Next Article in Journal
Jewel Orchid’s Biology and Physiological Response to Aquaponic Water as a Potential Fertilizer
Next Article in Special Issue
Reactive Oxygen, Nitrogen, and Sulfur Species (RONSS) as a Metabolic Cluster for Signaling and Biostimulation of Plants: An Overview
Previous Article in Journal
Hippeastrum stapfianum (Kraenzl.) R.S.Oliveira & Dutilh (Amaryllidaceae) Ethanol Extract Activity on Acetylcholinesterase and PPAR-α/γ Receptors
Previous Article in Special Issue
Bio-Stimulating Effect of Natural Polysaccharides from Lobularia maritima on Durum Wheat Seedlings: Improved Plant Growth, Salt Stress Tolerance by Modulating Biochemical Responses and Ion Homeostasis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 11
Issue 22
10.3390/plants11223180
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Biostimulant Effect of Hydroalcoholic Extracts of Sargassum spp. in Tomato Seedlings under Salt Stress

by
Oscar Sariñana-Aldaco
1,
Adalberto Benavides-Mendoza
2,
Armando Robledo-Olivo
3 and
Susana González-Morales
4,*
1
Program in Protected Agriculture, Universidad Autónoma Agraria Antonio Narro, Saltillo 25315, Coahuila, Mexico
2
Horticulture Department, Universidad Autónoma Agraria Antonio Narro, Saltillo 25315, Coahuila, Mexico
3
Food Science & Technology Department, Universidad Autónoma Agraria Antonio Narro, Saltillo 25315, Coahuila, Mexico
4
National Council for Science and Technology (CONACyT), Universidad Autónoma Agraria Antonio Narro, Saltillo 25315, Coahuila, Mexico
*
Author to whom correspondence should be addressed.
Plants 2022, 11(22), 3180; https://doi.org/10.3390/plants11223180
Submission received: 18 August 2022 / Revised: 14 November 2022 / Accepted: 15 November 2022 / Published: 21 November 2022
(This article belongs to the Special Issue Plant Biostimulation)
Browse Figures
Versions Notes

Abstract

:
Currently, the use of biostimulants in agriculture is a tool for mitigating certain environmental stresses. Brown algae extracts have become one of the most important categories of biostimulants in agriculture, and are derived from the different uses and positive results obtained under optimal and stressful conditions. This study aimed to examine the efficacy of a foliar application of a hydroalcoholic extract of Sargassum spp. and two controls (a commercial product based on Ascophyllum nodosum and distilled water) with regard to growth, the antioxidant system, and the expression of defense genes in tomato seedlings grown in nonsaline (0 mM NaCl) and saline (100 mM NaCl) conditions. In general, the results show that the Sargassum extract increased the growth of the seedlings at the end of the experiment (7.80%) compared to the control; however, under saline conditions, it did not modify the growth. The Sargassum extract increased the diameter of the stem at the end of the experiment in unstressed conditions by 14.85% compared to its control and in stressful conditions by 16.04% compared to its control. Regarding the accumulation of total fresh biomass under unstressed conditions, the Sargassum extract increased it by 19.25% compared to its control, and the accumulation of total dry biomass increased it by 18.11% compared to its control. Under saline conditions, the total of fresh and dry biomass did not change. Enzymatic and nonenzymatic antioxidants increased with NaCl stress and the application of algal products (Sargassum and A. nodosum), which was positively related to the expression of the defense genes evaluated. Our results indicate that the use of the hydroalcoholic extract of Sargassum spp. modulated different physiological, metabolic, and molecular processes in tomato seedlings, with possible synergistic effects that increased tolerance to salinity.

1. Introduction

In general terms, salinity stress is one of the most limiting stresses in crop production, damaging large cultivated areas [1]. This stress negatively influences the absorption and assimilation of water and nutrients, in addition to generating toxicity, which makes it more harmful to crop production [2]. Salinity-induced stress in plants causes a decrease in water potential due to the high concentration of dissolved ions in the soil solution or nutrient solution [3]. Plants subjected to this type of stress suffer physiological, morphological, and biochemical changes such as photosynthesis decrease and growth reduction, stomatal closure, overproduction of reactive oxygen species (ROS), and the production of enzymatic and nonenzymatic antioxidants [3,4]. The overproduction of ROS damages carbohydrates, proteins, lipids, and nucleic acids; however, by producing antioxidants, plants manage to mitigate stress to a certain extent [5,6].
Faced with this situation, traditional measures are taken, such as washing salts from the soil or the use of genetically modified plants; however, these measures are not always kind to the environment [7]. As a response, alternatives have been sought to reduce the adverse effects of salinity stress on crops. One of them is the use of the technique called plant biostimulation. Biostimulation is a phenomenon of the modification of metabolism and gene expression that allows for more efficient use of environmental resources, more significant growth and yield, and a greater tolerance to adverse environmental factors [8]. Biostimulation can be achieved through different environmental stimuli or using biostimulants, e.g., seaweed or botanical extracts. To date, there is no single definition, with unanimous acceptance, of what constitutes a biostimulant. However, among the academic community, there is close agreement on the subject. The most recent definition that is available is Yakhin et al. [9], which mentions that a biostimulant is any formulated product of biological origin that improves plant productivity because of new or emerging properties of the complex of constituents and not only by the essential nutrients, growth regulators or plant protective compounds.
In addition to this, there is the definition of du Jardin [10], which was, at the time, the most accepted definition, and to date, it is the most cited. This definition mentions that a plant biostimulant is any substance or microorganism applied to plants with the aim of enhancing nutrition efficiency, abiotic stress tolerance, and/or crop quality traits, regardless of its nutrient content. The European Union (EU) also has a definition. This definition mentions that a plant biostimulant shall be a fertilizing product, the function of which is to stimulate plant nutrition processes independently of the product’s nutrient content, with the sole aim of improving one or more of the following characteristics of the plant or the plant rhizosphere: (1) nutrient-use efficiency, (2) tolerance to abiotic stress, (3) quality traits, and (4) availability of confined nutrients in the soil or rhizosphere [11].
Seaweed extracts fall within these academic definitions due to the biostimulant power provided by the complex of carbohydrates, amino acids, inorganic compounds, phenolic compounds, carotenoids, and phytohormones that are present in the extracts [12,13,14,15]. In general, the metabolites that are present in the extracts fulfill a protective function in plants, providing greater tolerance to stress [16]. In addition, the extracts are complied with activities that improved the growth and development of plants [14,16].
In the EU there is legislation on biostimulants [11]; however, in other countries, such as Mexico, to date, there is no regulation on them as differentiated products of fertilizers and/or growth regulators. In addition, Mexico has the NOM-182-SSA1-2010 standard [17], which mentions three categories of growth regulators. In category one, which is where algae extracts come in, it is established that they are substances found naturally in plant tissues, whether obtained by extraction, fermentation, synthesis, or other methods. These substances include but are not limited to auxins, gibberellins, cytokinins, ethylene, cofactors, and growth retardants, which, in small quantities, promote, inhibit, or modify the growth and development of plants. According to the above, in Mexico, without legislation on biostimulants, algae extracts could be considered type 1 growth regulators [17].
The use of algae in agriculture has been increasing; however, the most commonly used algae are brown algae due to their higher concentration of metabolites [18]. The brown algae of the genus Sargassum today are a pollution problem on the Caribbean coast [19]. Derived from this, Sargassum has been given different uses to take advantage of its exaggerated amounts on the coasts. Uses include housing construction, the production of food supplements, the production of cosmetics, and the use of biostimulants in agriculture [20,21,22].
Sargassum spp. seaweed extracts (SSE) have shown positive results as inducers of tolerance to abiotic stress. Previously, SSE was shown to improve NaCl tolerance in chickpea crops by improving growth parameters and the enzymatic activity of superoxide dismutase (SOD), ascorbate peroxidase (APX), and peroxidase (POD) [23]. It was also shown that SSE increased the activity of SOD, POD, and catalase (CAT) enzymes and increased the contents of phenols, proline, and total antioxidant activity in barley plants subjected to NaCl stress [24]. In addition, there are reports that mention the regulation of the expression of defense genes in plants, which promotes tolerance to stress [22,25]. In this context, the application of SSE was carried out with the objective of evaluating responses at the agronomic, biochemical, and molecular levels of tomato seedlings subjected to saline stress. The hypothesis is that the SSE applied by foliar spray works as a biostimulant, inducing changes in gene expression and the promotion of antioxidant enzymes or active metabolites to counteract the adverse effects caused by saline stress.

2. Results

2.1. Seedling Growth and Biomass

Table 1 shows the results of the height, stem diameter, and a number of leaves of tomato seedlings. The results indicate that in plant height under standard growth conditions at 11 DAT, the SSE increased by 17% compared to AC; at 21 DAT, there were no significant differences; and at 31 DAT, the SSE increased by 7.80% compared to AC. For the stressed treatments, there were no differences in any evaluation.
For the stem diameter under standard growth conditions, at 11 DAT, the SSE increased it by 11.32%, at 21 DAT by 12.33%, and at 31 DAT by 14.85%, compared to AC. For the stressed treatments at 11 DAT, the SSE + NaCl increased by 14.76%, at 21 DAT by 14.88%, and at 31 DAT by 16.04%, compared to AC + NaCl.
For the number of leaves under standard growth conditions at 11 DAT, the SSE increased by 23.33%, at 21 DAT by 17.03%, and at 31 DAT by 11.76%, compared to AC. The stressed treatments did not show differences between them.
Table 2 shows the results of fresh and dry biomass of tomato seedlings. In general, the results indicate that for the total fresh biomass under standard growth conditions, the SSE increased by 19.25% compared to AC. Under stress conditions, there were no differences between treatments. For the total dry biomass under standard growth conditions, the SSE increased by 18.11% compared to AC. Under stress conditions, there were no differences between treatments.
Figure 1 shows an image of the seedlings under standard growth conditions and NaCl stress conditions.

2.2. Stomatal Conductance of Leaves

The results showed significant differences between treatments, and NaCl stress caused a decrease in stomatal conductance compared to treatments that were not stressed (Figure 2). Regarding the nonstressed treatments, in the first evaluation (11 DAT), ANCP showed the highest conductance, surpassing AC by 17.11%. In the second evaluation (21 DAT), there were no differences, and in the third evaluation (31 DAT), the SSE exceeded the AC by 29.31%. In the stressed treatments, in the first evaluation (11 DAT), SSE + NaCl was statistically higher by 49.70% compared to AC + NaCl. In the second evaluation (21 DAT), there were no differences between the treatments, and in the third evaluation (31 DAT), ANCP + NaCl and SSE + NaCl exceeded AC + NaCl by 3.78 and 4.13 times, respectively.

2.3. Photosynthetic Pigments

Figure 3 shows the results for photosynthetic pigments. For chlorophyll a, under standard growth conditions in the first sampling (11 DAT), it can be seen that the ANCP exceeded the AC by 10.87%; in the second sampling (21 DAT) there were no differences; and in the third sampling (31 DAT), SSE exceeded the AC by 15.57%. For the stressed treatments, SSE + NaCl, in the first sampling (11 DAT), exceeded AC + NaCl by 6.90%; in the second sampling (21 DAT), there were no differences; and in the third sampling (31 DAT) SSE + NaCl exceeded AC + NaCl by 16.66%.
For chlorophyll b, under standard growth conditions in the first sampling (11 DAT), ANCP increased SSE by 10.84%, which was the lowest; in the second sampling (21 DAT), there were no differences; and in the third sampling (31 DAT), SSE exceeded AC by 10.79%. Regarding the stressed treatments in the first sampling (11 DAT), ANCP + NaCl and SSE + NaCl exceeded AC + NaCl by 3.58 and 4.30%, respectively; in the second sampling (21 DAT), there were no differences; and in the third sampling (31 DAT), SSE + NaCl exceeded AC + NaCl by 10.74%.
For total chlorophyll, under standard growth conditions, in the first sampling (11 DAT), ANCP exceeded AC by 10.28%, in the second sampling (21 DAT) there were no differences, and in the third sampling (31 DAT), SSE exceeded AC by 13.94%. For the stressed treatments in the first sampling (11 DAT), SSE + NaCl exceeded AC + NaCl by 6.30%; for the second sampling (21 DAT), there were no differences; and for the third sampling (31 DAT), SSE + NaCl exceeded AC + NaCl by 14.69%.
Regarding carotenoids, it can be seen that stress decreased them compared to treatments that were not stressed, and in the first sampling (11 DAT) under standard growth conditions, ANCP and SSE exceeded AC by 20.93 and 13.95%, respectively. In the second sampling (21 DAT), there were no differences. For the third sampling (31 DAT), the SSE statistically exceeded AC by 40%. The stressed treatments did not present differences in any of the samplings.

2.4. Enzymatic Activity and Total Proteins

The results indicate that there were significant differences between treatments (Figure 4). For SOD activity, the stressed treatments at 11, 21, and 31 DAT increased their activity compared to those that were not stressed. In the treatments that were not stressed, there were no significant differences in any sampling. In the first two samplings (11 and 21 DAT), of the stressed treatments, there were no significant differences; only in the last sampling (31 DAT) was ANCP + NaCl the highest compared to AC + NaCl with 41.26%.
In the CAT activity, in the nonstressed treatments, the SSE increased the activity at 11 and 21 DAT by 87.03 and 53.05%, respectively, with respect to the AC; for the 31 DAT, there were no differences. For the stressed treatments, at 11 DAT, the SSE + NaCl increased the activity by 94.05% compared to the AC + NaCl. At 21 DAT, the AC + NaCl exceeded ANCP + NaCl three-fold, which was the lowest, and at 31 DAT, the SSE + NaCl exceeded AC + NaCl by five-fold.
In the APX activity, the stressed treatments and the use of the SSE increased the activity. For the nonstressed treatments, there was no differences in any sampling; however, in the stressed treatments, there were differences. SSE + NaCl increased the activity by 35.01% (11 DAT), 31.37% (21 DAT), and 43.10% (31 DAT) compared to AC + NaCl.
In the activity of phenylalanine ammonia-lyase (PAL), it can be seen in the treatments that were not stressed, ANCP showed lower activity than AC and SSE at 11 DAT. At 21 and 31 DAT, the SSE exceeded the AC by 5.46 and 7.25%, respectively. Regarding the stressed treatments at 11 and 21 DAT, SSE + NaCl exceeded AC + NaCl by 8.19 and 6.77%, respectively. At 31 DAT, ANCP + NaCl exceeded AC + NaCl by 2.76%.
For total proteins, it can be seen that for the treatments with and without stress, there were only differences in the first sampling (11 DAT). The ANCP and SSE exceeded the AC by 12.04 and 10.12%, respectively. AC + NaCl exceeded ANCP + NaCl and SSE + NaCl by 5.20 and 4.91%, respectively.

2.5. Hydrophilic Antioxidants and Antioxidant Capacity

Regarding nonenzymatic antioxidants and antioxidant capacity, some differences between treatments were observed (Figure 5). For ascorbic acid, in the nonstressed treatments, it was observed that at 11 DAT, the SSE exceeded the AC by 7.10%; at 21 DAT, the ANCP exceeded the AC by 53.21%; and at 31 DAT, the SSE exceeded the AC 1.9-fold. Regarding the stressed treatments, SSE + NaCl increased the content by 49.65% (11 DAT), 106% (21 DAT) and 2.2-fold (31 DAT), compared to AC + NaCl.
For the content of reduced glutathione (GSH), in the nonstressed treatments, no significant differences were observed compared to the AC in any sampling. For the stressed treatments at 11 DAT, ANCP + NaCl exceeded SSE + NaCl by 12.61%, which was the lowest. For 21 DAT, there were no differences, and for 31 DAT, the SSE + NaCl exceeded the AC + NaCl by 7.67%.
For total phenols, in the nonstressed treatments, differences were observed only at 31 DAT, with SSE exceeding AC by 34.41%. Regarding the stressed treatments at 11 DAT, ANCP + NaCl showed a decrease with respect to AC + NaCl and SSE + NaCl; for 21 DAT, SSE + NaCl exceeded ANCP + NaCl by 76.31%, which was the lowest. At 31 DAT, ANCP + NaCl exceeded AC + NaCl by 24.12%.
For flavonoids, in the nonstressed treatments, there was only a difference at 11 DAT, with the SSE exceeding the ANCP by 6.90%, which was the lowest. For the stressed treatments at 11 DAT, ANCP + NaCl exceeded AC + NaCl by 4.48%; at 21 and 31 DAT, SSE + NaCl increased the concentration by 31.39 and 17.16%, respectively, compared to AC + NaCl.
For the hydrophilic antioxidant capacity, there were only differences at 11 DAT of the unstressed treatments, with AC and ANCP exceeding SSE by 8.11 and 6.81%, respectively.
For the lipophilic antioxidant capacity, in the nonstressed treatments, there was only a difference at 11 DAT, where the SSE was lower than the AC. Regarding the stressed treatments, only at 31 DAT were differences shown, with SSE + NaCl exceeding AC + NaCl by 15.68%.

2.6. Proline and Hydrogen Peroxide

The results showed significant differences in the concentrations of hydrogen peroxide and proline between treatments (Figure 6). For proline in the treatments without stress, there were only differences at 31 DAT, where the SSE exceeded the AC by 27.73%. For the stressed treatments, the SSE + NaCl exceeded the AC + NaCl by 24.50% (11 DAT), 31.07% (21 DAT), and 39.64% (31 DAT).
For hydrogen peroxide, in the treatments without stress, there was only a difference at 31 DAT, where ANCP and SSE exceeded the AC by 5.26 and 4.55%, respectively. For the stressed treatments, AC + NaCl at 11 DAT increased its concentration compared to SSE + NaCl by 2.02%, and at 21 and 31 DAT, AC + NaCl exceeded ANCP + NaCl and SSE + NaCl.

2.7. Expression of Defense Genes

The results indicate that the use of algae products (SSE and ANCP) and NaCl stress induced the expression of the genes evaluated in the three samplings (Figure 7). In unstressed treatments, SSE increased the expression of the NCED1 gene by 1.35-fold (11 DAT), 2.36-fold (21 DAT), and 1.68-fold (31 DAT) compared to AC. In stressed treatments, the SSE + NaCl, increased the expression of the NCED1 gene by 4.77-fold (11 DAT), 12.35-fold (21 DAT), and 2.24-fold (31 DAT) compared to AC.
For the HSP70 gene, in the treatments without stress, the SSE increased its expression 3.54-fold (11 DAT), 1.08-fold (21 DAT), and 1.17-fold (31 DAT), compared to AC. For the stressed treatments, ANCP + NaCl increased its expression 1.4-fold at 11 DAT, AC + NaCl increased by 2.37-fold at 21 DAT, and SSE + NaCl increased by 2.13-fold at 31 DAT, compared to AC.
For the PIP2 gene, in treatments without stress, ANCP increased its expression 1.46 and 2.04-fold at 11 and 31 DAT, compared to AC. At 21 DAT, the SSE increased its expression 1.69-fold, compared to the AC. In the stressed treatments, SSE + NaCl increased its expression 9.91-fold (11 DAT), 4.35-fold (21 DAT), and 2.62-fold (31 DAT), compared to AC.
For the P5CS1 gene, in the unstressed treatments, SSE increased its expression at 11 and 21 DAT (1.15 and 1.45-fold, respectively), as well as ANCP (1.947-fold) at 31 DAT, compared to AC. At 11 and 21 DAT, ANCP + NaCl increased its expression (1.78 and 1.69-fold, respectively), as well as SSE + NaCl (3.27-fold) at 31 DAT, compared to AC.
For the ERD15 gene, in treatments without stress, at 11 DAT, ANCP and SSE repressed their expression (0.41 and 0.58-fold, respectively); at 21 and 31 DAT, SSE increased its expression 1.24- and 1.74-fold, respectively, compared to AC. In stress treatments at 11 DAT, AC + NaCl increased its expression 2.08-fold; at 21 DAT, ANCP + NaCl increased its expression 1.69-fold; and at 31 DAT, SSE + NaCl increased its expression 2.94-fold, compared to AC.
The Fe-SOD gene showed an increase in expression in the stressed treatments. In treatments without stress, SSE had the highest expression by 1.53, 2.7, and 2.98-fold, respectively, for 11, 21, and 31 DAT, compared to AC. At 11 DAT, ANCP + NaCl increased its expression by 13.41-fold; at 21 DAT, SSE + NaCl increased its expression by 3.7-fold; and at 31 DAT, ANCP + NaCl increased its expression by 43.38-fold, compared to AC.
For the CAT1 gene, in treatments without stress at 11 DAT, ANCP and SSE repressed their expression (0.38 and 0.82-fold, respectively); at 21 DAT, ANCP increased its expression 3.06-fold; and at 31 DAT, SSE increased its expression 2.07-fold, compared to AC. In stress treatments, at 11 DAT, SSE + NaCl increased its expression 1.85-fold; at 21 DAT, AC + NaCl increased its expression 1.54-fold; and at 31 DAT, SSE + NaCl increased its expression 70.5-fold, compared to AC.
The cAPX2 gene showed an increase in expression in the three samplings for the stressed treatments. At 11 DAT, ANCP + NaCl increased its expression 9.25-fold; and at 21 and 31 DAT, SSE + NaCl increased its expression by 3.07-fold and 63.64-fold, respectively, compared to AC. For treatments without stress, ANCP increased its expression at 11 and 31 DAT (3.58 and 2.29-fold, respectively) compared to AC. At 21 DAT, the SSE increased its expression 1.82-fold, compared to the AC.
The expression of the PAL5-3 gene with respect to the stressed treatments was increased compared to the nonstressed treatments. For the stressed treatments, SSE + NaCl increased its expression by 4.1-fold (11 DAT), 31.07-fold (21 DAT), and 44.17-fold (31 DAT), compared to AC. For unstressed treatments, SSE increased its expression 3.26-fold (11 DAT), 2.14-fold (21 DAT), and 5.12-fold (31 DAT) compared to AC.

3. Discussion

3.1. Seedling Biomass and Growth Parameters

Crops that grow in high concentrations of salts tend to reduce their development and growth; therefore, production is reduced [7,26,27]. Salt stress in plants causes osmotic stress, which triggers plants to consume extra energy to absorb water and nutrients [28,29]. This effect is analogous to that produced by water stress, when the plant increases the respiration rate to produce more energy to absorb water [30,31]. Derived from this extra energy consumption, plants reduce growth and biomass accumulation, as observed in the results of this study; however, the use of SSE improved these parameters to a certain extent. There are different investigations that show that SSE has a positive influence on aspects related to the growth and biomass of plants. Abdel Latef et al. [23] reported that the extracts of Sargassum muticum (1%) caused a positive effect on growth variables and on the biomass of the chickpea crop under stress conditions by NaCl (50 and 150 mM). On the other hand, Gharib et al. [32] indicated that the foliar application of extracts of Sargassum latifolium (0.4%) increased the growth parameters (height) and biomass (fresh and dry weights of the shoot) of rosemary plants under salt stress (100 mM NaCl). In addition, they also mention that the extracts at all of the concentrations used improved the growth of the plants in conditions without stress.
The positive effects are induced due to the biostimulant compounds that SSE contains (phytohormones, carbohydrates, proteins, amino acids, and GSH), which help the plant in the absorption and translocation of nutrients under NaCl stress conditions, and in the same way, stimulate the C and N metabolism [14,22,33,34,35]. On the other hand, auxins, mainly indole-3-acetic acid (IAA), control physiological processes in plants, such as cell elongation and division [36]. Cytokinins, mainly trans-zeatin (tZ), activate lateral bud growth and stimulate nutrient translocation [37,38]. Carbohydrates facilitate the assimilation and transport of mineral elements and are the main source of energy in plants [39,40]. Nitrogenous metabolites (proteins, amino acids, and GSH), being a source of nitrogen and hormonal precursors, positively modify metabolism, which improves the growth and accumulation of biomass in plants [41,42,43].

3.2. Stomatal Conductance

This variable indicates the rate of water vapor diffusion via the stomata from the mesophyll to the atmosphere [44]. This variable also works as an indicator when plants are under water deficit [45]. As mentioned above, NaCl in plants causes water stress that deprives them of this resource so plants tend to close their stomata and reduce stomatal conductance to avoid water loss as much as possible [46,47]. The results of the present investigation show that the treatments without stress showed a greater stomatal conductance. Similar results were reported by Miceli et al. [48], indicating that the use of extracts of Ecklonia maxima in lettuce cultivation increased stomatal conductance at all concentrations (1, 2, and 4 mL L−1) compared to the control. The results are because brown algae extracts contain osmolytes such as proline, glycine betaine, and carbohydrates, compounds that allow for osmotic adjustment and that facilitate the absorption of water and nutrients by plants [49,50,51]. These osmolytes can stabilize the hydration sphere of proteins and membranes and reduce the water potential in cells under conditions of osmotic stress [52], which can explain the improvement in stomatal conductance. It is important to mention that at higher rates of stomatal conductance, biomass accumulation is improved, to a certain extent, since photosynthetic activity is increased by greater carbon dioxide (CO2) uptake [45].

3.3. Photosynthetic Pigments

Chlorophylls are the most important pigments that plants have since they control photosynthetic activity by capturing solar light energy [53]. However, chlorophylls are not the only pigments that are involved in the photosynthetic process, since carotenoids also play an important role by having photoprotective properties and capturing light in spectral regions that are not covered by chlorophylls, which broadens the range of wavelengths in which light can be used in photosynthesis [54,55]. The results of the present investigation showed that with NaCl stress and the use of SSE, the concentration of chlorophylls increased, but that of carotenoids decreased. Similar results were shown by Hernández-Hernández et al. [56], indicating that stress by NaCl (100 mM) in tomato leaves increased the concentration of chlorophylls compared to treatments that were not stressed. They also indicated that stress increased the concentration of carotenoids, which differs from the present experiment. Similarly, Morales-Espinoza et al. [57] indicated that stress by NaCl (50 mM) increased the concentration of chlorophylls in tomato leaves, compared to the control treatment. Zou et al. [16] indicated that stress by NaCl (150 mM) caused a significant decrease in the contents of chlorophylls a and b in wheat seedlings; however, with the use of polysaccharides derived from the brown algae Lessonia nigrescens, the content was increased. Vijayanand et al. [58] mentioned that the foliar application of Sargassum wightii extracts (1.5%) improved the contents of chlorophylls a and b in bean plants.
The results in the first instance are caused by NaCl stress, which causes plants to make the photosynthetic process more efficient, increasing the concentration of chlorophylls, up to a certain point, due to the limitation of water and nutrients [59]. The photosynthetic capacity of leaves is closely related to the N content since the proteins that make up the thylakoids and those that function in the Calvin cycle represent the majority of the foliar N [60,61]. In this way, SSE, being a source of nitrogenous metabolites (proteins, amino acids, and GSH), can increase the concentration of pigments. In the same way, SSE contains glycine betaine, which is a quaternary amine; in addition to being a source of N, its main role is involved in photosynthetic activity since it protects chlorophylls from oxidation [51,62]. Regarding carotenoids, the results are attributed to the fact that pigments are responsible for the detoxification of free radicals and the dissipation of excess energy, for which, when there is severe stress, they will be the first pigments to oxidize, protecting the chlorophylls [54].

3.4. Enzymatic Activity, Hydrophilic Antioxidants, and Antioxidant Capacity

Plants are sessile organisms, and to survive and reproduce, they not only need to grow and develop but also must continuously tolerate and adapt to stress (pathogens, drought, extreme temperatures, and salinity, among others) [63,64,65]. In this situation, plants activate enzymatic and nonenzymatic antioxidant systems, which are responsible for protecting cells against ROS produced by stress [63,66,67]. The enzyme antioxidant system is the first line of defense in plants that neutralizes ROS; these enzymes include SOD, CAT, APX, and glutathione peroxidase (GPX) [67,68]. There are other enzymes that are not classified as antioxidants; however, they are indirectly involved, and one of them is PAL, which catalyzes the first reaction of the phenylpropanoid pathway, compounds with high antioxidant capacities [69]. Nonenzymatic antioxidants, whether hydrophilic (phenols, GSH, and ascorbic acid) or lipophilic (carotenoids), are the second line of defense and are responsible for inhibiting the production of damage caused by the oxidative reaction [67,70].
The results of the present investigation show that with stress and brown algae products (SSE and ANCP), it was possible to increase the activity of the enzymes, the accumulation of hydrophilic antioxidants, and the hydrophilic antioxidant capacity. Sofy et al. [24] mentioned that the use of extracts of S. latifolium (30%) in barley plants under saline conditions (NaCl, 75 and 150 mM) increased the activities of the SOD, CAT, and POD enzymes. Similarly, Elansary et al. [71] reported an increase in APX activity with the use of A. nodosum extracts (5 and 7 mL L−1) in Paspalum vaginatum under NaCl stress conditions (49.7 dS m−1). Aitouguinane et al. [72] indicated that the use of alginates and oligoalginates, isolated from the brown alga Bifurcaria bifurcata, in tomato seedlings increased the activity of the PAL enzyme, which was positively correlated with the increase in total phenols, which coincides with the present study.
Similar results are reported by Hashem et al. [73], who mention that the use of the brown alga Cystoseira Spp. in the canola crop under NaCl stress conditions (75 and 150 mM) increased the contents of phenols, flavonoids, anthocyanins, and DPPH antioxidant capacity. Kumari et al. [74] mentioned that the foliar, drenching, and combined application of extracts (10%) of Sargassum johnstonii increased the contents of phenols, ascorbic acid, and lycopene in tomato leaves and fruits.
NaCl stress, by causing water and nutrient deficits, and toxicity, leads to the overproduction of ROS in plant cells, and therefore, to the activation of the enzymatic and nonenzymatic antioxidant system that detoxifies the cells of ROS [7,66,75,76]. Brown algae extracts also activate the defense system of plants. Shukla et al. [77] indicated that the metabolites present in the extracts induce the increase and synthesis of antioxidants, both enzymatic and nonenzymatic. In the present investigation, stress caused a decrease in carotenoids, which correlates with a lower lipophilic antioxidant capacity; however, the use of SSE in stress situations helped to improve the antioxidant capacity to a certain extent, compared to AC + NaCl.

3.5. Total Protein, Proline, and Hydrogen Peroxide

Proteins are of vast importance in plant metabolism. There are catalytic, transport, structural, defense, and reserve proteins, which are involved in all of the metabolic processes of plants [78,79,80,81,82]. In the present study, it was observed that in the first sampling (11 DAT), there were significant differences. Nonstress treatments, specifically SSE and ANCP, increased the protein concentration compared to the stress treatments. Sofy et al. [24] reported that with the application of NaCl at 75 and 150 mM in barley culture, the protein content decreased, but with the application of extracts of S. latifolium, it increased substantially. The results are attributed to the products of algae since they contain nitrogenous metabolites such as proteins; in addition, they stimulate the synthesis of these in plants [83]. ROS are generated due to stress and cause the oxidation of lipids, nucleic acids, and proteins, which is why they decrease with NaCl stress [84].
Proline is an amino acid; under normal conditions, it is found in low quantities in plants; however, under stress conditions, its concentration increases to act as an osmotic agent, protecting cells from dehydration and oxidative stress [85,86]. In this study, under NaCl stress conditions and with the use of SSE, the proline concentration increased. Similar results were shown by Zou et al. [87], indicating that with stress by NaCl at 120 mM and the use of fucoidan extracted from the brown algae Macrocystis pyrifera, the proline content increased compared to the control in wheat seedlings. The results are a product of the stress caused by the use of the SSE. With osmotic stress, plants increase their concentration of osmolytes, such as proline, glycine betaine, and carbohydrates, compounds that allow for osmotic adjustment and that facilitate the absorption of water and nutrients by plants [50,88,89]. These osmolytes are also involved in maintaining protein structure under stressful conditions [90]. As mentioned above, SSE contains this type of osmolyte, which is why the proline concentration was increased.
Plant metabolism, when subjected to stress, produces ROS, including H2O2, a toxic species in high concentrations, which in turn is reduced to water and O2 by the enzymes CAT, APX, and GPX. In this study, CAT and APX activity were increased with the application of SSE in tomato seedlings [68]. The enzymes APX and GPX use ascorbate and GSH, respectively, as electron donors, to carry out the reduction of H2O2 [68]. This study shows that stress increased the concentration of H2O2; however, the use of alga products reduced it to a certain extent. Zou et al. [87] showed similar results, where NaCl stress increased H2O2 in wheat seedlings, but the use of fucoidan extracted from the algae M. pyrifera reduced it considerably. As mentioned above, H2O2 at high concentrations is toxic; however, being below the threshold level, it is important in plant cell metabolism by functioning as a signaling molecule in different processes, both under stress conditions and without stress [91]. The reduction in H2O2 in the stressed treatments and with the application of SSE is probably because SSE helps plants synthesize antioxidant compounds that decrease or neutralize ROS.

3.6. Expression of Defense Genes

The plant defense system includes enzymatic and nonenzymatic systems, but to achieve this, processes occur that are of great importance and that have not been explored in detail. These processes are linked to the expression of genes that code for proteins involved in the defense system [92]. Plants, being sessile organisms, have the ability to defend themselves against environmental stresses through the expression of defense genes, which will make them have an arsenal of effector biomolecules; however, there are different alternatives, such as genetic engineering, that allow them to always keep certain genes of interest active (gene overexpression). However, there are also other alternatives, such as the use of biostimulants, specifically the use of brown alga extracts that have the ability to activate the plant defense system through the differential expression of genes [25,93,94].
In the present experiment, in the three samplings, there was differential expression of all of the genes studied, especially with the treatments under stress by NaCl and the use of SSE. Drira et al. [95] mention in their study that with the application of Padina pavonica extracts in Arabidopsis thaliana under NaCl stress, the genes SOD, CAT, POD, and P5CS were expressed, which conferred a certain tolerance to the plants. In the same way, Zou et al. [16] indicated that the use of polysaccharides derived from L. nigrescens in wheat seedlings stressed by NaCl (150 mM) produced an overexpression of the genes that code for high-affinity potassium transporters (HKT2;1) and membrane antiporters Na+/H+ (SOS1 and NHX2). Al-Ghamdi y Elansary [96] applied extracts of A. nodosum in asparagus under saline irrigation (NaCl) and indicated that the PIP1, P5CS1, APX1, and GPX3 genes were differentially expressed.
The results are the product of the stress caused by NaCl and, consequently, by the application of the algae products. The metabolites present in the algal products (carbohydrates, proteins, amino acids, carotenoids, phytohormones, vitamins, and phenolic compounds) bind to specific sensors in the cell membranes, which trigger a series of signals that lead to the expression of defense genes, which, in turn, code for proteins that directly or indirectly mitigate the adverse effects of stress [77,97]. Cell membranes also have sodium sensors that generate the expression of genes that code for antioxidant and transporter proteins, with the ability to exclude salts from cells or to store them in central vacuoles [97,98].
Among the genes evaluated, Fe-SOD, CAT1, cAPX2, and PAL5-3, the functions of the metabolites that they encode have been explained previously, but not for the rest. P5CS1 encodes the enzyme ∆1-pyrroline-5-carboxylate synthase 1, which catalyzes the synthesis of the amino acid proline [99]. NCED1 encodes the enzyme 9-cis-expoxycarotenoid dioxygenase 1, which catalyzes the synthesis of abscisic acid in chloroplasts. This phytohormone regulates various processes in plants, including stomatal closure under conditions of osmotic stress [100]. HSP70 encodes a heat shock protein that protects other biomolecules from denaturation or misfolding under stressful conditions [101]. PIP2 codes for aquaporins that are responsible for regulating the movement of water across cell membranes under conditions of osmotic stress [102]. ERD15 encodes proteins involved in the stabilization and renaturation of biomolecules affected by biotic and abiotic stress [103].
It is important to mention that Sargassum algae play an important role in the ecological balance of the oceans, and consequently, due to its massive accumulations on the coasts, it is already an environmental problem that has caused the death of marine species such as turtles and fish. However, different uses are being given to Sargassum (construction, food supplements, cosmetics, and agricultural products), which somehow mitigate its environmental impact. For this reason, it is important to take advantage of this type of natural resource in agricultural activities.

4. Materials and Methods

4.1. Plant Material and Experimental Conditions

CID F1 hybrid tomato seeds (Harris Moran Seed Company, Modesto, CA, USA; saladette type and indeterminate growth) were sown in polystyrene trays with a mixture of peat moss and perlite (1:1 v/v). The experiment was established in a greenhouse covered with polyethylene in the Department of Horticulture of the Universidad Autónoma Agraria Antonio Narro (Saltillo, México). The average temperature was 28 °C, and 50 to 60% relative humidity was used. The seedlings were grown for 30 days until they developed four true leaves. Subsequently, they were transplanted into 1 L containers with the same ratio of substrate used for sowing. The irrigation system was manual, giving one irrigation per day at field capacity. Plant nutrition was performed with a 25% Steiner nutrient solution [104].

4.2. Treatments

A 1.5% hydroalcoholic SSE was used, produced by a batch reactor under the conditions of 160 °C, 30 min, and 50% ethanol. The ratio used for the extraction was 1:20 (1 g of algae and 20 mL of 50% ethanol). The dose of SSE used was in accordance with research carried out by Ramya et al. [105], Kasim et al. [106], and Ramya et al. [107], and the extraction condition was selected based on the results obtained in a preliminary test established by Sariñana-Aldaco et al. [14]. Biochemical characterization was performed on the SSE, which is shown in Table 3.
The treatments applied were the following: (1) control with distilled water (AC), (2) A. nodosum commercial product (BYOALG®) at 0.13%, based on the specifications for use (ANCP), (3) application of the Sargassum spp. seaweed extract (SSE), (4) AC and 100 mM NaCl (AC + NaCl), (5) ANCP and 100 mM NaCl (ANCP + NaCl), and (6) SSE and 100 mM NaCl (SSE + NaCl), giving a total of six treatments. Foliar applications for the algae extracts were applied, a manual sprinkler was used, and the plants were sprayed to the point of dripping. The applications were made every 10 days from the transplant, accumulating four applications during the experiment, which lasted 31 days (Figure 8). The applications were made between 08:00 and 10:00 h. To prevent spraying from neighboring treatments, a flexible plastic barrier was used to isolate the application space. NaCl stress was applied from the fifth day after transplantation (DAT) in the nutrient solution until the end of the experiment.

4.3. Sampling and Evaluations

Three destructive samplings and three evaluations were carried out 24 h after the second application of the extracts (11 DAT), 24 h after the third application of the extracts (21 DAT), and 24 h after the fourth application of the extracts (31 DAT) (Figure 8). Destructive sampling consisted of five plants per treatment to determine stress indicator metabolites, and four plants for the expression of defense genes. These samplings were carried out by removing all the leaves of the seedlings, immediately freezing them with liquid nitrogen, and storing them in an ultrafreezer at −80 °C. The evaluations consisted of five plants per treatment that were chosen to measure plant height, number of leaves, stem diameter, and stomatal conductance of the leaves (SC-1 Leaf porometer, ICT International). At the end of the experiment, the fresh and dry biomasses of the seedlings were quantified.

4.4. Biochemical Analyses

To determine the stress indicator metabolites in the leaves of the tomato seedlings, the frozen tissue was lyophilized and macerated with a hand mortar to later perform the extractions and quantifications according to the methodologies used.
The contents of photosynthetic pigments were determined according to the Wellburn method [108], with modifications. Total protein was determined using the method described by Bradford [109]. The enzymatic activity of SOD (EC 1.15.1.1) was determined using a Cayman® 7060002 commercial kit (Cayman Chemical Company, Ann Arbor, MI, USA) [27], and the results are expressed in U mL−1 per total protein. One unit of SOD is defined as the amount of enzyme required to exhibit a 50% dismutation of the superoxide radical. The enzyme activity of CAT (EC 1.11.1.6) was determined as described in Dhindsa et al. [110], and their results are reported as U (consumption in mM hydrogen peroxide per minute) per total protein. APX activity (EC 1.11.1.11) was determined as described in Nakano and Asada [111], and the results are reported as U (µmol of ascorbic acid oxidized per minute) per total protein. The activity of PAL (EC 4.3.1.5) was determined according to that established by Sykłowska-Baranek et al. [112], and their results are reported as U (production in µmol of trans-cinnamic acid per minute) per total protein.
Ascorbic acid was determined via high-performance liquid chromatography (HPLC) (HPLC VARIAN 920LC) using the method described by Nour et al. [113]. GSH was quantified using the method of Xue et al. [114] via the reaction of 5,5-dithio-bis-2 nitrobenzoic acid (DTNB). Total phenols were determined using the method of Singleton et al. [115] via the Folin–Ciocalteu reaction. Flavonoids were quantified via the aluminum chloride method, as described by Zhishen et al. [116]. Hydrophilic and lipophilic antioxidant capacities were determined using the DPPH radical, as described by Brand-Williams et al. [117], with some modifications. The hydrophilic compounds were extracted with 100% methanol, and the lipophilic compounds were extracted with hexane-acetone (1:1 v/v).
Free proline content was quantified using the method described by Bates [118]. H2O2 was quantified using the methodology described by Antoniou et al. [119], using potassium iodide as the reaction agent.
The amino acid content of SSE was determined according to Yemm and Cocking [120]. IAA, tZ, and monosaccharides of SSE were quantified by HPLC using the methodologies of Bosco et al. [121], Rivas-Martínez et al. [122], and Rodríguez-Jasso et al. [123], respectively. The rest of the metabolites of SSE were determined according to the methodologies described above.
For the determination of photosynthetic pigments, proteins, enzymatic activity, GSH, total phenols, flavonoids, antioxidant capacity, proline, H2O2, and amino acids, a UV-Vis spectrophotometer was used (Thermo Scientific Model G10S, Waltham, MA, USA).

4.5. Real-Time Reverse Transcription PCR

TRI reagent (TRI Reagent®) was used to extract RNA from the leaves of tomato seedlings, which were subsequently purified with chloroform and precipitated with isopropanol, as described by Cui et al. [124]. The RNA was treated with DNase I (Sigma-Aldrich, Burlington, MA, USA) and quantified using a UV-Vis spectrophotometer with the A260/A280 nm ratio, and the quality was determined by denaturing electrophoresis. cDNA synthesis was performed using a commercial Bioline kit (SensiFAST cDNA Synthesis Kit). The primers were acting as an endogenous gene (ACT) and nine study genes: NCED1 (9-cis-expoxycarotenoid dioxygenase 1), HSP70 (heat shock protein), PIP2 (aquaporin), P5CS1 (delta1-pyrroline-5-carboxylate synthase 1), ERD15 (protein of late embryogenesis), Fe-SOD (iron superoxide dismutase), CAT1 (catalase), cAPX2 (cytosolic ascorbate peroxidase), and PAL5-3 (phenylalanine ammonia lyase). The primers were designed using Primer BLAST software (National Center for Biotechnology Information NCBI, Bethesda, Rockville, MD, USA) and Oligoanalyzer 3.1 (Integrated DNA Technologies IDT, Coralville, IA, USA), except for ERD15, Fe-SOD, and cAPX2, which were obtained from Ziaf et al. [103] and Mascia et al. [125], respectively. The sequences of the primers used are described in Table 4.
Real-time PCRs were performed on Applied Biosystems StepOne™ Equipment version 2.3 (Thermo Fisher Scientific, Waltham, MA, USA) using the ∆∆Ct method, measuring the fluorescence intensity of SYBR™ Select Master Mix (Applied Biosystems, Foster City, CA, USA). PCR was performed in a volume of 20 µL for all genes (10 µL Master Mix, 1 µL of cDNA, the concentration of primers, and nuclease-free water). For the actin gene, the concentration of the forward primer was 72 nM, and 60 nM was used for the reverse primer. For the NCED1, ERD15, cAPX2, and Fe-SOD genes, the concentrations of the primers were 300 nM equimolar. For the HSP70 gene, the concentration of the forward primer was 80 nM, and that of the reverse primer was 100 nM. For the PIP2 and P5CS1 genes, the primer concentration was 100 nM equimolar. For the CAT1 gene, the primer concentration was 200 nM equimolar. For the PAL5-3 gene, the concentration of the forward primer was 150 nM, and 100 nM for the reverse primer. Real-time PCR was run under the following conditions: 10 min at 95 °C and PCR (40 cycles): 15 s at 95 °C and 1 min at 60 °C.

4.6. Experimental Design and Data Analysis

A completely randomized design with a 3 × 2 factorial arrangement was used, considering 20 repetitions per treatment. An analysis of variance and Fisher’s LSD test of means (p ≤ 0.05) were performed. All statistical procedures were performed using Infostat software (v2020). Heatmaps for gene expression were generated in GraphPad Prism 8 statistical software.

5. Conclusions

In the present study, it was shown that the application of SSE under both unstressed and NaCl-stressed conditions improved seedling growth and biomass parameters. In the same way, with the application of SSE and stress by NaCl, the concentration of photosynthetic pigments, nonenzymatic antioxidants, and proline, and the activity of antioxidant enzymes increased. Regarding the defense genes, stress increased their expression, and the use of SSE potentiated gene expression. This indicates that SSE can be an alternative for mitigating the negative effects of salt stress in tomato crops by inducing growth and activating the antioxidant system. However, SSE could also be used in other crops to improve yields and product quality, under both normal and stressful conditions.

Author Contributions

Conceptualization, S.G.-M.; Data curation, O.S.-A.; Formal analysis, A.B.-M. and A.R.-O.; Investigation, O.S.-A. and S.G.-M.; Methodology, S.G.-M.; Writing—original draft, O.S.-A.; Writing—review and editing, O.S.-A., S.G.-M., A.R.-O. and A.B.-M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable for studies not involving humans or animals.

Data Availability Statement

Not applicable.

Acknowledgments

The authors thank CONACyT for the financial support of the project.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Jēkabsone, A.; Andersone-Ozola, U.; Karlsons, A.; Romanovs, M.; Ievinsh, G. Effect of Salinity on Growth, Ion Accumulation and Mineral Nutrition of Different Accessions of a Crop Wild Relative Legume Species, Trifolium fragiferum. Plants 2022, 11, 797. [Google Scholar] [CrossRef] [PubMed]
  2. Ahmad, P.; Ahanger, M.A.; Alam, P.; Alyemeni, M.N.; Wijaya, L.; Ali, S.; Ashraf, M. Silicon (Si) Supplementation Alleviates NaCl Toxicity in Mung Bean [Vigna radiata (L.) Wilczek] Through the Modifications of Physio-biochemical Attributes and Key Antioxidant Enzymes. J. Plant Growth Regul. 2018, 38, 70–82. [Google Scholar] [CrossRef]
  3. Arif, Y.; Singh, P.; Siddiqui, H.; Bajguz, A.; Hayat, S. Salinity induced physiological and biochemical changes in plants: An omic approach toward salt stress tolerance. Plant Physiol. Biochem. 2020, 156, 64–77. [Google Scholar] [CrossRef] [PubMed]
  4. Hernández-Hernández, H.; Juárez-Maldonado, A.; Benavides-Mendoza, A.; Ortega-Ortiz, H.; Cadenas-Pliego, G.; Sánchez-Aspeytia, D.; González-Morales, S. Chitosan-PVA and Copper Nanoparticles Improve Growth and Overexpress the SOD and JA Genes in Tomato Plants under Salt Stress. Agronomy 2018, 8, 175. [Google Scholar] [CrossRef] [Green Version]
  5. Raja, V.; Majeed, U.; Kang, H.; Andrabi, K.I.; John, R. Abiotic stress: Interplay between ROS, hormones and MAPKs. Environ. Exp. Bot. 2017, 137, 142–157. [Google Scholar] [CrossRef]
  6. Hasanuzzaman, M.; Borhannuddin Bhuyan, M.H.M.; Zulfiqar, F.; Raza, A.; Mohsin, S.M.; Al Mahmud, J.; Fujita, M.; Fotopoulos, V. Reactive oxygen species and antioxidant defense in plants under abiotic stress: Revisiting the crucial role of a universal defense regulator. Antioxidants 2020, 9, 681. [Google Scholar] [CrossRef]
  7. Alkharabsheh, H.M.; Seleiman, M.F.; Hewedy, O.A.; Battaglia, M.L.; Jalal, R.S.; Alhammad, B.A.; Schillaci, C.; Ali, N.; Al-Doss, A. Field crop responses and management strategies to mitigate soil salinity in modern agriculture: A review. Agronomy 2021, 11, 2299. [Google Scholar] [CrossRef]
  8. Juárez-Maldonado, A.; Tortella, G.; Rubilar, O.; Fincheira, P.; Benavides-Mendoza, A. Biostimulation and toxicity: The magnitude of the impact of nanomaterials in microorganisms and plants. J. Adv. Res. 2021, 31, 113–126. [Google Scholar] [CrossRef]
  9. Yakhin, O.I.; Lubyanov, A.A.; Yakhin, I.A.; Brown, P.H. Biostimulants in Plant Science: A Global Prespective. Front. Plant Sci. 2017, 7, 2049. [Google Scholar] [CrossRef] [Green Version]
  10. du Jardin, P. Plant biostimulants: Definition, concept, main categories and regulation. Sci. Hortic. 2015, 196, 3–14. [Google Scholar] [CrossRef]
  11. European Union (EU). Regulation of the European Parliament and of the Council Laying down Rules on the Making Available on the Market of EU Fertilizing Products ond Amending Regulations (EC) No 1069/2009 and (EC) No 1107/2009 and Repealing Regulation (EC) No 2003/2003. 2019. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/?uri=OJ:L:2019:170:TOC (accessed on 3 November 2022).
  12. Mukherjee, A.; Patel, J.S. Seaweed extract: Biostimulator of plant defense and plant productivity. Int. J. Environ. Sci. Technol. 2020, 17, 553–558. [Google Scholar] [CrossRef]
  13. Benítez-García, I.; Dueñas-Ledezma, A.K.; Martínez-Montaño, E.; Salazar-Leyva, J.A.; Carrera, E.; Osuna-Ruiz, I. Identification and Quantification of Plant Growth Regulators and Antioxidant Compounds in Aqueous Extracts of Padina durvillaei and Ulva lactuca. Agronomy 2020, 10, 866. [Google Scholar] [CrossRef]
  14. Sariñana-Aldaco, O.; Benavides-Mendoza, A.; Juárez-Maldonado, A.; Robledo-Olivo, A.; Rodríguez-Jasso, R.M.; Preciado-Rangel, P.; Gonzalez-Morales, S. Efecto de extractos de Sargassum spp. en el crecimiento y antioxidantes de plántulas de tomate. Ecosistemas Y Recur. Agropecu. 2021, 8, e2814. [Google Scholar] [CrossRef]
  15. Hamed, S.M.; Abd El-Rhman, A.A.; Abdel-Raouf, N.; Ibraheem, I.B.M. Role of marine macroalgae in plant protection & improvement for sustainable agriculture technology. Beni-Suef Univ. J. Basic Appl. Sci. 2018, 7, 104–110. [Google Scholar] [CrossRef]
  16. Zou, P.; Lu, X.; Zhao, H.; Yuan, Y.; Meng, L.; Zhang, C.; Li, Y. Polysaccharides derived from the brown algae Lessonia nigrescens enhance salt stress tolerance to wheat seedlings by enhancing the antioxidant system and modulating intracellular ion concentration. Front. Plant Sci. 2019, 10, 48. [Google Scholar] [CrossRef] [Green Version]
  17. Diario Oficial de la Federación (DOF). NORMA Oficial Mexicana NOM-182-SSA1-2010, Etiquetado de Nutrientes Vegetales. Available online: https://www.dof.gob.mx/normasOficiales/4371/salud1a1.htm#:~:text=1.1%20Esta%20norma%20establece%20las,regladores%20de%20crecimiento%20tipo%203 (accessed on 6 October 2022).
  18. González-Morales, S.; Solís-Gaona, S.; Valdés-Caballero, M.V.; Juárez-Maldonado, A.; Loredo-Treviño, A.; Benavides-Mendoza, A. Transcriptomics of Biostimulation of Plants Under Abiotic Stress. Front. Genet. 2021, 12, 583888. [Google Scholar] [CrossRef]
  19. Chávez, V.; Uribe-Martínez, A.; Cuevas, E.; Rodríguez-Martínez, R.E.; van Tussenbroek, B.I.; Francisco, V.; Estévez, M.; Celis, L.B.; Monroy-Velázquez, V.; Leal-Bautista, R.; et al. Massive Influx of Pelagic Sargassum spp. on the Coasts of the Mexican Caribbean 2014-2020: Challenges and Opportunities. Water 2020, 12, 2908. [Google Scholar] [CrossRef]
  20. López-Sosa, L.B.; Morales-Máximo, M.; Anastacio-Paulino, R.; Custodio-Hernández, A.; Corral-Huacuz, J.C.; Aguilera-Mandujano, A. Electron Microscopy Characterization of Sargassum Spp. from the Mexican Caribbean for Application as a Bioconstruction Material. Microsc. Microanal. 2021, 27, 3140–3143. [Google Scholar] [CrossRef]
  21. Waghmode, A.V.; Narayankar, C.U.; Nimbalkar, M.S.; Gaikwad, D.K. Exploration of fucoxanthin and astaxanthin in macro alga (Sargassum sp.) by high-performance liquid chromatography. Indian Hydrobiol. 2019, 18, 40–49. [Google Scholar]
  22. Ali, O.; Ramsubhag, A.; Jayaraman, J. Phytoelicitor activity of Sargassum vulgare and Acanthophora spicifera extracts and their prospects for use in vegetable crops for sustainable crop production. J. Appl. Phycol. 2021, 33, 639–651. [Google Scholar] [CrossRef]
  23. Abdel Latef, A.A.H.; Srivastava, A.K.; Saber, H.; Alwaleed, E.A.; Tran, L.S.P. Sargassum muticum and Jania rubens regulate amino acid metabolism to improve growth and alleviate salinity in chickpea. Sci. Rep. 2017, 7, 10537. [Google Scholar] [CrossRef] [PubMed]
  24. Sofy, M.R.; Sharaf, A.E.M.A.; Osman, M.S.; Sofy, A.R. Physiological changes, antioxidant activity, lipid peroxidation and yield characters of salt stressed barely plant in response to treatment with Sargassum extract. Int. J. Adv. Res. Biol. Sci. 2017, 4, 90–109. [Google Scholar] [CrossRef]
  25. Jithesh, M.N.; Shukla, P.S.; Kant, P.; Joshi, J.; Critchley, A.T.; Prithiviraj, B. Physiological and Transcriptomics Analyses Reveal that Ascophyllum nodosum Extracts Induce Salinity Tolerance in Arabidopsis by Regulating the Expression of Stress Responsive Genes. J. Plant Growth Regul. 2019, 38, 463–478. [Google Scholar] [CrossRef]
  26. Shin, Y.K.; Bhandari, S.R.; Jo, J.S.; Song, J.W.; Cho, M.C.; Yang, E.Y.; Lee, J.G. Response to salt stress in lettuce: Changes in chlorophyll fluorescence parameters, phytochemical contents, and antioxidant activities. Agronomy 2020, 10, 1627. [Google Scholar] [CrossRef]
  27. Medrano Macías, J.; López Caltzontzit, M.G.; Rivas Martínez, E.N.; Narváez Ortiz, W.A.; Benavides Mendoza, A.; Martínez Lagunes, P. Enhancement to salt stress tolerance in strawberry plants by iodine products application. Agronomy 2021, 11, 602. [Google Scholar] [CrossRef]
  28. Zhu, D.; Luo, F.; Zou, R.; Liu, J.; Yan, Y. Integrated physiological and chloroplast proteome analysis of wheat seedling leaves under salt and osmotic stresses. J. Proteomics 2021, 234, 104097. [Google Scholar] [CrossRef]
  29. Darko, E.; Végh, B.; Khalil, R.; Marček, T.; Szalai, G.; Pál, M.; Janda, T. Metabolic responses of wheat seedlings to osmotic stress induced by various osmolytes under iso-osmotic conditions. PLoS ONE 2019, 14, e0226151. [Google Scholar] [CrossRef]
  30. Turk, H. Chitosan-induced enhanced expression and activation of alternative oxidase confer tolerance to salt stress in maize seedlings. Plant Physiol. Biochem. 2019, 141, 415–422. [Google Scholar] [CrossRef]
  31. Che-Othman, M.H.; Jacoby, R.P.; Millar, A.H.; Taylor, N.L. Wheat mitochondrial respiration shifts from the tricarboxylic acid cycle to the GABA shunt under salt stress. New Phytol. 2020, 225, 1166–1180. [Google Scholar] [CrossRef]
  32. Gharib, F.A.E.L.; Zeid, I.M.; Salem, O.M.A.-H.; Ahmed, E.Z. Effects of Sargassum latifolium Extract on Growth, Oil Content and Enzymatic Activities of Rosemary Plants under Salinity Stress. Life Sci. J. 2014, 11, 933–945. [Google Scholar]
  33. Fleurence, J. Perspectives on the Use of Algae in Agriculture and Animal Production. Phycology 2021, 1, 79–82. [Google Scholar] [CrossRef]
  34. Rouphael, Y.; Colla, G.; Giordano, M.; El-Nakhel, C.; Kyriacou, M.C.; De Pascale, S. Foliar applications of a legume-derived protein hydrolysate elicit dose-dependent increases of growth, leaf mineral composition, yield and fruit quality in two greenhouse tomato cultivars. Sci. Hortic. 2017, 226, 353–360. [Google Scholar] [CrossRef]
  35. Chen, C.-L.; Song, W.-L.; Sun, L.; Qin, S.; Ren, C.-G.; Yang, J.-C.; Feng, D.-W.; Liu, N.; Yan, J.; Cui, B.-B.; et al. Effect of Seaweed Extract Supplement on Rice Rhizosphere Bacterial Community in Tillering and Heading Stages. Agronomy 2022, 12, 342. [Google Scholar] [CrossRef]
  36. Chandra, S.; Askari, K.; Kumari, M. Optimization of indole acetic acid production by isolated bacteria from Stevia rebaudiana rhizosphere and its effects on plant growth. J. Genet. Eng. Biotechnol. 2018, 16, 581–586. [Google Scholar] [CrossRef]
  37. Hönig, M.; Plíhalová, L.; Husičková, A.; Nisler, J.; Doležal, K. Role of cytokinins in senescence, antioxidant defense and photosynthesis. Int. J. Mol. Sci. 2018, 19, 4045. [Google Scholar] [CrossRef] [Green Version]
  38. Hai, N.N.; Chuong, N.N.; Tu, N.H.C.; Kisiala, A.; Hoang, X.L.T.; Thao, N.P. Role and regulation of cytokinins in plant response to drought stress. Plants 2020, 9, 422. [Google Scholar] [CrossRef] [Green Version]
  39. Liu, Z.; Ren, Z.; Zhang, J.; Chuang, C.C.; Kandaswamy, E.; Zhou, T.; Zou, L. Role of ROS and Nutritional Antioxidants in Human Diseases. Front. Physiol. 2018, 9, 477. [Google Scholar] [CrossRef] [Green Version]
  40. Jeandet, P.; Formela-Luboińska, M.; Labudda, M.; Morkunas, I. The Role of Sugars in Plant Responses to Stress and Their Regulatory Function during Development. Int. J. Mol. Sci. 2022, 23, 5161. [Google Scholar] [CrossRef]
  41. Hernández-Herrera, R.M.; Santacruz-Ruvalcaba, F.; Ruiz-López, M.A.; Norrie, J.; Hernández-Carmona, G. Effect of liquid seaweed extracts on growth of tomato seedlings (Solanum lycopersicum L.). J. Appl. Phycol. 2014, 26, 619–628. [Google Scholar] [CrossRef]
  42. Teixeira, W.F.; Fagan, E.B.; Soares, L.H.; Umburanas, R.C.; Reichardt, K.; Neto, D.D. Foliar and seed application of amino acids affects the antioxidant metabolism of the soybean crop. Front. Plant Sci. 2017, 8, 327. [Google Scholar] [CrossRef] [Green Version]
  43. Gao, F.; Li, Z.; Du, Y.; Duan, J.; Zhang, T.; Wei, Z.; Guo, L.; Gong, W.; Liu, Z.; Zhang, M. The Combined Application of Urea and Fulvic Acid Solution Improved Maize Carbon and Nitrogen Metabolism. Agronomy 2022, 12, 1400. [Google Scholar] [CrossRef]
  44. Clavijo-Herrera, J.; van Santen, E.; Gómez, C. Growth, water-use efficiency, stomatal conductance, and nitrogen uptake of two lettuce cultivars grown under different percentages of blue and red light. Horticulturae 2018, 4, 16. [Google Scholar] [CrossRef]
  45. Iseki, K.; Olaleye, O. A new indicator of leaf stomatal conductance based on thermal imaging for field grown cowpea. Plant Prod. Sci. 2020, 23, 136–147. [Google Scholar] [CrossRef] [Green Version]
  46. Daszkowska-Golec, A.; Szarejko, I. Open or close the gate–Stomata action under the control of phytohormones in drought stress conditions. Front. Plant Sci. 2013, 4, 138. [Google Scholar] [CrossRef] [Green Version]
  47. Brodribb, T.J.; McAdam, S.A.M.; Carins Murphy, M.R. Xylem and stomata, coordinated through time and space. Plant Cell Environ. 2017, 40, 872–880. [Google Scholar] [CrossRef]
  48. Miceli, A.; Vetrano, F.; Moncada, A. Influence of Ecklonia maxima extracts on growth, yield, and postharvest quality of hydroponic leaf lettuce. Horticulturae 2021, 7, 440. [Google Scholar] [CrossRef]
  49. Carrillo, P.; Ciarmiello, L.F.; Woodrow, P.; Corrado, G.; Chiaiese, P.; Rouphael, Y. Enhancing Sustainability by Improving Plant Salt Tolerance through Macro- and Micro-Algal Biostimulants. Biology 2020, 9, 253. [Google Scholar] [CrossRef]
  50. Annunziata, M.G.; Ciarmiello, L.F.; Woodrow, P.; Dell’Aversana, E.; Carillo, P. Spatial and temporal profile of glycine betaine accumulation in plants under abiotic stresses. Front. Plant Sci. 2019, 10, 230. [Google Scholar] [CrossRef] [Green Version]
  51. Samuels, L.J.; Setati, M.E.; Blancquaert, E.H. Toward a Better Understanding of the Potential Benefits of Seaweed Based Biostimulants in Vitis vinifera L. Cultivars. Plants 2022, 11, 348. [Google Scholar] [CrossRef]
  52. Karimi, S.; Karami, H.; Mokhtassi-Bidgoli, A.; Tavallali, V.; Vahdati, K. Inducing drought tolerance in greenhouse grown Juglans regia by imposing controlled salt stress: The role of osmotic adjustment. Sci. Hortic. 2018, 239, 181–192. [Google Scholar] [CrossRef]
  53. Queiroz Zepka, L.; Jacob-Lopes, E.; Roca, M. Catabolism and bioactive properties of chlorophylls. Curr. Opin. Food Sci. 2019, 26, 94–100. [Google Scholar] [CrossRef] [Green Version]
  54. Collini, E. Carotenoids in Photosynthesis: The Revenge of the “Accessory” Pigments. Chem 2019, 5, 494–495. [Google Scholar] [CrossRef]
  55. Domonkos, I.; Kis, M.; Gombos, Z.; Ughy, B. Carotenoids, versatile components of oxygenic photosynthesis. Prog. Lipid Res. 2013, 52, 539–561. [Google Scholar] [CrossRef] [PubMed]
  56. Hernández-Hernández, H.; Gonzáles-Morales, S.; Benavides-Mendoza, A.; Ortega-Ortiz, H.; Cadenas-Pliego, G.; Juárez-Maldonado, A. Effects of Chitosan–PVA and Cu Nanoparticles on the Growth and Antioxidant Capacity of Tomato under Saline Stress. Molecules 2018, 23, 178. [Google Scholar] [CrossRef] [Green Version]
  57. Morales-Espinoza, M.C.; Cadenas-Pliego, G.; Pérez-Alvarez, M.; Hernández-Fuentes, A.D.; Cabrera de la Fuente, M.; Benavides-Mendoza, A.; Valdés-Reyna, J.; Juárez-Maldonado, A. Se Nanoparticles Induce Changes in the Growth, Antioxidant Responses, and Fruit Quality of Tomato Developed under NaCl Stress. Molecules 2019, 24, 3030. [Google Scholar] [CrossRef] [Green Version]
  58. Vijayanand, N.; Ramya, S.S.; Rathinavel, S. Potential of liquid extracts of Sargassum wightii on growth, biochemical and yield parameters of cluster bean plant. Asian Pacific J. Reprod. 2014, 3, 150–155. [Google Scholar] [CrossRef]
  59. Khoshbakht, D.; Ramin, A.A.; Baninasab, B. Effects of sodium chloride stress on gas exchange, chlorophyll content and nutrient concentrations of nine citrus rootstocks. Photosynthetica 2015, 53, 241–249. [Google Scholar] [CrossRef]
  60. Latsague, M.; Sáez, P.; Mora, M. Efecto de la fertilización con nitrógeno, fósforo y potasio, sobre el contenido foliar de carbohidratos, proteínas y pigmentos fotosintéticos en plantas de Berberidopsis corallina Hook.f. Gayana Bot. 2014, 71, 37–42. [Google Scholar] [CrossRef] [Green Version]
  61. Sánchez, E.; Ruiz, J.M.; Romero, L.; Preciado-Rangel, P.; Flores-Córdova, M.A.; Márquez-Quiroz, C. ¿Son los pigmentos fotosintéticos buenos indicadores de la relación del nitrógeno, fósforo y potasio en frijol ejotero? Ecosistemas Y Recur. Agropecu. 2018, 5, 387–398. [Google Scholar] [CrossRef] [Green Version]
  62. Estaji, A.; Kalaji, H.M.; Karimi, H.R.; Roosta, H.R.; Moosavi-Nezhad, S.M. How glycine betaine induces tolerance of cucumber plants to salinity stress? Photosynthetica 2019, 57, 753–761. [Google Scholar] [CrossRef] [Green Version]
  63. Gonzalez-Morales, S.; López-Sánchez, R.C.; Juárez-Maldonado, A.; Robledo-Olivo, A.; Benavides Mendoza, A. A Transcriptomic and Proteomic View of Hydrogen Sulfide Signaling in Plant Abiotic Stress. In Hydrogen Sulfide and Plant Acclimation to Abiotic Stresses; Khan, M., Siddiqui, M., Alamri, S., Corpas, F., Eds.; Springer: Cham, Switzerland, 2021; Volume 1, pp. 161–186. ISBN 978-3-030-73678-1. [Google Scholar]
  64. Oberkofler, V.; Pratx, L.; Bäurle, I. Epigenetic regulation of abiotic stress memory: Maintaining the good things while they last. Curr. Opin. Plant Biol. 2021, 61, 102007. [Google Scholar] [CrossRef] [PubMed]
  65. Kim, J.S.; Jeon, B.W.; Kim, J. Signaling Peptides Regulating Abiotic Stress Responses in Plants. Front. Plant Sci. 2021, 12, 704490. [Google Scholar] [CrossRef] [PubMed]
  66. Zhou, X.; Joshi, S.; Patil, S.; Khare, T.; Kumar, V. Reactive Oxygen, Nitrogen, Carbonyl and Sulfur Species and Their Roles in Plant Abiotic Stress Responses and Tolerance. J. Plant Growth Regul. 2021, 3, 1–24. [Google Scholar] [CrossRef]
  67. Haida, Z.; Hakiman, M. A comprehensive review on the determination of enzymatic assay and nonenzymatic antioxidant activities. Food Sci. Nutr. 2019, 7, 1555–1563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Rajput, V.D.; Harish; Singh, R.K.; Verma, K.K.; Sharma, L.; Quiroz-Figueroa, F.R.; Meena, M.; Gour, V.S.; Minkina, T.; Sushkova, S.; et al. Recent developments in enzymatic antioxidant defense mechanism in plants with special reference to abiotic stress. Biology 2021, 10, 267. [Google Scholar] [CrossRef] [PubMed]
  69. Hsieh, C.-Y.; Huang, Y.-H.; Yeh, H.-H.; Hong, P.-Y.; Hsiao, C.-J.; Hsieh, L.-S. Phenylalanine, tyrosine, and DOPA are bona fide substrates for Bambusa oldhamii BoPAL4. Catalysts 2021, 11, 1263. [Google Scholar] [CrossRef]
  70. Dumanović, J.; Nepovimova, E.; Natić, M.; Kuča, K.; Jaćević, V. The Significance of Reactive Oxygen Species and Antioxidant Defense System in Plants: A Concise Overview. Front. Plant Sci. 2021, 11, 552969. [Google Scholar] [CrossRef]
  71. Elansary, H.O.; Yessoufou, K.; Abdel-Hamid, A.M.E.; El-Esawi, M.A.; Ali, H.M.; Elshikh, M.S. Seaweed extracts enhance salam turfgrass performance during prolonged irrigation intervals and saline shock. Front. Plant Sci. 2017, 8, 830. [Google Scholar] [CrossRef] [Green Version]
  72. Aitouguinane, M.; Bouissil, S.; Mouhoub, A.; Rchid, H.; Fendri, I.; Abdelkafi, S.; Ould El-Hadj, M.D.; Boual, Z.; Dubessay, P.; Gardarin, C.; et al. Induction of Natural Defenses in Tomato Seedlings by Using Alginate and Oligoalginates Derivatives Extracted from Moroccan Brown Algae. Mar. Drugs 2020, 18, 521. [Google Scholar] [CrossRef]
  73. Hashem, H.A.; Mansour, H.A.; El-Khawas, S.A.; Hassanein, R.A. The potentiality of marine macroalgae as biofertilizers to improve the productivity and salt stress tolerance of canola (Brassica napus L.) plants. Agronomy 2019, 9, 146. [Google Scholar] [CrossRef] [Green Version]
  74. Kumari, R.; Kaur, I.; Bhatnagar, A.K. Effect of aqueous extract of Sargassum johnstonii Setchell & Gardner on growth, yield and quality of Lycopersicon esculentum Mill. J. Appl. Phycol. 2011, 23, 623–633. [Google Scholar] [CrossRef]
  75. Taha, R.S.; Seleiman, M.F.; Alotaibi, M.; Alhammad, B.A.; Rady, M.M.; Mahdi, A.H.A. Exogenous potassium treatments elevate salt tolerance and performances of Glycine max L. by boosting antioxidant defense system under actual saline field conditions. Agronomy 2020, 10, 1741. [Google Scholar] [CrossRef]
  76. Taha, R.S.; Seleiman, M.F.; Alhammad, B.A.; Alkahtani, J.; Alwahibi, M.S.; Mahdi, A.H.A. Activated Yeast Extract Enhances Growth, Anatomical Structure, and Productivity of Lupinus termis L. Plants under Actual Salinity Conditions. Agronomy 2021, 11, 74. [Google Scholar] [CrossRef]
  77. Shukla, P.S.; Mantin, E.G.; Adil, M.; Bajpai, S.; Critchley, A.T.; Prithiviraj, B. Ascophyllum nodosum-based biostimulants: Sustainable applications in agriculture for the stimulation of plant growth, stress tolerance, and disease management. Front. Plant Sci. 2019, 10, 655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  78. Weng, J.K.; Philippe, R.N.; Noel, J.P. The rise of chemodiversity in plants. Science 2012, 336, 1667–1670. [Google Scholar] [CrossRef] [Green Version]
  79. Dhara, A.; Raichaudhuri, A. ABCG transporter proteins with beneficial activity on plants. Phytochemistry 2021, 184, 112663. [Google Scholar] [CrossRef]
  80. Prins, M.; Laimer, M.; Noris, E.; Schubert, J.; Wassenegger, M.; Tepfer, M. Strategies for antiviral resistance in transgenic plants. Mol. Plant Pathol. 2008, 9, 73–83. [Google Scholar] [CrossRef]
  81. Ali, S.; Ganai, B.A.; Kamili, A.N.; Bhat, A.A.; Mir, Z.A.; Bhat, J.A.; Tyagi, A.; Islam, S.T.; Mushtaq, M.; Yadav, P.; et al. Pathogenesis-related proteins and peptides as promising tools for engineering plants with multiple stress tolerance. Microbiol. Res. 2018, 212–213, 29–37. [Google Scholar] [CrossRef]
  82. Radhakrishnan, R. Seed pretreatment with magnetic field alters the storage proteins and lipid profiles in harvested soybean seeds. Physiol. Mol. Biol. Plants 2018, 24, 343–347. [Google Scholar] [CrossRef]
  83. Rouphael, Y.; Giordano, M.; Cardarelli, M.; Cozzolino, E.; Mori, M.; Kyriacou, M.C.; Bonini, P.; Colla, G. Plant-and seaweed-based extracts increase yield but differentially modulate nutritional quality of greenhouse spinach through biostimulant action. Agronomy 2018, 8, 126. [Google Scholar] [CrossRef] [Green Version]
  84. Sachdev, S.; Ansari, S.A.; Ansari, M.I.; Fujita, M. Abiotic Stress and Reactive Oxygen Species: Generation, Signaling, and Defense Mechanisms. Antioxidants 2021, 10, 277. [Google Scholar] [CrossRef] [PubMed]
  85. Nguyen, H.T.T.; Bhowmik, S.D.; Long, H.; Cheng, Y.; Mundree, S.; Hoang, L.T.M. Rapid Accumulation of Proline Enhances Salinity Tolerance in Australian Wild Rice Oryza australiensis Domin. Plants 2021, 10, 2044. [Google Scholar] [CrossRef] [PubMed]
  86. El-Beltagi, H.S.; Mohamed, H.I.; Sofy, M.R. Role of Ascorbic acid, Glutathione and Proline Applied as Singly or in Sequence Combination in Improving Chickpea Plant through Physiological Change and Antioxidant Defense under Different Levels of Irrigation Intervals. Molecules 2020, 25, 1702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  87. Zou, P.; Yang, X.; Yuan, Y.; Jing, C.; Cao, J.; Wang, Y.; Zhang, L.; Zhang, C.; Li, Y. Purification and characterization of a fucoidan from the brown algae Macrocystis pyrifera and the activity of enhancing salt-stress tolerance of wheat seedlings. Int. J. Biol. Macromol. 2021, 180, 547–558. [Google Scholar] [CrossRef]
  88. Chun, S.C.; Paramasivan, M.; Chandrasekaran, M. Proline Accumulation Influenced by Osmotic Stress in Arbuscular Mycorrhizal Symbiotic Plants. Front. Microbiol. 2018, 9, 2525. [Google Scholar] [CrossRef] [Green Version]
  89. Arnao, M.B.; Hernández-Ruiz, J.; Cano, A.; Reiter, R.J. Melatonin and carbohydrate metabolism in plant cells. Plants 2021, 10, 1917. [Google Scholar] [CrossRef]
  90. Mao, Y.; Chen, N.; Cao, M.; Chen, R.; Guan, X.; Wang, D. Functional Characterization and Evolutionary Analysis of Glycine-Betaine Biosynthesis Pathway in Red Seaweed Pyropia yezoensis. Mar. Drugs 2019, 17, 70. [Google Scholar] [CrossRef] [Green Version]
  91. Khan, T.A.; Yusuf, M.; Fariduddin, Q. Hydrogen peroxide in regulation of plant metabolism: Signaling and its effect under abiotic stress. Photosynthetica 2018, 56, 1237–1248. [Google Scholar] [CrossRef]
  92. Aerts, N.; Pereira Mendes, M.; Van Wees, S.C.M. Multiple levels of crosstalk in hormone networks regulating plant defense. Plant J. 2021, 105, 489–504. [Google Scholar] [CrossRef]
  93. MacKelprang, R.; Lemaux, P.G. Genetic Engineering and Editing of Plants: An Analysis of New and Persisting Questions. Annu. Rev. Plant Biol. 2020, 71, 659–687. [Google Scholar] [CrossRef] [Green Version]
  94. Medda, S.; Fadda, A.; Mulas, M. Influence of Climate Change on Metabolism and Biological Characteristics in Perennial Woody Fruit Crops in the Mediterranean Environment. Horticulturae 2022, 8, 273. [Google Scholar] [CrossRef]
  95. Drira, M.; Ben Mohamed, J.; Ben Hlima, H.; Hentati, F.; Michaud, P.; Abdelkafi, S.; Fendri, I. Improvement of Arabidopsis thaliana salt tolerance using a polysaccharidic extract from the brown algae Padina pavonica. Algal Res. 2021, 56, 102324. [Google Scholar] [CrossRef]
  96. Al-Ghamdi, A.A.; Elansary, H.O. Synergetic effects of 5-aminolevulinic acid and Ascophyllum nodosum seaweed extracts on Asparagus phenolics and stress related genes under saline irrigation. Plant Physiol. Biochem. 2018, 129, 273–284. [Google Scholar] [CrossRef]
  97. Tuteja, N.; Sopory, S.K. Chemical signaling under abiotic stress environment in plants. Plant Signal. Behav. 2008, 3, 525–536. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  98. Keisham, M.; Mukherjee, S.; Bhatla, S.C. Mechanisms of sodium transport in plants—Progresses and challenges. Int. J. Mol. Sci. 2018, 19, 647. [Google Scholar] [CrossRef] [Green Version]
  99. Guan, C.; Huang, Y.-H.; Cen, H.-F.; Cui, X.; Tian, D.-Y.; Zhang, Y.-W. Overexpression of the Lolium perenne L. Delta1-pyrroline 5-carboxylate synthase (LpP5CS) gene results in morphological alterations and salinity tolerance in switchgrass (Panicum virgatum L.). PLoS ONE 2019, 14, e0219669. [Google Scholar] [CrossRef] [Green Version]
  100. Changan, S.S.; Ali, K.; Kumar, V.; Garg, N.K.; Tyagi, A. Abscisic acid biosynthesis under water stress: Anomalous behavior of the 9-cis-epoxycarotenoid dioxygenase1 (NCED1) gene in rice. Biol. Plant. 2018, 62, 663–670. [Google Scholar] [CrossRef]
  101. ul Haq, S.; Khan, A.; Ali, M.; Khattak, A.M.; Gai, W.-X.; Zhang, H.-X.; Wei, A.-M.; Gong, Z.-H. Heat shock proteins: Dynamic biomolecules to counter plant biotic and abiotic stresses. Int. J. Mol. Sci. 2019, 20, 5321. [Google Scholar] [CrossRef] [Green Version]
  102. Afzal, Z.; Howton, T.C.; Sun, Y.; Mukhtar, M.S. The roles of aquaporins in plant stress responses. J. Dev. Biol. 2016, 4, 9. [Google Scholar] [CrossRef] [Green Version]
  103. Ziaf, K.; Munis, M.F.H.; Samin, G.; Zhang, X.; Li, J.; Zhang, J.; Ye, Z. Characterization of ERD15 gene from cultivated tomato (Solanum lycopersicum). Pakistan J. Agric. Sci. 2016, 53, 27–33. [Google Scholar] [CrossRef]
  104. Steiner, A.A. A universal method for preparing nutrient solutions of a certain desired composition. Plant Soil 1961, 15, 134–154. [Google Scholar] [CrossRef] [Green Version]
  105. Ramya, S.S.; Nagaraj, S.; Vijayanand, N. Influence of Seaweed Liquid Extracts on Growth, Biochemical and Yield Characteristics of Cyamopsis tetragonolaba (L.) Taub. J. Phytol. 2011, 3, 37–41. [Google Scholar]
  106. Kasim, W.A.; Hamada, E.A.M.; El-Din, N.G.S.; Eskander, S. Influence of seaweed extracts on the growth, some metabolic activities and yield of wheat grown under drought stress. Int. J. Agron. Agric. Res. 2015, 7, 173–189. [Google Scholar]
  107. Ramya, S.S.; Vijayanand, N.; Rathinavel, S. Foliar application of liquid biofertilizer of brown alga Stoechospermum marginatum on growth, biochemical and yield of Solanum melongena. Int. J. Recycl. Org. Waste Agric. 2015, 4, 167–173. [Google Scholar] [CrossRef]
  108. Wellburn, A.R. The Spectral Determination of Chlorophylls a and b, as well as Total Carotenoids, Using Various Solvents with Spectrophotometers of Different Resolution. J. Plant Physiol. 1994, 144, 307–313. [Google Scholar] [CrossRef]
  109. Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  110. Dhindsa, R.S.; Plumb-Dhindsa, P.; Thorpe, T.A. Leaf Senescence: Correlated with Increased Levels of Membrane Permeability and Lipid Peroxidation, and Decreased Levels of Superoxide Dismutase and Catalase. J. Exp. Bot. 1981, 32, 93–101. [Google Scholar] [CrossRef]
  111. Nakano, Y.; Asada, K. Purification of ascorbate peroxidase in spinach chloroplasts; its inactivation in ascorbate-depleted medium and reactivation by monodehydroascorbate radical. Plant Cell Physiol. 1987, 28, 131–140. [Google Scholar] [CrossRef]
  112. Sykłowska-Baranek, K.; Pietrosiuk, A.; Naliwajski, M.R.; Kawiak, A.; Jeziorek, M.; Wyderska, S.; Łojkowska, E.; Chinou, I. Effect of L-phenylalanine on PAL activity and production of naphthoquinone pigments in suspension cultures of Arnebia euchroma (Royle) Johnst. Vitro Cell. Dev. Biol. Plant 2012, 48, 555–564. [Google Scholar] [CrossRef] [Green Version]
  113. Nour, V.; Trandafir, I.; Ionica, M.E. HPLC Organic Acid Analysis in Different Citrus Juices under Reversed Phase Conditions. Not. Bot. Horti Agrobot. Cluj-Napoca 2010, 38, 44–48. [Google Scholar] [CrossRef]
  114. Xue, T.; Hartikainen, H.; Piironen, V. Antioxidative and growth-promoting effect of selenium on senescing lettuce. Plant Soil 2001, 237, 55–61. [Google Scholar] [CrossRef]
  115. Singleton, V.L.; Orthofer, R.; Lamuela-Raventós, R.M. Analysis of Total Phenols and Other Oxidation Substrates and Antioxidants by Means of Folin-Ciocalteu Reagent. Methods Enzymol. 1999, 299, 152–178. [Google Scholar] [CrossRef]
  116. Zhishen, J.; Mengcheng, T.; Jianming, W. The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals. Food Chem. 1999, 64, 555–559. [Google Scholar] [CrossRef]
  117. Brand-Williams, W.; Cuvelier, M.E.; Berset, C. Use of a Free Radical Method to Evaluate Antioxidant Activity. LWT Food Sci. Technol. 1995, 28, 25–30. [Google Scholar] [CrossRef]
  118. Bates, L.S. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
  119. Antoniou, C.; Savvides, A.; Georgiadou, E.C.; Fotopoulos, V. Spectrophotometric Quantification of Reactive Oxygen, Nitrogen and Sulfur Species in Plant Samples. In Polyamines: Methods and Protocols, Methods in Molecular Biology; Alcázar, R., Tiburcio, A.F., Eds.; Springer: Berlin/Heidelberg, Germany, 2018; Volume 1694, pp. 155–161. ISBN 9781493973989. [Google Scholar]
  120. Yemm, E.; Cocking, E. The Determination of Amino-acids with Ninhydrin. Analyst 1955, 80, 209–214. [Google Scholar] [CrossRef]
  121. Bosco, R.; Caser, M.; Vanara, F.; Scariot, V. Development of a rapid LC-DAD/FLD method for the simultaneous determination of auxins and abscisic acid in plant extracts. J. Agric. Food Chem. 2013, 61, 10940–10947. [Google Scholar] [CrossRef]
  122. Rivas-Martínez, E.N.; Foroughbakhch-Pournavab, R.; Reyes-Valdés, M.H.; Benavides-Mendoza, A. Determinación de giberelina A4 y trans zeatina ribósido en diferentes órganos de Dasylirion cedrosanum. Rev. Mex. Cienc. Agrícolas 2016, 7, 2063–2069. [Google Scholar] [CrossRef] [Green Version]
  123. Rodriguez-Jasso, R.M.; Mussatto, S.I.; Pastrana, L.; Aguilar, C.N.; Teixeira, J.A. Microwave-assisted extraction of sulfated polysaccharides (fucoidan) from brown seaweed. Carbohydr. Polym. 2011, 86, 1137–1144. [Google Scholar] [CrossRef] [Green Version]
  124. Cui, X.; Tao, X.; Xie, Y.; Fauquet, C.M.; Zhou, X. A DNAβ Associated with Tomato Yellow Leaf Curl China Virus Is Required for Symptom Induction. J. Virol. 2004, 78, 13966–13974. [Google Scholar] [CrossRef] [Green Version]
  125. Mascia, T.; Santovito, E.; Gallitelli, D.; Cillo, F. Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants. Mol. Plant Pathol. 2010, 11, 805–816. [Google Scholar] [CrossRef] [PubMed]
Plants 11 03180 g001 550
Figure 1. Tomato seedlings in the experimental assay. SSE: Sargassum spp. seaweed extracts; ANCP: A. nodosum commercial product; AC: Absolute control; NaCl: 100 mM sodium chloride.
Figure 1. Tomato seedlings in the experimental assay. SSE: Sargassum spp. seaweed extracts; ANCP: A. nodosum commercial product; AC: Absolute control; NaCl: 100 mM sodium chloride.
Plants 11 03180 g001
Plants 11 03180 g002 550
Figure 2. Stomatal conductance in the leaves of tomato seedlings. Different letters within each column indicate significant differences between treatments (LSD, p ≤ 0.05). DAT: Days after transplant; SC: Stomatal conductance; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5; ± bar intervals represent the SD.
Figure 2. Stomatal conductance in the leaves of tomato seedlings. Different letters within each column indicate significant differences between treatments (LSD, p ≤ 0.05). DAT: Days after transplant; SC: Stomatal conductance; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5; ± bar intervals represent the SD.
Plants 11 03180 g002
Plants 11 03180 g003 550
Figure 3. Photosynthetic pigments in the leaves of tomato seedlings. Different letters within each column indicate significant differences between treatments (LSD, p ≤ 0.05). DAT: Days after transplant; DW: Dry weight; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5; ± bar intervals represent the SD.
Figure 3. Photosynthetic pigments in the leaves of tomato seedlings. Different letters within each column indicate significant differences between treatments (LSD, p ≤ 0.05). DAT: Days after transplant; DW: Dry weight; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5; ± bar intervals represent the SD.
Plants 11 03180 g003
Plants 11 03180 g004a 550Plants 11 03180 g004b 550
Figure 4. Enzymatic activity and total proteins in the leaves of tomato seedlings. Different letters within each column indicate significant differences between treatments (LSD, p ≤ 0.05). DAT: Days after transplant; SOD: Superoxide dismutase; CAT: Catalase; APX: Ascorbate peroxidase; PAL: Phenylalanine ammonium lyase; DW: Dry weight. AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5; ± bar intervals represent the SD.
Figure 4. Enzymatic activity and total proteins in the leaves of tomato seedlings. Different letters within each column indicate significant differences between treatments (LSD, p ≤ 0.05). DAT: Days after transplant; SOD: Superoxide dismutase; CAT: Catalase; APX: Ascorbate peroxidase; PAL: Phenylalanine ammonium lyase; DW: Dry weight. AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5; ± bar intervals represent the SD.
Plants 11 03180 g004aPlants 11 03180 g004b
Plants 11 03180 g005 550
Figure 5. Hydrophilic antioxidants and antioxidant capacity in the leaves of tomato seedlings. Different letters within each column indicate significant differences between treatments (LSD, p ≤ 0.05). DAT: Days after transplant; DW: Dry weight; GAE: Gallic acid equivalents; CE: Catechin equivalents; HAC: Hydrophilic antioxidant capacity; DPPH: 2,2-diphenyl-1-picrilhidrazilo; AAE: Ascorbic acid equivalents; LAC: Lipophilic antioxidants capacity; βCE: β-carotene equivalents; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5 except ascorbic acid (n = 4); ± bar intervals represent the SD.
Figure 5. Hydrophilic antioxidants and antioxidant capacity in the leaves of tomato seedlings. Different letters within each column indicate significant differences between treatments (LSD, p ≤ 0.05). DAT: Days after transplant; DW: Dry weight; GAE: Gallic acid equivalents; CE: Catechin equivalents; HAC: Hydrophilic antioxidant capacity; DPPH: 2,2-diphenyl-1-picrilhidrazilo; AAE: Ascorbic acid equivalents; LAC: Lipophilic antioxidants capacity; βCE: β-carotene equivalents; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5 except ascorbic acid (n = 4); ± bar intervals represent the SD.
Plants 11 03180 g005
Plants 11 03180 g006a 550Plants 11 03180 g006b 550
Figure 6. Proline and hydrogen peroxide in the leaves of tomato seedlings. Different letters within each column indicate significant differences between treatments. (LSD, p ≤ 0.05). DAT: Days after transplant; DW: Dry weight; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5; ± bar intervals represent the SD.
Figure 6. Proline and hydrogen peroxide in the leaves of tomato seedlings. Different letters within each column indicate significant differences between treatments. (LSD, p ≤ 0.05). DAT: Days after transplant; DW: Dry weight; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5; ± bar intervals represent the SD.
Plants 11 03180 g006aPlants 11 03180 g006b
Plants 11 03180 g007a 550Plants 11 03180 g007b 550
Figure 7. Heatmap of the relative expression of defense genes in leaves of tomato seedlings. DAT: Days after transplant; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 4. The AC represents a constant value of 1 at the expression level.
Figure 7. Heatmap of the relative expression of defense genes in leaves of tomato seedlings. DAT: Days after transplant; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 4. The AC represents a constant value of 1 at the expression level.
Plants 11 03180 g007aPlants 11 03180 g007b
Plants 11 03180 g008 550
Figure 8. Schematic representation of the experiment. SSE: Sargassum spp. seaweed extracts; DAT: Days after transplant.
Figure 8. Schematic representation of the experiment. SSE: Sargassum spp. seaweed extracts; DAT: Days after transplant.
Plants 11 03180 g008
Table
Table 1. Growth parameters of tomato seedlings.
Table 1. Growth parameters of tomato seedlings.
EvaluationTreatmentSeedling Height (cm)Stem Diameter (mm)Number of Leaves
AC12.00 ± 0.73 bc3.18 ± 0.23 bc6.00 ± 0.00 b
ANCP12.66 ± 1.05 b3.22 ± 0.27 b6.60 ± 0.55 b
11 DATSSE14.04 ± 1.43 a3.54 ± 0.32 a7.40 ± 0.89 a
AC + NaCl11.18 ± 0.60 c2.71 ± 0.14 d6.00 ± 0.71 b
ANCP + NaCl11.50 ± 0.94 bc2.91 ± 0.15 cd6.20 ± 0.45 b
SSE + NaCl11.72 ± 0.91 bc3.11 ± 0.18 bc6.40 ± 0.55 b
AC24.02 ± 0.84 a3.81 ± 0.15 bc8.20 ± 0.45 c
ANCP25.40 ± 1.91 a4.05 ± 0.25 ab8.80 ± 0.45 b
21 DATSSE26.20 ± 2.79 a4.28 ± 0.30 a9.60 ± 0.55 a
AC + NaCl19.18 ± 1.27 b3.09 ± 0.14 d7.80 ± 0.45 c
ANCP + NaCl20.78 ± 1.71 b3.16 ± 0.18 d8.00 ± 0.00 c
SSE + NaCl20.97 ± 0.67 b3.55 ± 0.16 c8.00 ± 0.00 c
AC35.60 ± 0.45 b4.51 ± 0.15 c10.20 ± 0.45 b
ANCP36.80 ± 2.68 ab4.83 ± 0.35 b11.00 ± 0.71 a
31 DATSSE38.38 ± 2.62 a5.18 ± 0.30 a11.40 ± 0.55 a
AC + NaCl24.66 ± 1.09 c3.49 ± 0.14 e8.80 ± 0.45 c
ANCP + NaCl26.00 ± 0.60 c3.56 ± 0.18 e9.00 ± 0.00 c
SSE + NaCl26.44 ± 1.26 c4.05 ± 0.16 d9.20 ± 0.45 c
Different letters within each column indicate significant differences between treatments (LSD, p ≤ 0.05). DAT: Days after transplant; AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; n = 5; ± standard deviation (SD).
Table
Table 2. Fresh and dry biomasses of tomato seedlings at the end of the experiment.
Table 2. Fresh and dry biomasses of tomato seedlings at the end of the experiment.
TreatmentFABFRBTFBDABDRBTDB
(g Plant−1)(g Plant−1)(g Plant−1)(g Plant−1)(g Plant−1)(g Plant−1)
AC19.58 ± 1.34 b3.95 ± 2.24 a–c23.53 ± 3.14 b3.52 ± 0.14 b0.84 ± 0.09 b4.36 ± 0.21 b
ANCP20.49 ± 2.43 b5.91 ± 3.55 a26.40 ± 5.54 ab3.69 ± 0.44 b0.90 ± 0.13 b4.59 ± 0.57 b
SSE23.02 ± 1.51 a5.04 ± 1.71 ab28.06 ± 3.10 a4.03 ± 0.33 a1.12 ± 0.17 a5.15 ± 0.43 a
AC + NaCl9.32 ± 0.93 c1.04 ± 0.57 d10.36 ± 1.48 c1.55 ± 0.14 c0.37 ± 0.09 d1.92 ± 0.23 c
ANCP + NaCl10.04 ± 0.85 c2.22 ± 1.41 cd12.27 ± 2.23 c1.61 ± 0.15 c0.43 ± 0.07 cd2.04 ± 0.21 c
SSE + NaCl11.06 ± 1.11 c2.43 ± 1.35 b–d13.49 ± 2.02 c1.72 ± 0.10 c0.56 ± 0.15 c2.28 ± 0.20 c
CV (%)9.3759.0916.829.3617.4310
Different letters within each column indicate significant differences between treatments (LSD, p ≤ 0.05). AC: Absolute control; ANCP: A. nodosum commercial product; SSE: Sargassum spp. seaweed extracts; NaCl: 100 mM sodium chloride; FAB: Fresh aerial biomass; FRB: Fresh root biomass; TFB: Total fresh biomass; DAB: Dry aerial biomass; DRB: Dry root biomass; TDB: Total dry biomass; CV: Coefficient of variation; n = 5; ± SD.
Table
Table 3. Biochemical characterization of SSE.
Table 3. Biochemical characterization of SSE.
CompositionConcentration
pH5.60 ± 0.10
EC (dS m−1)0.83 ± 0.01
Total proteins (mg g−1 DW)3.47 ± 0.08
GSH (mg g−1 DW)3.29 ± 0.02
Amino acids (mg g−1 DW)0.43 ± 0.008
Total phenols (mg EAG g−1 DW)8.43 ± 0.79
Flavonoids (mg EC g−1 DW)2.83 ± 0.04
IAA (mg kg−1 DW)0.57 ± 0.07
tZ (µg g−1 DW)175.99 ± 7.49
Glucose (mg 100 g−1 DW)107.87 ± 0.004
Galactose (mg 100 g−1 DW)74.01 ± 0.49
Fucose (mg 100 g−1 DW)258.37 ± 9.82
Mannitol (mg 100 g−1 DW)29.96 ± 0.40
ACTE DPPH (mg g−1 DW)53.54 ± 1.70
SSE: Sargassum spp. seaweed extracts; EC: Electric conductivity; GSH: Reduced glutathione; IAA: Indole-3-acetic acid; tZ: Trans-zeatin; ACTE: Antioxidant capacity in trolox equivalents; DPPH: 2,2-diphenyl-1-picrylhydrazyl; DW: Dry weight; n = 3 except GSH, amino acids and total phenols (n = 5) ± SD.
Table
Table 4. Primer sequences of the analyzed genes.
Table 4. Primer sequences of the analyzed genes.
GeneForward Primer 5′-3′Reverse Primer 5′-3′
ACTCCCAGGCACACAGGTGTTACAGGAGCAACTCGAAGCTC
NCED1CTTATTTGGCTATCGCTGAACCCCTCCAACTTCAAACTCATTGC
HSP70TGCTGGAGGTGTTATGACCAGACTCCTCTTGGTGCTGGAG
PIP2CTGCACCGTTGCTCGATTTTGCGACAGTGACGTAGAGGAA
P5CS1CTGTTGTGGCTCGAGCTGATGACGACCAACACCTACAGCA
ERD15AGGCATCAAGTCATCACTCTCTGGTGAGGTAAATGTGAGTAAGAACCAACG
Fe-SODCTGGGAATCTATGAAGCCCAACGGACAAATTGTGTTGCTGCAGCTGCCTT
CAT1TCGCGATGGTGCTATGAACACTCCCCTGCCTGTTTGAAGT
cAPX2GTGACCACTTGAGGGACGTGTTTGTACCAGAACGCTCCTTGTGGCATCTT
PAL5-3GGAGGAGAATTTGAAGAATGCTGTGTCCCTTTCCACCACTTGTAGC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sariñana-Aldaco, O.; Benavides-Mendoza, A.; Robledo-Olivo, A.; González-Morales, S. The Biostimulant Effect of Hydroalcoholic Extracts of Sargassum spp. in Tomato Seedlings under Salt Stress. Plants 2022, 11, 3180. https://doi.org/10.3390/plants11223180

AMA Style

Sariñana-Aldaco O, Benavides-Mendoza A, Robledo-Olivo A, González-Morales S. The Biostimulant Effect of Hydroalcoholic Extracts of Sargassum spp. in Tomato Seedlings under Salt Stress. Plants. 2022; 11(22):3180. https://doi.org/10.3390/plants11223180

Chicago/Turabian Style

Sariñana-Aldaco, Oscar, Adalberto Benavides-Mendoza, Armando Robledo-Olivo, and Susana González-Morales. 2022. "The Biostimulant Effect of Hydroalcoholic Extracts of Sargassum spp. in Tomato Seedlings under Salt Stress" Plants 11, no. 22: 3180. https://doi.org/10.3390/plants11223180

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop