Next Article in Journal
Physiological Mechanism through Which Al Toxicity Inhibits Peanut Root Growth
Next Article in Special Issue
OsJAZ4 Fine-Tunes Rice Blast Resistance and Yield Traits
Previous Article in Journal
Recent Advances in the Specialized Metabolites Mediating Resistance to Insect Pests and Pathogens in Tea Plants (Camellia sinensis)
Previous Article in Special Issue
Stripe Rust Effector Pst_9302 Inhibits Wheat Immunity to Promote Susceptibility
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 2
10.3390/plants13020324
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Codon Optimization Enables the Geneticin Resistance Gene to Be Applied Efficiently to the Genetic Manipulation of the Plant Pathogenic Fungus Botrytis cinerea

by
Maoyao Tang
1,†,
Yangyizhou Wang
1,†,
Kexin Wang
1,
Yuanhang Zhou
2,
Enshuang Zhao
3,
Hao Zhang
3,
Mingzhe Zhang
1,
Hang Yu
1,
Xi Zhao
1 and
Guihua Li
1,*
1
College of Plant Sciences, Jilin University, Changchun 130062, China
2
Research Management Department, Changchun Academy of Forestry, Changchun 130021, China
3
College of Computer Science and Technology, Jilin University, Changchun 130012, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2024, 13(2), 324; https://doi.org/10.3390/plants13020324
Submission received: 21 December 2023 / Revised: 18 January 2024 / Accepted: 19 January 2024 / Published: 22 January 2024
(This article belongs to the Special Issue Plant Pathology and Epidemiology for Grain, Pulses, and Cereal Crops)
Browse Figures
Versions Notes

Abstract

:
Botrytis cinerea can infect almost all of the important horticultural crops and cause severe economic losses globally every year. Modifying candidate genes and studying the phenotypic changes are among the most effective ways to unravel the pathogenic mechanism of this crop killer. However, few effective positive selection markers are used for B. cinerea genetic transformation, which limits multiple modifications to the genome, especially genes involving redundant functions. Here, we optimized a geneticin resistance gene, BcNPTII, based on the codon usage preference of B. cinerea. We found that BcNPTII can greatly increase the transformation efficiency of B. cinerea under G418 selection, with approximately 30 times higher efficiency than that of NPTII, which is applied efficiently to transform Magnaporthe oryzae. Using the gene replacement method, we successfully knocked out the second gene BOT2, with BcNPTII as the selection marker, from the mutant ΔoahA, in which OAHA was first replaced by the hygromycin resistance gene HPH in a field strain. We obtained the double knockout mutant ΔoahA Δbot2. Our data show that the codon-optimized BcNPTII is an efficient positive selection marker for B. cinerea transformation and can be used for various genetic manipulations in B. cinerea, including field wild-type strains.

1. Introduction

Botrytis cinerea can infect over 1400 plant species, causing grey mould disease [1]. It mainly affects dicotyledonous plants and is a major concern in horticultural crop protection [2]. Grey mould is one of the most serious plant diseases in greenhouse production. The economic losses caused by this disease amount to between USD 10 and 100 billion worldwide annually [3,4]. Additionally, B. cinerea is listed as one of the top 10 plant pathogenic fungi based on its scientific and economic importance [5]. Therefore, B. cinerea has become an important model pathogenic fungus for studying the pathogenicity of highly aggressive necrotrophic fungi and their interaction mechanisms with hosts [5]. B. cinerea mostly uses conidia as the source of primary infection and re-infection of the hosts and is spread through wind, rain, irrigation water, or agricultural operations [6]. Upon reaching the surface of host plants, the conidia germinate and form germ tubes under conditions of low temperature and high humidity. The tips of the germ tubes are induced by signals derived from the host surface and swell slightly and develop into appressoria, or they may undergo further branching and develop into more complex and powerful infection cushions to invade hosts [7]. B. cinerea synthesizes a variety of pathogenic factors to participate in disease, including cell wall-degrading enzymes, cutinase, toxins, enzymes against host immune reactions, sRNA, and metal-chelating proteins [3,8,9]. On the one hand, these factors cooperate to suppress the host’s defense response, and on the other hand, they also assist in the rapid killing of host cells and the decomposition of host tissues as nutrients. Genome sequencing has revealed that B. cinerea is predicted to contain more than 15,000 protein-coding genes, many of which have unknown functions, especially in host infection [10], and a few of them are expected to be set as alternative molecular targets for grey mould control after systematic functional analysis.
One of the most commonly used strategies for gene function analysis is genetic methods, including forward genetics and reverse genetics. To conduct genetic research, it is always necessary to introduce exogenous DNA fragments into B. cinerea, which requires a positive selection marker for screening transformants easily. Currently, the most commonly used selection marker is the hygromycin resistance gene HPH [3,11,12,13]. In addition, other positive selection markers reported for B. cinerea transformation include the bialaphos (or glufosinate) resistance gene BAR [3], the sulfonylurea resistance allele of the Magnaporthe oryzae ILV1 gene [11], the fenhexamid resistance gene (FenR) [14], and the nourseothricin resistance gene (NatR) [14]. In fungi such as M. oryzae, the geneticin resistance gene NPTII has been widely used [15,16,17]. However, geneticin positive selection has not yet been established efficiently for the genetic transformation of B. cinerea.
In this study, we first attempted to use NPTII, the gene applied efficiently to M. oryzae transformation [17], as a positive selection marker for transforming B. cinerea. However, we found that the transformation efficiency was very low. Subsequently, we optimized the NPTII codon according to the usage preference of B. cinerea, and named it BcNPTII. We found that this synthetic gene significantly improved the transformation efficiency of B. cinerea. BcNPTII can also be used for gene double knockout (in combination with HPH). Notably, the new geneticin resistance gene can be efficiently applied to genetic manipulations of field-isolated wild-type B. cinerea strains. This study provides an efficient positive selection marker, BcNPTII, for the genetic manipulation of B. cinerea.

2. Results

2.1. Sensitivity Test of B. cinerea to Geneticin

To establish an efficient geneticin genetic transformation system in B. cinerea, it is necessary to determine the appropriate concentration of antibiotic geneticin (G418) for selecting transformants. We performed a geneticin concentration gradient experiment to assess the sensitivity of B. cinerea to geneticin. Growth analysis of colonies formed on PDA plates supplemented with different concentrations of G418 showed that B. cinerea is very sensitive to G418 compared to the rice blast fungus. Using inoculation with mycelial plugs, we found that 10 mg/L G418 significantly inhibited the growth of the B. cinerea strain B05.10, and when the concentration was increased to 25 mg/L, the growth of B05.10 was completely suppressed, and the colonies were unable to expand from the inoculated agar plugs (Figure 1A). M. oryzae requires about 400 mg/L G418 for growth suppression.
Subsequently, we used the conidial inoculation method and tested the inhibitory effects of different concentrations of geneticin on conidial germination. Similar results to the mycelial plug inoculation experiment were obtained. We found that 10–20 mg/L G418 significantly inhibited the colony growth of B05.10, and no growth was observed when the G418 concentration was increased to 50 mg/L (Figure 1B and Figure S1). Microscopic observation revealed that 50 mg/L G418 completely inhibited the germination of B. cinerea conidia (Figure 1C). Based on the above analysis, we determined that 50 mg/L or higher G418 is the appropriate selection concentration for the genetic transformation of B. cinerea, and this concentration was used subsequently.

2.2. Codon Optimization of the Geneticin Resistance Gene NPTII Based on the Codon Usage Preference of B. cinerea

We first attempted to use NPTII, the gene applied efficiently to M. oryzae, to transform B. cinerea. However, the transformation efficiency was very low. We speculate that the codon usage of NPTII might not be consistent with that of B. cinerea. Codon analysis (http://www.kazusa.or.jp/codon/ (accessed on 8 August 2021)) showed that the coding GC content of the B. cinerea genome is 46.6%, which is significantly lower compared to that of the rice blast fungus at 56.3%. The two strains exhibit substantial differences in codon usage preference, which explains the efficient performance of NPTII in the rice blast fungus but lower effectiveness in B. cinerea. For example, the Arg codon CGC is used at a rate of 30.9% in the rice blast fungus and NPTII, but only 14.6% in B. cinerea. Similarly, the CGG codon is used at a rate of 13.9% in the rice blast fungus, but only 6.8% in B. cinerea. The Leu codon CTG is utilized at a rate of 28.9% in the rice blast fungus and NPTII, but only 10.7% in B. cinerea. Additionally, the Pro codon CCG is used at a rate of 26.1% in the rice blast fungus and NPTII, but only 11.4% in B. cinerea. The Thr codon ACG is used at a rate of 25% in the rice blast fungus and NPTII, but only 12.4% in B. cinerea (Table S1).
Since the codon usage of NPTII did not follow that of B. cinerea and was not suitable for the efficient transformation of this fungus, we subsequently optimized the codons of NPTII according to the usage preference of B. cinerea. A systematic codon optimization of the geneticin resistance gene NPTII was performed, following the strategy used for the codon optimization of the GFP gene in B. cinerea [18]. For each amino acid in the optimized gene, the top two most frequently used codons in B. cinerea were selected and differentially assigned based on their frequency of usage. Additionally, in the final CDS sequence, restriction endonuclease cleavage sites used frequently were removed (Table S1) to facilitate subsequent cloning. The new geneticin resistance gene optimized here was named BcNPTII, whose sequence was deposited in the Genbank database, and the accession number is OR921207.

2.3. The Codon-Optimized Gene BcNPTII Significantly Enhances the Transformation Efficiency of B. cinerea under the Selection Pressure of Geneticin

To assess the efficiency of the optimized gene BcNPTII as a positive selection marker for genetic transformation in B. cinerea, we synthesized and cloned this gene into a binary vector pXE [11] under the control of the trpC promoter from Aspergillus nidulans (PtrpC), resulting in the vector pXEGbc (Figure 2A). Similarly, we subcloned the NPTII gene used in M. oryzae into pXE, also controlled by PtrpC, to construct pXEG as a control. Subsequently, we employed the Agrobacterium tumefaciens-mediated transformation (ATMT) method to introduce the T-DNA region of both vectors into the B. cinerea strain B05.10 and selected transformants using PDA media containing 50 mg/L G418.
The results indicated that NPTII, which is suitable for M. oryzae transformation, yielded only a small number of transformants for B. cinerea, with approximately 41 ± 20 transformants per 106 conidia. However, after codon optimization, the transformation efficiency significantly increased, resulting in approximately 1214 ± 89 transformants per 106 conidia, representing an approximately 30-fold increase in transformation efficiency (Figure 2B). PCR analysis demonstrated that a partial fragment of the codon-optimized gene BcNPTII was successfully amplified from eight randomly selected transformants (Figure 2C), confirming that the resistant strains obtained were positive transformants. Additionally, four randomly selected NPTII and BcNPTII transformants were analyzed for differences in resistance levels to geneticin. It was observed that when the G418 concentration was increased to 200 mg/L, the growth of the BcNPTII transformant B7 was significantly faster than that of the NPTII transformants, while B9 exhibited slightly faster growth (Figure S2). These results indicate that the codon-optimized gene BcNPTII can be used efficiently for random insertion into the genome of B. cinerea by generating transformants with varying degrees of increased resistance to geneticin.

2.4. The Codon-Optimized Gene BcNPTII Can Be Used for Gene Double Knockout in B. cinerea, Even Using a Field Wild-Type Strain

One of the most effective methods for deciphering the function of target genes in pathogenic fungi is to knock out the gene and define its function by analyzing the defects of resulting mutants. Given the common occurrence of gene functional redundancy, a reverse genetic strategy through gene replacement to elucidate the function of such genes often requires knocking out two or more functionally redundant genes simultaneously to observe the defective phenotype. This requires the combined use of multiple positive screening markers. To determine whether the optimized BcNPTII in this paper can be applied to multiple gene knockouts, we used BcNPTII to knock out the second gene BOT2, a key gene for the synthesis of the phytotoxin botrydial [19,20], from mutant ΔoahA, in which the key gene OAHA required for oxalic acid synthesis [21] had been knocked out already by replacement with the hygromycin resistance gene HPH (Figure 3A).
Additionally, to confirm whether our optimized geneticin resistance gene can be used for the genetic transformation of field wild-type strains, we performed this double knockout experiment using a field strain, CLS1, isolated from a Chinese greenhouse. Firstly, we replaced the gene OAHA in strain CLS1 with HPH, resulting in the deletion mutant ΔoahA. Subsequently, we introduced the BOT2 knockout fragment based on BcNPTII into this mutant using ATMT. After selection on PDA supplemented with 50 mg/L G418, we randomly picked seven transformants for molecular analysis. Primers NU and GbR-RC were used for detecting upstream homologous recombination at the BOT2 locus in the transformants. The expected recombination would result in a 1.9 kb fragment amplification, while the wild type and knockout vector should not produce any bands. The results showed that transformants #2 and #4 matched the expected pattern (Figure 3B). We also obtained the same results when checking for downstream recombination events using primers GbF-RC and ND; transformants #2 and #4 exhibited the expected gene replacement (Figure 3C), which indicated that BOT2 was replaced with BcNPTII in the two transformants. Furthermore, we amplified an internal fragment of BOT2 using primers BOT2-F and BOT2-R; the result was consistent with the homologous recombination detection mentioned above. In transformants #2 and #4, BOT2 was not detected, while the amplification of the control gene BOA6 was normal (Figure 3D). All of these results indicate that we successfully replaced the BOT2 gene with the optimized gene BcNPTII from the mutant ΔoahA, obtaining the double knockout mutant ΔoahA Δbot2. Our data suggest that the optimized gene BcNPTII can be used in combination with other positive selection markers for gene double or multiple knockouts, even using field wild-type strains.

3. Discussion

Many resistance genes or reporter genes that work well in filamentous fungi such as M. oryzae often show poor performance when directly used in B. cinerea, mainly due to the substantial differences in codon usage preference between B. cinerea and other filamentous fungi such as M. oryzae [18]. In this study, according to the codon usage preference of B. cinerea, we optimized the codons of the geneticin resistance gene and found it can be effectively used as a positive selection marker for B. cinerea genetic transformation.
We found that B. cinerea was more sensitive to G418, and 50 mg/L G418 completely inhibited the conidial germination or the mycelium growth of B. cinerea compared to the higher G418 concentration used in positive selection against other fungi, e.g., 400 mg/L for M. oryzae [15], 250 mg/L for Paecilomyces lilacinus [22], and 200 mg/L for Ashbya gossypii [23] and Fusarium oxysporum [24]. We recommend 50–75 mg/L G418 for the genetic transformation of B. cinerea.
Our study showed that using the optimized BcNPTII as a positive selection marker for transforming B. cinerea resulted in a much higher number of transformants, with an approximately 30-fold increase in transformation efficiency. Due to the substantial differences in codon usage preference between M. oryzae and B. cinerea (Table S1), the expression level of NPTII used for the rice blast fungus was too low to withstand selection pressure when used to transform B. cinerea, resulting in very few transformants growing on the selection plates. Only when the expression of NPTII reached a certain level could the transformants grow under selection pressure. In addition to codon preference, the expression level of exogenous genes in transformants is also influenced by the insertion site in the genome. When the gene is inserted into regions containing enhancers nearby, the expression level of the positive selection marker can reach a level that allows the transformants to overcome selection pressure and be selected. This explains the phenomenon that, even when using the not codon-optimized gene NPTII, a small number of transformants could still be obtained despite the low transformation efficiency. Nevertheless, when the selection pressure increased, the resistance level of the transformants containing the optimized gene generally showed varying degrees of improvement.
To simultaneously knock out multiple genes in a strain, sexual mating can be used to gather single-gene deletions into the same descendant strain [1]. However, due to the complex nature of sexual reproduction and tetrad analysis in filamentous fungi, especially in heterothallic fungi like B. cinerea, this method is relatively inefficient. Recently, with the rapid development of gene editing technology, a single positive selection marker loaded onto a mini-chromosome in B. cinerea allows for the sequential knockout of target genes, resulting in strains with multiple gene knockouts [14]. However, considering the multinucleate nature of B. cinerea, this strategy sometimes has low efficiency in obtaining homozygous mutants [25], in addition to carrying a certain degree of off-target risk, and requires further optimization and improvement. Presently, for simultaneously knocking out multiple genes in B. cinerea, the classical method using different positive selection markers to individually knock out target genes through homologous recombination remains one of the most efficient ways. This study contributes new and useful positive selection markers for multi-gene knockout in B. cinerea.
The codon-optimized geneticin resistance gene BcNPTII reported in this paper can be applied to the construction of random insertional mutant libraries of B. cinerea, the expression of exogenous functional genes, reporting genes such as GFP, and genetic complementation. It can also be used for gene knockout, especially in combination with other selection markers for double or multiple gene knockouts. Both model strains and field isolates of B. cinerea were efficiently transformed. Notably, we used PtrpC instead of POlic to drive BcNPTII to reserve the strong promoter POlic for the overexpression of reporter genes such as GFP, ensuring sufficient expression levels to meet the needs of related research. In summary, the codon-optimized BcNPTII can be efficiently applied to the analysis of the pathogenesis of B. cinerea, which will help to identify more alternative molecular targets for disease control. Since the codon usage preferences of Sclerotinia sclerotiorum and B. cinerea are very similar [10], it is speculated that the optimized BcNPTII described in this paper can be used as a positive selection marker gene for genetic transformation in S. sclerotiorum. With the use of the similar codon-optimization method, other low-efficiency positive selection markers, such as BAR, IVL1, etc., may also be improved for the efficient genetic transformation of the grey mould fungus.

4. Materials and Methods

4.1. Botrytis cinerea Strains and Culture Conditions

The B. cinerea strains used in this study are listed in Table 1. Wild-type strain B05.10 and a Chinese field strain CLS1 were used in genetic modifications or as control strains. All strains were cultivated and maintained on potato dextrose agar (PDA) plates as previously described [11].

4.2. Synthesis of the Codon-Optimized Geneticin Resistance Gene and Construction of the Random Insertion Binary Vector

The codon-optimized version of B. cinerea NPTII (BcNPTII) was synthesized by GENEWIZ (Suzhou, China) and was cloned into the pUC57 cloning vector via EcoR V. Kpn I and BamH I sites were included during synthesis for the generation of the expression constructs (see below). For transformation, the coding sequence of BcNPTII was digested with Kpn I and BamH I and subcloned into pXE, a binary vector used for fungal genetic transformation [11], to generate pXEGbc (Table 2). For comparative analysis, the NPTII expression cassette used for Magnaporthe oryzae transformation [17] was subcloned into pXE by digestion with Kpn I and Sal I and subsequent ligation to generate pXEG (Table 2).

4.3. Construction of the Knockout Vector

The method for constructing a knockout vector for gene BOT2 of B. cinerea is as follows. With the use of primers BOT2-UP-F/BOT2-UP-R and B05.10 genomic DNA as a template, a 1020 bp fragment upstream of BOT2 was amplified with Q5 high-fidelity DNA polymerase (NEB, Ipswich, MA, USA). With the use of primers BOT2-DN-F/BOT2-DN-R (Table 3), a 959 bp fragment downstream of BOT2 was amplified. The NEBuilder HiFi DNA Assembly Cloning Kit (NEB, Ipswich, MA, USA) was then used to clone the above two DNA amplification products via recombination into the respective Hind III and Kpn I sites of the pXEGbc vector, with the codon-optimized BcNPTII in between, to construct the knockout vector pBOT2-ko, which was subsequently confirmed by sequencing.

4.4. Genetic Transformation of B. cinerea

The random insertion binary vectors pXEG and pXEGbc, or the knockout vector pBOT2-ko, were transformed into the Agrobacterium tumefaciens strain AGL-1, and Agrobacterium tumefaciens-mediated transformation (ATMT) was used to obtain fungal transformants following the methods reported previously [27,28,29]. Transformants were selected using PDA media containing 50 mg/L G418.

4.5. Molecular Analysis of Transformants

Isolation of B. cinerea genomic DNA was performed according to a documented protocol [30]. The BOT2 knockout strains were screened by PCR amplifications as follows. Primers NU/GbR-RC and GbF-RC/ND (Table 3) were used to detect whether homologous recombination had occurred upstream and downstream, respectively, of the target gene. Primers BOT2-F/BOT2-R (Table 3) were used to determine if the target gene was no longer present in the genome.

4.6. Sensitivity Analysis of B. cinerea to Geneticin

To test the sensitivity of B. cinerea to geneticin, G418 concentration gradient experiments were performed. Briefly, mycelial plugs of B05.10 were inoculated on PDA plates supplemented with G418 at concentrations of 0, 1, 10, and 25 mg/L. To test the conidial sensitivity to geneticin, two μL 2 × 105 mL−1 conidial suspensions of B05.10 were inoculated on PDA plates supplemented with G418 at concentrations of 0, 5, 10, 15, 20, and 50 mg/L. Colony growth was assayed at 3–4 days post inoculation (DPI). To test the ability of geneticin to suppress conidial germination, ten μL 2 × 105 mL−1 conidial suspension in PDB media supplemented with or without 50 mg/L G418 was inoculated on slides and observed at 12 h post inoculation (HPI).
The size (diameter or radius) of the colonies grown under G418 pressure was used to reflect the sensitivity of the strain to G418. Under the same G418 concentration, the smaller the colony size, the more sensitive the strain to G418. The resistance level of a strain was reflected by calculating the percentage colony size with G418 compared to that without G418. Colonies grown on PDA plates supplemented with different concentrations of G418 were photographed, and their diameter or radius was measured and calculated using ImageJ software v1.52v (https://imagej.en.softonic.com/download (accessed on 15 May 2023)).

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/plants13020324/s1, Figure S1: Quantification of the radial growth (in diameter) of B05.10 at 3 days post inoculation (DPI) on PDA plates supplemented with different concentrations of G418; Figure S2: The transformants derived from the codon-optimized gene BcNPTII show varying degrees of increased resistance to geneticin; Table S1: Codon usage of fungal genes and the two geneticin resistance genes.

Author Contributions

Conceptualization, G.L.; methodology, M.T., Y.W., K.W., Y.Z., E.Z., H.Y., X.Z. and G.L.; resources, M.T., Y.W. and G.L.; supervision, G.L., H.Z. and M.Z.; writing—original draft preparation, G.L.; project administration, G.L.; funding acquisition, G.L. and H.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Natural Science Foundation of Jilin Province, China (grant number 20220101279JC), the National Natural Science Foundation of China (grant number 62072210), and the National Undergraduate Innovative and Entrepreneurship Training Program, China (202210183334).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The authors would like to thank the anonymous reviewers for their constructive comments on this article.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Fillinger, S.; Elad, Y. Botrytis—The Fungus, the Pathogen and Its Management in Agricultural Systems; Springer: New York, NY, USA, 2016. [Google Scholar] [CrossRef]
  2. Williamson, B.; Tudzynski, B.; Tudzynski, P.; van Kan, J.A. Botrytis cinerea: The cause of grey mould disease. Mol. Plant Pathol. 2007, 8, 561–580. [Google Scholar] [CrossRef] [PubMed]
  3. Weiberg, A.; Wang, M.; Lin, F.M.; Zhao, H.; Zhang, Z.; Kaloshian, I.; Huang, H.D.; Jin, H. Fungal small RNAs suppress plant immunity by hijacking host RNA interference pathways. Science 2013, 342, 118–123. [Google Scholar] [CrossRef] [PubMed]
  4. Veloso, J.; van Kan, J.A.L. Many Shades of Grey in Botrytis-Host Plant Interactions. Trends Plant Sci. 2018, 23, 613–622. [Google Scholar] [CrossRef] [PubMed]
  5. Dean, R.; Van Kan, J.A.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [PubMed]
  6. Petrasch, S.; Knapp, S.J.; van Kan, J.A.L.; Blanco-Ulate, B. Grey mould of strawberry, a devastating disease caused by the ubiquitous necrotrophic fungal pathogen Botrytis cinerea. Mol. Plant Pathol. 2019, 20, 877–892. [Google Scholar] [CrossRef] [PubMed]
  7. Choquer, M.; Rascle, C.; Goncalves, I.R.; de Vallee, A.; Ribot, C.; Loisel, E.; Smilevski, P.; Ferria, J.; Savadogo, M.; Souibgui, E.; et al. The infection cushion of Botrytis cinerea: A fungal ‘weapon’ of plant-biomass destruction. Environ. Microbiol. 2021, 23, 2293–2314. [Google Scholar] [CrossRef] [PubMed]
  8. Choquer, M.; Fournier, E.; Kunz, C.; Levis, C.; Pradier, J.M.; Simon, A.; Viaud, M. Botrytis cinerea virulence factors: New insights into a necrotrophic and polyphageous pathogen. FEMS Microbiol. Lett. 2007, 277, 1–10. [Google Scholar] [CrossRef]
  9. Liu, L.; Gueguen-Chaignon, V.; Goncalves, I.R.; Rascle, C.; Rigault, M.; Dellagi, A.; Loisel, E.; Poussereau, N.; Rodrigue, A.; Terradot, L.; et al. A secreted metal-binding protein protects necrotrophic phytopathogens from reactive oxygen species. Nat. Commun. 2019, 10, 4853. [Google Scholar] [CrossRef]
  10. Amselem, J.; Cuomo, C.A.; van Kan, J.A.; Viaud, M.; Benito, E.P.; Couloux, A.; Coutinho, P.M.; de Vries, R.P.; Dyer, P.S.; Fillinger, S.; et al. Genomic analysis of the necrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLoS Genet. 2011, 7, e1002230. [Google Scholar] [CrossRef]
  11. Feng, H.Q.; Li, G.H.; Du, S.W.; Yang, S.; Li, X.Q.; de Figueiredo, P.; Qin, Q.M. The septin protein Sep4 facilitates host infection by plant fungal pathogens via mediating initiation of infection structure formation. Environ. Microbiol. 2017, 19, 1730–1749. [Google Scholar] [CrossRef]
  12. Qin, S.; Veloso, J.; Baak, M.; Boogmans, B.; Bosman, T.; Puccetti, G.; Shi-Kunne, X.; Smit, S.; Grant-Downton, R.; Leisen, T.; et al. Molecular characterization reveals no functional evidence for naturally occurring cross-kingdom RNA interference in the early stages of Botrytis cinerea-tomato interaction. Mol. Plant Pathol. 2023, 24, 3–15. [Google Scholar] [CrossRef] [PubMed]
  13. Sun, J.; Sun, C.H.; Chang, H.W.; Yang, S.; Liu, Y.; Zhang, M.Z.; Hou, J.; Zhang, H.; Li, G.H.; Qin, Q.M. Cyclophilin BcCyp2 Regulates Infection-Related Development to Facilitate Virulence of the Gray Mold Fungus Botrytis cinerea. Int. J. Mol. Sci. 2021, 22, 1694. [Google Scholar] [CrossRef] [PubMed]
  14. Leisen, T.; Bietz, F.; Werner, J.; Wegner, A.; Schaffrath, U.; Scheuring, D.; Willmund, F.; Mosbach, A.; Scalliet, G.; Hahn, M. CRISPR/Cas with ribonucleoprotein complexes and transiently selected telomere vectors allows highly efficient marker-free and multiple genome editing in Botrytis cinerea. PLoS Pathog. 2020, 16, e1008326. [Google Scholar] [CrossRef] [PubMed]
  15. Bhadauria, V.; Banniza, S.; Vandenberg, A.; Selvaraj, G.; Wei, Y. Peroxisomal alanine: Glyoxylate aminotransferase AGT1 is indispensable for appressorium function of the rice blast pathogen, Magnaporthe oryzae. PLoS ONE 2012, 7, e36266. [Google Scholar] [CrossRef] [PubMed]
  16. Kim, S.; Park, S.Y.; Kim, K.S.; Rho, H.S.; Chi, M.H.; Choi, J.; Park, J.; Kong, S.; Park, J.; Goh, J.; et al. Homeobox transcription factors are required for conidiation and appressorium development in the rice blast fungus Magnaporthe oryzae. PLoS Genet. 2009, 5, e1000757. [Google Scholar] [CrossRef]
  17. Nguyen, Q.B.; Kadotani, N.; Kasahara, S.; Tosa, Y.; Mayama, S.; Nakayashiki, H. Systematic functional analysis of calcium-signaling proteins in the genome of the rice-blast fungus, Magnaporthe oryzae, using a high-throughput RNA-silencing system. Mol. Microbiol. 2008, 68, 1348–1365. [Google Scholar] [CrossRef] [PubMed]
  18. Leroch, M.; Mernke, D.; Koppenhoefer, D.; Schneider, P.; Mosbach, A.; Doehlemann, G.; Hahn, M. Living colors in the gray mold pathogen Botrytis cinerea: Codon-optimized genes encoding green fluorescent protein and mCherry, which exhibit bright fluorescence. Appl. Environ. Microbiol. 2011, 77, 2887–2897. [Google Scholar] [CrossRef]
  19. Pinedo, C.; Wang, C.M.; Pradier, J.M.; Dalmais, B.; Choquer, M.; Le Pecheur, P.; Morgant, G.; Collado, I.G.; Cane, D.E.; Viaud, M. Sesquiterpene synthase from the botrydial biosynthetic gene cluster of the phytopathogen Botrytis cinerea. ACS Chem. Biol. 2008, 3, 791–801. [Google Scholar] [CrossRef]
  20. Dalmais, B.; Schumacher, J.; Moraga, J.; Le Pêcheur, P.; Tudzynski, B.; Collado, I.G.; Viaud, M. The Botrytis cinerea phytotoxin botcinic acid requires two polyketide synthases for production and has a redundant role in virulence with botrydial. Mol. Plant Pathol. 2011, 12, 564–579. [Google Scholar] [CrossRef]
  21. Han, Y.; Joosten, H.J.; Niu, W.L.; Zhao, Z.M.; Mariano, P.S.; McCalman, M.; van Kan, J.; Schaap, P.J.; Dunaway-Mariano, D. Oxaloacetate hydrolase, the C-C bond lyase of oxalate secreting fungi. J. Biol. Chem. 2007, 282, 9581–9590. [Google Scholar] [CrossRef]
  22. Liu, X.; Wang, X.; Wang, L.; Shu, Q.; Cao, Z. Generation of green fluorescent protein vector transformed Paecilomyces lilacinus Strains. Afr. J. Microbiol. Res. 2013, 7, 1114–1120. [Google Scholar]
  23. Ayad-Durieux, Y.; Knechtle, P.; Goff, S.; Dietrich, F.; Philippsen, P. A PAK-like protein kinase is required for maturation of young hyphae and septation in the filamentous ascomycete Ashbya gossypii. J. Cell Sci. 2000, 113, 4563–4575. [Google Scholar] [CrossRef] [PubMed]
  24. Namiki, F.; Matsunaga, M.; Okuda, M.; Inoue, I.; Nishi, K.; Fujita, Y.; Tsuge, T. Mutation of an arginine biosynthesis gene causes reduced pathogenicity in Fusarium oxysporum f. sp. melonis. Mol. Plant Microbe Interact. 2001, 14, 580–584. [Google Scholar] [CrossRef] [PubMed]
  25. Hahn, M.; Scalliet, G. One Cut to Change Them All: CRISPR/Cas, a Groundbreaking Tool for Genome Editing in Botrytis cinerea and Other Fungal Plant Pathogens. Phytopathology 2021, 111, 474–477. [Google Scholar] [CrossRef] [PubMed]
  26. Quidde, T.; Osbourn, A.E.; Tudzynski, P. Detoxification of α-tomatine by Botrytis cinerea. Physiol. Mol. Plant Pathol. 1998, 52, 151–165. [Google Scholar] [CrossRef]
  27. Mullins, E.D.; Chen, X.; Romaine, P.; Raina, R.; Geiser, D.M.; Kang, S. Agrobacterium-Mediated Transformation of Fusarium oxysporum: An Efficient Tool for Insertional Mutagenesis and Gene Transfer. Phytopathology 2001, 91, 173–180. [Google Scholar] [CrossRef]
  28. Cao, S.N.; Yuan, Y.; Qin, Y.H.; Zhang, M.Z.; de Figueiredo, P.; Li, G.H.; Qin, Q.M. The pre-rRNA processing factor Nop53 regulates fungal development and pathogenesis via mediating production of reactive oxygen species. Environ. Microbiol. 2018, 20, 1531–1549. [Google Scholar] [CrossRef]
  29. Liu, J.K.; Chang, H.W.; Liu, Y.; Qin, Y.; Ding, Y.H.; Wang, L.; Zhao, Y.; Zhang, M.Z.; Cao, S.N.; Li, L.T.; et al. The key gluconeogenic gene is crucial for virulence of Botrytis cinerea via initiating its conidia germination and host penetration. Environ. Microbiol. 2018, 20, 1794–1814. [Google Scholar] [CrossRef]
  30. Chi, M.H.; Park, S.Y.; Lee, Y.H. A Quick and Safe Method for Fungal DNA Extraction. Plant Pathol. J. 2009, 25, 108–111. [Google Scholar] [CrossRef]
Plants 13 00324 g001
Figure 1. Sensitivity test of Botrytis cinerea to geneticin. (A) Mycelial plugs of B05.10 were inoculated on PDA plates supplemented with G418 at concentrations of 0, 1, 10, and 25 mg/L. Photographs were taken at 3.5 days post inoculation (DPI). 90 mm plates were used. Bar = 15 mm. Edges of the colonies are marked with red circles; (B) Conidial suspensions of B05.10 were inoculated on PDA plates supplemented with G418 at concentrations of 0, 5, 10, 15, 20, and 50 mg/L. Photographs were taken at 3 DPI. 70 mm plates were used. Bar = 15 mm. (C) Conidial germination in PDB media supplemented with or without G418 at 12 h post inoculation (HPI). Bar = 20 μm.
Figure 1. Sensitivity test of Botrytis cinerea to geneticin. (A) Mycelial plugs of B05.10 were inoculated on PDA plates supplemented with G418 at concentrations of 0, 1, 10, and 25 mg/L. Photographs were taken at 3.5 days post inoculation (DPI). 90 mm plates were used. Bar = 15 mm. Edges of the colonies are marked with red circles; (B) Conidial suspensions of B05.10 were inoculated on PDA plates supplemented with G418 at concentrations of 0, 5, 10, 15, 20, and 50 mg/L. Photographs were taken at 3 DPI. 70 mm plates were used. Bar = 15 mm. (C) Conidial germination in PDB media supplemented with or without G418 at 12 h post inoculation (HPI). Bar = 20 μm.
Plants 13 00324 g001
Plants 13 00324 g002
Figure 2. The codon-optimized gene BcNPTII significantly enhances the transformation efficiency of B. cinerea under the selection pressure of geneticin. (A) The binary vector pXEGbc is used for Agrobacterium tumefaciens-mediated genetic transformation (ATMT), and it contains BcNPTII (geneticinR) controlled by the PtrpC promoter and the TniaD terminator. (B) Quantitative analysis of the transformation efficiency of BcNPTII and NPTII with the ATMT method. Data represent means ± standard deviations (SD) of three independent experiments. *** indicates statistical significance at p < 0.01. (C) Identification of randomly selected geneticin-resistant transformants via PCR amplification with specific primers of BcNPTII. The templates of lanes 1–8 are transformants (lane 2, transformant B7; lane 4, transformant B9), p and WT indicate the templates are plasmid pXEGbc and the wild-type B05.10, respectively.
Figure 2. The codon-optimized gene BcNPTII significantly enhances the transformation efficiency of B. cinerea under the selection pressure of geneticin. (A) The binary vector pXEGbc is used for Agrobacterium tumefaciens-mediated genetic transformation (ATMT), and it contains BcNPTII (geneticinR) controlled by the PtrpC promoter and the TniaD terminator. (B) Quantitative analysis of the transformation efficiency of BcNPTII and NPTII with the ATMT method. Data represent means ± standard deviations (SD) of three independent experiments. *** indicates statistical significance at p < 0.01. (C) Identification of randomly selected geneticin-resistant transformants via PCR amplification with specific primers of BcNPTII. The templates of lanes 1–8 are transformants (lane 2, transformant B7; lane 4, transformant B9), p and WT indicate the templates are plasmid pXEGbc and the wild-type B05.10, respectively.
Plants 13 00324 g002
Plants 13 00324 g003
Figure 3. The codon-optimized gene BcNPTII was effectively used for BOT2 knockout from the mutant ΔoahA to generate double knockout strains. ΔoahA was generated from CLS1, a Chinese field strain. (A) The strategy for the generation of the BOT2 knockout mutant via the gene replacement approach; (B–D) Identification of the BOT2 knockout mutant via PCR amplification with the indicated primers by detecting BOT2 upstream recombination (B), detecting downstream recombination (C), and detecting BOT2 loss, with BOA6 presence as a control (D). Numbers 1–7 indicate randomly selected transformants, P indicates plasmid pXEGbc, and ΔoahA indicates the deletion mutant of OAHA of the CLS1 strain.
Figure 3. The codon-optimized gene BcNPTII was effectively used for BOT2 knockout from the mutant ΔoahA to generate double knockout strains. ΔoahA was generated from CLS1, a Chinese field strain. (A) The strategy for the generation of the BOT2 knockout mutant via the gene replacement approach; (B–D) Identification of the BOT2 knockout mutant via PCR amplification with the indicated primers by detecting BOT2 upstream recombination (B), detecting downstream recombination (C), and detecting BOT2 loss, with BOA6 presence as a control (D). Numbers 1–7 indicate randomly selected transformants, P indicates plasmid pXEGbc, and ΔoahA indicates the deletion mutant of OAHA of the CLS1 strain.
Plants 13 00324 g003
Table 1. Strains of Botrytis cinerea used in this paper.
Table 1. Strains of Botrytis cinerea used in this paper.
StrainDescriptionSource
B05.10Wild-type strain[26]
CLS1A Chinese field strain (Wild-type strain)This study
N2NPTII random insertion in B05.10This study
N4NPTII random insertion in B05.10This study
B7BcNPTII random insertion in B05.10This study
B9BcNPTII random insertion in B05.10This study
ΔoahABcOAHA gene knockout (ΔBcoahA::HPH) in CLS1This study
ΔoahA Δbot2Double gene knockout (ΔBcoahA::HPH; ΔBcbot2::BcNPTII) in CLS1This study
Table 2. Vectors used in this paper.
Table 2. Vectors used in this paper.
VectorDescriptionSource
pXEHBinary vector used for knockout of fungal genes, containing the HPH gene within its T-DNA region; KmR[11]
pXEGBinary vector used for knockout of fungal genes, containing the NPTII gene within its T-DNA region; KmRThis study
pXEGbcBinary vector used for knockout of fungal genes, containing the BcNPTII gene within its T-DNA region; KmRThis study
pBOT2-koBinary vector used for knockout of BcBOT2, containing the BcNPTII gene within its T-DNA region; KmRThis study
Table 3. Primers used in this paper.
Table 3. Primers used in this paper.
NameSequence (5′–3′)
For identification of BcNPTII
GbFGGCACAACAGACAATCGG
GbRATCACGGGTAGCCAAAGC
For construction of the BOT2 knockout vector
BOT2-UP-FtgggaattcgagctcggtacAGGTCCTGTTGACATGGAATC
BOT2-UP-RagtcgacctgcaggcatgcaCGGAACACGAACGAATGG
BOT2-DN-FccttcaatatcagttggtacTGGGCTAAGCACAGGACAATG
BOT2-DN-RaatgcggctccacagctgcaCCTCCCGATGATAAGGGTTC
For Screening the BOT2 knockout strains
NUTGGACAACCTTGAGGACGAG
NDGCGGAGTTGCCTTGGAGT
GbF-RCCCGATTGTCTGTTGTGCC
GbR-RCGCTTTGGCTACCCGTGAT
For identification of BOT2
BOT2-FGACTGGAATCATTGGGTTTG
BOT2-RGCGTTTGTGCTGGTCTATC
For identification of BOA6 (to confirm the genomic DNAs of transformants were suitable for amplification)
BOA6-FAACTCGGCAATCGAACCT
BOA6-RGCAGCATAAGCAGCACCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tang, M.; Wang, Y.; Wang, K.; Zhou, Y.; Zhao, E.; Zhang, H.; Zhang, M.; Yu, H.; Zhao, X.; Li, G. Codon Optimization Enables the Geneticin Resistance Gene to Be Applied Efficiently to the Genetic Manipulation of the Plant Pathogenic Fungus Botrytis cinerea. Plants 2024, 13, 324. https://doi.org/10.3390/plants13020324

AMA Style

Tang M, Wang Y, Wang K, Zhou Y, Zhao E, Zhang H, Zhang M, Yu H, Zhao X, Li G. Codon Optimization Enables the Geneticin Resistance Gene to Be Applied Efficiently to the Genetic Manipulation of the Plant Pathogenic Fungus Botrytis cinerea. Plants. 2024; 13(2):324. https://doi.org/10.3390/plants13020324

Chicago/Turabian Style

Tang, Maoyao, Yangyizhou Wang, Kexin Wang, Yuanhang Zhou, Enshuang Zhao, Hao Zhang, Mingzhe Zhang, Hang Yu, Xi Zhao, and Guihua Li. 2024. "Codon Optimization Enables the Geneticin Resistance Gene to Be Applied Efficiently to the Genetic Manipulation of the Plant Pathogenic Fungus Botrytis cinerea" Plants 13, no. 2: 324. https://doi.org/10.3390/plants13020324

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop