1995, 39, 785–790. [Google Scholar] [CrossRef]
  81. Ai, T.N.; Naing, A.H.; Arun, M.; Lim, S.H.; Kim, C.K. Sucrose-induced anthocyanin accumulation in vegetative tissue of Petunia plants requires anthocyanin regulatory transcription factors. Plant Sci. 2016, 252, 144–150. [Google Scholar] [CrossRef] [PubMed]
  82. Chu, H.; Jeong, J.C.; Kim, W.J.; Chung, D.M.; Jeon, H.K.; Ahn, Y.O.; Kim, S.H.; Lee, H.S.; Kwak, S.S.; Kim, C.Y. Expression of the sweetpotato R2R3-type IbMYB1a gene induces anthocyanin accumulation in Arabidopsis. Physiol. Plant. 2013, 148, 189–199. [Google Scholar] [CrossRef] [PubMed]
Plants 09 00785 g001 550
Figure 1. Developing stages of the flower of the Wintersweet (Chimonanthus praecox) H29 (Huazhong 29) genotype. Abbreviations: FB, flower bud; DP, display petal; POF, partially-open flower; OF, open flower stage; SF, senescing flower. Scale bar = 1 cm.
Figure 1. Developing stages of the flower of the Wintersweet (Chimonanthus praecox) H29 (Huazhong 29) genotype. Abbreviations: FB, flower bud; DP, display petal; POF, partially-open flower; OF, open flower stage; SF, senescing flower. Scale bar = 1 cm.
Plants 09 00785 g001
Plants 09 00785 g002 550
Figure 2. Multiple sequence alignment of the wintersweet CpMYC2 protein sequence with its homologous proteins from other plant species: Cinnamomum micranthum CmMYC2 (RWR86802.1), Nicotiana tabacum NtMYC2 (XP_016500373.1), Solanum lycopersicum SlMYC2 (NP_001311412.1), Vitis vinifera VvMYC2 (XP_002280253.2), Arabidopsis thaliana AtMYC2 (At1g32640), and Zea mays ZmMYC2 (PWZ55921.1). The red box indicates the basic helix-loop-helix DNA-binding domain common in plants.
Figure 2. Multiple sequence alignment of the wintersweet CpMYC2 protein sequence with its homologous proteins from other plant species: Cinnamomum micranthum CmMYC2 (RWR86802.1), Nicotiana tabacum NtMYC2 (XP_016500373.1), Solanum lycopersicum SlMYC2 (NP_001311412.1), Vitis vinifera VvMYC2 (XP_002280253.2), Arabidopsis thaliana AtMYC2 (At1g32640), and Zea mays ZmMYC2 (PWZ55921.1). The red box indicates the basic helix-loop-helix DNA-binding domain common in plants.
Plants 09 00785 g002
Plants 09 00785 g003 550
Figure 3. Multiple sequence alignment of the Wintersweet bHLH13 protein sequence with its homologous proteins from other plant species: Cinnamomum micranthum CmbHLH13 (RWR96436.1), Vitis vinifera VvbHLH13 (RVW95465.1), Malus domestica MdbHLH13 (XP_028955372.1), Nicotiana tabacum NtbHLH13 (XP_016459177.1), Solanum lycopersicum SlbHLH13 (XP_004229991.1), and Arabidopsis thaliana AtbHLH13 (AT1G01260). The red box indicates the basic helix-loop-helix DNA-binding domain common in plants.
Figure 3. Multiple sequence alignment of the Wintersweet bHLH13 protein sequence with its homologous proteins from other plant species: Cinnamomum micranthum CmbHLH13 (RWR96436.1), Vitis vinifera VvbHLH13 (RVW95465.1), Malus domestica MdbHLH13 (XP_028955372.1), Nicotiana tabacum NtbHLH13 (XP_016459177.1), Solanum lycopersicum SlbHLH13 (XP_004229991.1), and Arabidopsis thaliana AtbHLH13 (AT1G01260). The red box indicates the basic helix-loop-helix DNA-binding domain common in plants.
Plants 09 00785 g003
Plants 09 00785 g004 550
Figure 4. The transcriptomic expression pattern of (A) CpMYC2 and (B) CpbHLH13 during flower developing stages of H29. The stages are FB: flower bud, DP: display petal, POF: partially-open flower, OF: open flower, SF: senescing flower. Tissue-specific analysis of (C) CpMYC2 and (D) CpbHLH13 expression in wintersweet. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Figure 4. The transcriptomic expression pattern of (A) CpMYC2 and (B) CpbHLH13 during flower developing stages of H29. The stages are FB: flower bud, DP: display petal, POF: partially-open flower, OF: open flower, SF: senescing flower. Tissue-specific analysis of (C) CpMYC2 and (D) CpbHLH13 expression in wintersweet. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Plants 09 00785 g004
Plants 09 00785 g005 550
Figure 5. Expression of (A) the monoterpene synthase genes At1g61680 and At3g25810 in arabidopsis wild type (WT-Col-0), mutant (Salk_083483), and mutant Salk_083483 transformed by the empty vector pCAMBIA2300S (2300S-Sk83) and overexpressed CpMYC2 gene (35S::CpMYC2) plants and (B) the sesquiterpene synthase genes At5g23960 and At5g44630 in arabidopsis wild type (WT-Col-0), wild type transformed by the empty vector pCAMBIA2300S (2300S-Col-0) and overexpressed CpbHLH13 gene (35S::CpbHLH13) plants measured by qRT-PCR. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Figure 5. Expression of (A) the monoterpene synthase genes At1g61680 and At3g25810 in arabidopsis wild type (WT-Col-0), mutant (Salk_083483), and mutant Salk_083483 transformed by the empty vector pCAMBIA2300S (2300S-Sk83) and overexpressed CpMYC2 gene (35S::CpMYC2) plants and (B) the sesquiterpene synthase genes At5g23960 and At5g44630 in arabidopsis wild type (WT-Col-0), wild type transformed by the empty vector pCAMBIA2300S (2300S-Col-0) and overexpressed CpbHLH13 gene (35S::CpbHLH13) plants measured by qRT-PCR. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Plants 09 00785 g005
Plants 09 00785 g006 550
Figure 6. The concentration of emitted linalool (ng g-1 FW h-1) from (A) arabidopsis wild type (WT-Col-0), mutant (Salk_083483), mutant Salk_083483 transformed by the empty vector pCAMBIA2300S (2300S-Sk83) and overexpressed CpMYC2 gene (35S::CpMYC2), and (B) tobacco wild type SR1, transformed by the empty vector pCAMBIA2300S (2300S-SR1) and overexpressed CpMYC2 gene (35S::CpMYC2) plants. Concentration of emitted β-caryophyllene (ng g-1 FW h-1) from (C) arabidopsis wild type (WT-Col-0), wild type transformed by empty vector pCAMBIA2300S (2300S-Col-0) and overexpressed CpbHLH13 gene (35S::CpbHLH13), and (D) tobacco wild type SR1, transformed by the empty vector pCAMBIA2300S (2300S-SR1) and overexpressed CpbHLH13 gene (35S::CpbHLH13) plants. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Figure 6. The concentration of emitted linalool (ng g-1 FW h-1) from (A) arabidopsis wild type (WT-Col-0), mutant (Salk_083483), mutant Salk_083483 transformed by the empty vector pCAMBIA2300S (2300S-Sk83) and overexpressed CpMYC2 gene (35S::CpMYC2), and (B) tobacco wild type SR1, transformed by the empty vector pCAMBIA2300S (2300S-SR1) and overexpressed CpMYC2 gene (35S::CpMYC2) plants. Concentration of emitted β-caryophyllene (ng g-1 FW h-1) from (C) arabidopsis wild type (WT-Col-0), wild type transformed by empty vector pCAMBIA2300S (2300S-Col-0) and overexpressed CpbHLH13 gene (35S::CpbHLH13), and (D) tobacco wild type SR1, transformed by the empty vector pCAMBIA2300S (2300S-SR1) and overexpressed CpbHLH13 gene (35S::CpbHLH13) plants. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Plants 09 00785 g006
Plants 09 00785 g007 550
Figure 7. GC-MS analysis of linalool emitted from the flowers of (A) arabidopsis wild type (WT-Col-0), mutant Salk-083483, transformed by the empty vector pCAMBIA2300S (2300S-Sk83) and overexpressed CpMYC2 gene (35S::CpMYC2) plants, and (B) tobacco wild type SR1, transformed by the empty vector pCAMBIA2300S (2300S-SR1) and overexpressed CpMYC2 gene (35S::CpMYC2) plants. (a) GC-MS chromatogram comparison between different plants. (b) Mass spectrum of the product. (c) Product confirmation in the NIST database according to retention index and mass spectrum.
Figure 7. GC-MS analysis of linalool emitted from the flowers of (A) arabidopsis wild type (WT-Col-0), mutant Salk-083483, transformed by the empty vector pCAMBIA2300S (2300S-Sk83) and overexpressed CpMYC2 gene (35S::CpMYC2) plants, and (B) tobacco wild type SR1, transformed by the empty vector pCAMBIA2300S (2300S-SR1) and overexpressed CpMYC2 gene (35S::CpMYC2) plants. (a) GC-MS chromatogram comparison between different plants. (b) Mass spectrum of the product. (c) Product confirmation in the NIST database according to retention index and mass spectrum.
Plants 09 00785 g007
Plants 09 00785 g008 550
Figure 8. GC-MS analysis of β-caryophyllene emitted from the flowers of (A) tobacco wild type SR1, transformed by the empty vector pCAMBIA2300S (2300S-SR1) and overexpressed CpbHLH13 gene (35S::CpbHLH13) plants; (B) arabidopsis wild type (WT-Col-0), transformed by the empty vector pCAMBIA2300S (2300S-SR1) and overexpressed CpbHLH13 gene (35S:CpbHLH13) plants. (a) GC-MS chromatogram comparison between different plants. (b) Mass spectrum of the product. (c) Product confirmation in the NIST database according to retention index and mass spectrum.
Figure 8. GC-MS analysis of β-caryophyllene emitted from the flowers of (A) tobacco wild type SR1, transformed by the empty vector pCAMBIA2300S (2300S-SR1) and overexpressed CpbHLH13 gene (35S::CpbHLH13) plants; (B) arabidopsis wild type (WT-Col-0), transformed by the empty vector pCAMBIA2300S (2300S-SR1) and overexpressed CpbHLH13 gene (35S:CpbHLH13) plants. (a) GC-MS chromatogram comparison between different plants. (b) Mass spectrum of the product. (c) Product confirmation in the NIST database according to retention index and mass spectrum.
Plants 09 00785 g008
Plants 09 00785 g009 550
Figure 9. The concentration of emitted linalool (ng g-1 FW h-1) after the application of methyl jasmonic acid (MeJA) and gibberellic acid (GA3) from arabidopsis wild type (WT-Col-0), mutant (Salk_083483), mutant Salk_083483 transformed by the empty vector pCAMBIA2300S (2300S-Sk83), and CpMYC2 gene (35S::CpMYC2) plants. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Figure 9. The concentration of emitted linalool (ng g-1 FW h-1) after the application of methyl jasmonic acid (MeJA) and gibberellic acid (GA3) from arabidopsis wild type (WT-Col-0), mutant (Salk_083483), mutant Salk_083483 transformed by the empty vector pCAMBIA2300S (2300S-Sk83), and CpMYC2 gene (35S::CpMYC2) plants. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Plants 09 00785 g009
Plants 09 00785 g010 550
Figure 10. GC-MS analysis of linalool emitted after the application of MeJA and GA3 from the flowers of arabidopsis wild type (WT-Col-0), mutant (Salk_083483), mutant Salk_083483 transformed by the empty vector pCAMBIA2300S (2300S-Sk83), and CpMYC2 gene (35S::CpMYC2) plants. (a) GC-MS chromatogram comparison between different plants. (b) Mass spectrum of the product. (c) Product confirmation in the NIST database according to retention index and mass spectrum.
Figure 10. GC-MS analysis of linalool emitted after the application of MeJA and GA3 from the flowers of arabidopsis wild type (WT-Col-0), mutant (Salk_083483), mutant Salk_083483 transformed by the empty vector pCAMBIA2300S (2300S-Sk83), and CpMYC2 gene (35S::CpMYC2) plants. (a) GC-MS chromatogram comparison between different plants. (b) Mass spectrum of the product. (c) Product confirmation in the NIST database according to retention index and mass spectrum.
Plants 09 00785 g010
Plants 09 00785 g011 550
Figure 11. Expression of the monoterpene synthase genes At1g61680 and At3g25810 in arabidopsis plants by qRT-PCR after the application of MeJA and GA3 in arabidopsis wild type (WT-Col-0), mutant (Salk_083483), mutant Salk_083483 transformed by the empty vector pCAMBIA2300S (2300S-Sk83), and CpMYC2 gene (35S::CpMYC2) plants measured by qRT-PCR. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Figure 11. Expression of the monoterpene synthase genes At1g61680 and At3g25810 in arabidopsis plants by qRT-PCR after the application of MeJA and GA3 in arabidopsis wild type (WT-Col-0), mutant (Salk_083483), mutant Salk_083483 transformed by the empty vector pCAMBIA2300S (2300S-Sk83), and CpMYC2 gene (35S::CpMYC2) plants measured by qRT-PCR. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Plants 09 00785 g011
Plants 09 00785 g012 550
Figure 12. Anthocyanin accumulation from the flowers of (A) overexpressed CpbHLH13 tobacco plants (35S:CpbHLH13), wild type tobacco SR1 (Wild Type-SR1), and tobacco plants transformed by the empty vector pCAMBIA2300S (2300S-SR1). (B) Anthocyanin detection from the described plants. (C) Quantitative anthocyanin concentration in tobacco plants. Scale bar = 1 cm. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Figure 12. Anthocyanin accumulation from the flowers of (A) overexpressed CpbHLH13 tobacco plants (35S:CpbHLH13), wild type tobacco SR1 (Wild Type-SR1), and tobacco plants transformed by the empty vector pCAMBIA2300S (2300S-SR1). (B) Anthocyanin detection from the described plants. (C) Quantitative anthocyanin concentration in tobacco plants. Scale bar = 1 cm. The different letters on the bars show significance between the treatments by using least significant difference (LSD) at p < 0.05.
Plants 09 00785 g012
Table
Table 1. Summary of the homology of wintersweet CpMYC2 with genes from other plants.
Table 1. Summary of the homology of wintersweet CpMYC2 with genes from other plants.
Plant NameGeneIdentity %Gene Function
ArabidopsisAtMYC2 (At1g32640)54.01Activate terpene synthesase
TobaccoTranscription factor MYC2-like57.62Activation of JA responses
TomatoSlMYC257.56Methyl jasmonate inducer
Grape vinePredicted: transcription factor MYC262.01Unknown (Genome data) *
LinderaTranscription factor MYC62.78Accumulation mechanism of β-ocimene
HayataTranscription factor MYC265.13Unknown (Genome data)
LotusTranscription factor MYC2-like62.01Unknown (Genome data)
Wintersweet CpMYC2 was found to be homologous to the following plants with maximum identity: Arabidopsis (Arabidopsis thaliana), tobacco (Nicotiana tabcum), tomato (Solanum lycopersicum), grape vine (Vitis vinifera), lindera (Lindera glauca), hayata (Cinnamomum micranthum), lotus (Nelumbo nucifera). * Gene sequence is from submitted genome data with unknown function.
Table
Table 2. Summary of the homology of wintersweet CpbHLH13 with genes from other plants.
Table 2. Summary of the homology of wintersweet CpbHLH13 with genes from other plants.
Plant NameGeneIdentity %Gene Function
ArabidopsisTranscription factor bHLH13/JAM2 (At1g01260)42.06Interacts with JAZ proteins to negatively regulate jasmonate responses
ArabidopsisTranscription factor bHLH17/JAM1 (At2g46510)44.78Interacts with JAZ proteins to negatively regulate jasmonate responses
TobaccoPredicted: transcription factor bHLH13-like60.26Unknown (Genome data) *
TomatoTranscription factor bHLH13-like59.51Unknown (Genome data)
Grape vineTranscription factor bHLH1362.90Unknown (Genome data)
HayataTranscription factor bHLH1369.77Unknown (Genome data)
LotusPredicted: transcription factor bHLH13-like62.46Unknown (Genome data)
Wintersweet CpbHLH13 was found to be homologous to the following plants with maximum identity: Arabidopsis (Arabidopsis thaliana), tobacco (Nicotiana tabcum), tomato (Solanum lycopersicum), grape vine (Vitis vinifera), hayata (Cinnamomum micranthum), lotus (Nelumbo nucifera). * Gene sequence is from submitted genome data with unknown function.
Table
Table 3. Primers used for PCR for homozygous T-DNA insertion lines.
Table 3. Primers used for PCR for homozygous T-DNA insertion lines.
Primer NamePrimer Sequence (5′–3′)TM C⁰
Salk_083483 LPTGGTTTTTCTTGGTTTCGATG60
Salk_083483 RPCTCTAATCATTGCGTCCCAAC
LBb1.3ATTTTGCCGATTTCGGAAC60
Table
Table 4. Primers for qRT-PCR analysis.
Table 4. Primers for qRT-PCR analysis.
Primer NamePrimer Sequence (5′–3′)TM C⁰
CpMYC2q-FTCCAGTCCAACAAGAAGAACCACCC63.5
CpMYC2q-RCTATCTGTTGCCAATTTTCTCCGCC
CpbHLH13q-FCCTTTGGACACCCACCCG60.5
CpbHLH13q-RCTATAATGAGTTTGATTCACGACTAAATGC
RPL8-FACATTGCCGACCATGAGATTG59
RPL8-RCACTTGCCCGAGTTACCTTT
CpTublin-FGTGCATCTCTATCCACATCG60
CpTublin-RCAAGCTTCCTTATGCGATCC
AtCACS-FTCGATTGCTTGGTTTGGAAGAT60
AtCACS-RGCACTTAGCGTGGACTCTGTTTGATC
AtTubulin-FTCAAGAGGTTCTCAGCAGTA59
AtTubulin-RTCACCTTCTTCATCCGCAGTT
NtNADH-FTTGGTGGATCTGACCTAGTG60
NtNADH-RATGGTGTGAAAGAGCGTTCG
NtCPN60-2-FATGGCACTCTTGATGGGTTC60
NtCPN60-2-RAGCACTAGGCATTGCCATTG
35S-FACGCACAATCCCACTATCCT59
35S-RTGCTCAACACATGAGCGAAAC
At1g61680-FATGATCGATGTCATTCAAAGT52
At1g61680-RTTAAATGTTTGAGACATTTCTC
At3g25810-FTATATTTGATGTAATCATCG53
At3g25810-RTTGAACCATAGCAGTGAAGAG
At5g23960-FGGAACTGAGACGTTCAAAGAG57
At5g23960-RCGCTGTGAATAAGATTAGTGC
At5g44630-FTGGAGGAAAATATAGTGATAT56
At5g44630-RCGGTGCTGAGGTATGTGAAGA
Table
Table 5. Primers of the candidate genes used for PCR amplification.
Table 5. Primers of the candidate genes used for PCR amplification.
Primer NamePrimer Sequence (5′–3′)TM C⁰
CpMYC2-FCGGGGTACCATGAATCTCTGGTCCGACGA63.5
CpMYC2-RCTAGTCTAGACTATCTGTTGCCAATTTTCTCC
CpbHLH13-FCGGGGTACCATGAAATCGGAGATTGGAA60.5
CpbHLH13-RCTAGTCTAGACTATAATGAGTTTGATTCACGA
Underline sequences indicate the restriction enzyme sites.

Share and Cite

MDPI and ACS Style

Aslam, M.Z.; Lin, X.; Li, X.; Yang, N.; Chen, L. Molecular Cloning and Functional Characterization of CpMYC2 and CpBHLH13 Transcription Factors from Wintersweet (Chimonanthus praecox L.). Plants 2020, 9, 785. https://doi.org/10.3390/plants9060785

AMA Style

Aslam MZ, Lin X, Li X, Yang N, Chen L. Molecular Cloning and Functional Characterization of CpMYC2 and CpBHLH13 Transcription Factors from Wintersweet (Chimonanthus praecox L.). Plants. 2020; 9(6):785. https://doi.org/10.3390/plants9060785

Chicago/Turabian Style

Aslam, Muhammad Zeshan, Xiang Lin, Xiang Li, Nan Yang, and Longqing Chen. 2020. "Molecular Cloning and Functional Characterization of CpMYC2 and CpBHLH13 Transcription Factors from Wintersweet (Chimonanthus praecox L.)" Plants 9, no. 6: 785. https://doi.org/10.3390/plants9060785

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop