Metals Induce Genotoxicity in Three Cardoon Cultivars: Relation to Metal Uptake and Distribution in Extra- and Intracellular Fractions
Abstract
:1. Introduction
2. Results
2.1. DNA Variability and Genotoxic Effect
2.2. Chemical Analyses
2.3. Leaf Epidermal Cell: Sizing and Counting
3. Discussion
4. Materials and Method
4.1. Plant Material and Growth Conditions
4.2. DNA Extraction and ISSR Amplification
4.3. Chemical Analysis of Plant Materials
4.4. Epidermal Cell Counting and Sizing
4.5. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dutta, S.; Mitra, M.; Agarwal, P.; Mahapatra, K.; De, S.; Sett, U.; Roy, S. Oxidative and genotoxic damages in plants in response to heavy metal stress and maintenance of genome stability. Plant Signal. Behav. 2018, 13, 1460048. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kocadal, K.; Alkas, F.B.; Battal, D.; Saygi, S. Cellular pathologies and genotoxic effects arising secondary to heavy metal exposure: A review. Hum. Exp. Toxicol. 2019, 39, 3–13. [Google Scholar] [CrossRef] [PubMed]
- Steinkellner, H.; Mun-Sik, K.; Helma, C.; Ecker, S.; Ma, T.H.; Horak, O.; Kundi, M.; Knasmuller, S. Genotoxic effects of heavy metals: Comparative investigation with plant bioassays. Environ. Mol. Mutagen. 1998, 31, 183–191. [Google Scholar] [CrossRef]
- Ünyayar, S.; Çelik, A.; Çekiç, F.Ö.; Gözel, A. Cadmium-induced genotoxicity, cytotoxicity and lipid peroxidation in Allium sativum and Vicia faba. Mutagen 2006, 21, 77–81. [Google Scholar] [CrossRef] [Green Version]
- Jayalakshmi, N.; Venkatachalam, P. Biochemical and molecular effects of lead heavy metal toxicity in plants: A phytoremediation approach. Plant Cell Biotech. Mol. Biol. 2011, 12, 1–14. [Google Scholar]
- Uzu, G.; Sobanska, S.; Aliouane, Y.; Pradere, P.; Dumat, C. Study of lead phytoavailability for atmospheric industrial micronic and sub-micronic particles in relation with lead speciation. Environ. Pollut. 2009, 157, 1178–1185. [Google Scholar] [CrossRef] [Green Version]
- Sharma, P.; Dubey, R.S. Involvement of oxidative stress and role of antioxidative defense systemin growing rice seedlings exposed to toxic concentrations of aluminium. Plant Cell. Rep. 2007, 26, 2027–2038. [Google Scholar] [CrossRef]
- Silva, S.; Silva, P.; Oliveira, H.; Gaivão, I.; Matos, M.; Pinto-Cardide, O.; Santos, C. Pb low doses induced genotoxicity in Lactuca sativa plants. Plant Physiol. Biochem. 2017, 112, 109–116. [Google Scholar] [CrossRef]
- Gichner, T.; Znidar, I.; Száková, J. Evaluation of DNA damage and mutagenicity induced by lead in tobacco plants. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2008, 652, 186–190. [Google Scholar] [CrossRef]
- Wierzbicka, M. The effect of lead on the cell cycle in the root meristem of Allium cepa L. Protoplasma 1999, 207, 186–194. [Google Scholar] [CrossRef]
- Reddy, A.M.; Kumar, S.G.; Jyothsnakumari, G.; Thimmanaik, S.; Sudhakar, C. Lead induced changes in antioxidant metabolism of horse gram (Macrotyloma uniflorum (Lam.) Verdc.) and Bengal gram (Cicer arietinum L.). Chemosphere 2005, 60, 97–104. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Xiao, H. Antagonistic effect of calcium, zinc and selenium against cadmium-induced chromosomal aberrations and micronuclei in root cells of Hordeum vulgare. Mutat. Res. 1998, 420, 1–6. [Google Scholar] [CrossRef]
- Hartwig, A.; Mullenders, L.H.F.; Schlepegrell, R.; Kasten, U.; Beyersmann, D. Nickel (II) interferes with the incision step in nucleotide excision repair in mammalian cells. Cancer Res. 1994, 54, 4045–4051. [Google Scholar]
- Hossain, Z.; Huq, F. Studies on the interaction between Cd ions and DNA J. Inorg. Biochem. 2002, 90, 85–96. [Google Scholar] [CrossRef]
- Crespo Pardo, D.; Terracciano, S.; Giordano, S.; Spagnuolo, V. Molecular markers based on PCR methods: A guideline for mosses. Cryptogam. Bryol. 2014, 35, 229–246. [Google Scholar] [CrossRef] [Green Version]
- Li, W.X.; Chen, T.B.; Huang, Z.C.; Lei, M.; Liao, X.Y. Effect of arsenic on chloroplast ultrastructure and calcium distribution in arsenic hyperaccumulator Pteris vittata L. Chemosphere 2006, 62, 803–809. [Google Scholar] [CrossRef] [PubMed]
- Yıldız, M.; Arıkan, E.S. Genotoxicity testing of quizalofop-P-ethyl herbicide using the Allium cepa anaphase and telophase chromosome aberration assay. Caryologia 2008, 61, 45–52. [Google Scholar]
- Sorrentino, M.C.; Capozzi, F.; Giordano, S.; Spagnuolo, V. Genotoxic effect of Pb and Cd on in vitro cultures of Sphagnum palustre: An evaluation by ISSR markers. Chemosphere 2017, 181, 208–215. [Google Scholar] [CrossRef]
- Karley, A.J.; Leigh, R.A.; Sanders, D. Where do all the ions go? The cellular basis of differential ion accumulation in leaf cells. Trends Plant Sci. 2000, 5, 465–470. [Google Scholar] [CrossRef]
- Clarkson, D.T.; Lüttge, U. Mineral nutrition: Divalent cations, transport and compartmentation. Prog. Bot. 1989, 93–112. [Google Scholar]
- Raskin, I.; Kumar, P.N.; Dushenkov, S.; Salt, D.E. Bioconcentration of heavy metals by plants. Curr. Opin. Biotechnol. 1994, 5, 285–290. [Google Scholar] [CrossRef]
- Briat, J.F.; Lebrun, M. Plant responses to metal toxicity. Comptes Rendus L’académie Des Sci.-Ser. III-Sci. Vie 1999, 322, 43–54. [Google Scholar] [CrossRef]
- Sorrentino, M.C.; Capozzi, F.; Amitrano, C.; De Tommaso, G.; Arena, C.; Iuliano, M.; Giordano, S.; Spagnuolo, V. Facing metal stress by multiple strategies: Morphophysiological responses of cardoon (Cynara cardunculus L.) grown in hydroponics. Environ. Sci. Pollut. Res. 2021, 28, 37616–37626. [Google Scholar] [CrossRef]
- Capozzi, F.; Sorrentino, M.C.; Caporale, A.G.; Fiorentino, N.; Giordano, S.; Spagnuolo, V. Exploring the phytoremediation potential of Cynara cardunculus: A trial on an industrial soil highly contaminated by heavy metals. Environ. Sci. Pollut. Res. 2020, 27, 9075–9084. [Google Scholar] [CrossRef] [PubMed]
- Sorrentino, M.C.; Capozzi, F.; Amitrano, C.; Giordano, S.; Arena, C.; Spanuolo, V. Performance of three cardoon cultivars in an industrial heavy metal-contaminated soil: Effects on morphology, cytology and photosynthesis. J. Hazard. Mater. 2018, 351, 131–137. [Google Scholar] [CrossRef] [PubMed]
- Arena, C.; Figlioli, F.; Sorrentino, M.C.; Izzo, L.G.; Capozzi, F.; Giordano, S.; Spagnuolo, V. Ultrastructural, protein and photosynthetic alteration induced by Pb and Cd in Cynara cardunculus L. and its potential for phytoremediation. Ecotox. Environ. Saf. 2017, 145, 83–89. [Google Scholar] [CrossRef] [PubMed]
- Figlioli, F.; Sorrentino, M.C.; Memoli, V.; Arena, C.; Maisto, G.; Giordano, S.; Capozzi, F.; Spagnuolo, V. Overall plant responses to Cd and Pb metal stress in maize: Growth pattern, ultrastructure, and photosynthetic activity. Environ. Sci. Pollut. Res. 2019, 26, 1781–1790. [Google Scholar] [CrossRef]
- Shahid, M.; Pinelli, E.; Pourrut, B.; Silvestre, J.; Dumat, C. Lead-induced genotoxicity to Vicia faba L. roots in relation with metal cell uptake and initial speciation. Ecotoxicol. Environ. Saf. 2011, 74, 78–84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kovalchuk, I.; Titov, V.; Hohn, B.; Kovalchuk, O. Transcriptome profiling reveals similarities and differences in plant responses to cadmium and lead. Mutat. Res./Fundam. Mol. Mech. Mutagenesis 2005, 570, 149–161. [Google Scholar] [CrossRef]
- Basile, A.; Giordano, S.; Cafiero, G.; Spagnuolo, V.; Castaldo-Cobianchi, R. Tissue and cell localization of experimentally-supplied lead in Funaria hygrometrica Hedw. using X-ray SEM and TEM microanalysis. J. Bryol. 1994, 18, 69–81. [Google Scholar] [CrossRef]
- Patra, M.; Bhowmik, N.; Bandopadhyay, B.; Sharma, A. Comparison of mercury, lead and arsenic with respect to genotoxic effects on plant systems and the development of genetic tolerance. Environ. Exp. Bot. 2004, 52, 199–223. [Google Scholar] [CrossRef]
- Atienzar, F.A.; Conradi, M.; Evenden, A.J.; Jha, A.M.; Depledge, M.H. Qualitative assessment of genotoxicity using random amplified polymorphic DNA: Comparison of genomic template stability with key fitness parameters in Daphnia magna exposed to benzo[a]pyrene. Environ. Toxicol. Chem. 1999, 18, 2275–2282. [Google Scholar] [CrossRef]
- Hoagland, D.R.; Arnon, D.I. The water-culture method for growing plants without soil. In Circular, 2nd ed.; California Agricultural Experiment Station: Berkley, CA, USA, 1950; p. 347. [Google Scholar]
- Murray, M.G.; Thompson, W. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4325. [Google Scholar] [CrossRef] [Green Version]
- Branquinho, C.; Brown, D.H. A method for studying the cellular location of lead in lichens. Lichenol. 1994, 26, 83–90. [Google Scholar] [CrossRef]
- Branquinho, C.; Catarino, F.; Brown, D.H. I Brown Dh: Improving the use of lichens as biomonitors of atmospheric metal pollution. In Proceedings of the International Workshop, BioMAP, Lisbon, Portugal, 21–24 September 1997; pp. 21–24. [Google Scholar]
- Spagnuolo, V.; Zampella, M.; Giordano, S.; Adamo, P. Cytological stress and element uptake in moss and lichen exposed in bags in urban area. Ecotox. Environ. Saf. 2011, 74.5, 1434–1443. [Google Scholar] [CrossRef] [PubMed]
SAR | SIC | SPA | |
---|---|---|---|
Cd | |||
L | 133 ± 9 c | 111 ± 7 d | 114 ± 8 d |
L + EDTA | 93 ± 9 e | 79 ± 7 e | 66 ± ef |
R | 482 ± 33 a | 386 ± 32 b | 420 ± 38 ab |
TF | 0.28 | 0.29 | 0.27 |
Pb | |||
L | 46 ± 7 c | 38 ± 5 c | 43 ± 5 c |
L + EDTA | 31 ± 4 d | 26 ± 5 de | 22 ± 3 e |
R | 770 ± 65 a | 652 ± 35 b | 656 ± 36 b |
TF | 0.06 | 0.06 | 0.06 |
SPA | |||
---|---|---|---|
Ct | Cd | Pb | |
Cell size | 2075 ± 264a | 935 ± 223b | 901 ± 236b |
Cell number | 81 ± 6.9b | 147 ± 13a | 145 ± 12a |
SAR | |||
Ct | Cd | Pb | |
Cell size | 2036 ± 211a | 1994 ± 318a | 1989 ± 220a |
Cell number | 79 ± 5.8b | 78 ± 4.6b | 78 ± 5.6b |
SIC | |||
Ct | Cd | Pb | |
Cell size | 2046 ± 331a | 2061 ± 261a | 1920 ± 313a |
Cell number | 77 ± 4.8b | 78 ± 4b | 77 ± 5.8b |
Primer | Primer Sequence 5′-3′ | Number of Bases | Tm (°C) | |
---|---|---|---|---|
1 | ISSR 10 | AGAGAGAGAGAGAGYC | 16 | 48 |
2 | ISSR 14 | TGTCACACACACACACAC | 18 | 54 |
3 | ISSR 15 | GGTCACACACACACACAC | 18 | 53.8 |
4 | ISSR 18 | GTGCACACACACACACAC | 18 | 56 |
5 | ISSR 19 | CGGCACACACACACACAC | 18 | 57.2 |
6 | ISSR 20 | CCTGCACACACACACACAC | 19 | 56.9 |
7 | ISSR 22 | GTGCTCTCTCTCTCTCTC | 18 | 50.8 |
8 | ISSR 23 | GAGTCTCTCTCTCTCTCTC | 19 | 49.9 |
9 | ISSR W814 | CTCTCTCTCTCTCTCTTG | 18 | 47.6 |
10 | ISSR W898 | CTCTCTCTCTCTRY | 14 | 39.6 |
11 | ISSR W899 | CTCTCTCTCTCTRG | 14 | 40 |
12 | ISSR W901 | GTGTGTGTGTGTYR | 14 | 44 |
13 | ISSR 8082 | CTCTCTCTCTCTCTCTCTG | 19 | 49.9 |
14 | ISSR 8564 | CACCACCACCACCACCACCAC | 22 | 64.1 |
15 | ISSR 8565 | GTAACCACCACCACCACCACC | 21 | 64.4 |
16 | ISSR TE | GTGGTGGTGGTGRC | 14 | 44 |
17 | ISSR HAD | CTCCTCCTCCTCRC | 14 | 44 |
18 | ISSR MAN | CACCACCACCACRC | 14 | 44 |
19 | ISSR DAT | GAGAGAGAGAGAGARC | 16 | 46 |
20 | ISSR W843 | CTCTCTCTCTCTCTCTRA | 18 | 47.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sorrentino, M.C.; Giordano, S.; Capozzi, F.; Spagnuolo, V. Metals Induce Genotoxicity in Three Cardoon Cultivars: Relation to Metal Uptake and Distribution in Extra- and Intracellular Fractions. Plants 2022, 11, 475. https://doi.org/10.3390/plants11040475
Sorrentino MC, Giordano S, Capozzi F, Spagnuolo V. Metals Induce Genotoxicity in Three Cardoon Cultivars: Relation to Metal Uptake and Distribution in Extra- and Intracellular Fractions. Plants. 2022; 11(4):475. https://doi.org/10.3390/plants11040475
Chicago/Turabian StyleSorrentino, Maria Cristina, Simonetta Giordano, Fiore Capozzi, and Valeria Spagnuolo. 2022. "Metals Induce Genotoxicity in Three Cardoon Cultivars: Relation to Metal Uptake and Distribution in Extra- and Intracellular Fractions" Plants 11, no. 4: 475. https://doi.org/10.3390/plants11040475