Next Article in Journal
Metabolomics-Driven Discovery of an Introduced Species and Two Malaysian Piper betle L. Variants
Next Article in Special Issue
Lanthanum Promotes Bahiagrass (Paspalum notatum) Roots Growth by Improving Root Activity, Photosynthesis and Respiration
Previous Article in Journal
A Review of Rhazya stricta Decne Phytochemistry, Bioactivities, Pharmacological Activities, Toxicity, and Folkloric Medicinal Uses
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 10
Issue 11
10.3390/plants10112509
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of Hsp90 Gene Family in Perennial Ryegrass and Expression Analysis under Various Abiotic Stresses

by
Charlotte Appiah
1,
Zhong-Fu Yang
1,
Jie He
1,
Yang Wang
1,
Jie Zhou
1,
Wen-Zhi Xu
2,
Gang Nie
1,* and
Yong-Qun Zhu
2,*
1
Department of Forage Science, College of Grassland Science and Technology, Sichuan Agricultural University, Chengdu 611130, China
2
lnstitute of Agricultural Resources and Environment, Sichuan Academy of Agricultural Sciences, Chengdu 610066, China
*
Authors to whom correspondence should be addressed.
Plants 2021, 10(11), 2509; https://doi.org/10.3390/plants10112509
Submission received: 5 October 2021 / Revised: 15 November 2021 / Accepted: 16 November 2021 / Published: 19 November 2021
(This article belongs to the Special Issue Stress Biology of Turfgrass)
Browse Figures
Versions Notes

Abstract

:
The heat shock protein 90 (Hsp90) is a protein produced in plants in response to stress. This study identified and analyzed Hsp90 gene family members in the perennial ryegrass genome. From the results, eight Hsp90 proteins were obtained and their MW, pI and number of amino acid bases varied. The amino acid bases ranged from 526 to 862. The CDS also ranged from 20 (LpHsp0-4) to 1 (LpHsp90-5). The least number of CDS regions was 1 (LpHsp90-5) with 528 kb amino acids, while the highest was 20 (LpHsp90-4) with 862 kb amino acids, which showed diversity among the protein sequences. The phylogenetic tree revealed that Hsp90 genes in Lolium perenne, Arabidopsis thaliana, Oryza sativa and Brachypodium distachyon could be divided into two groups with five paralogous gene pairs and three orthologous gene pairs. The expression analysis after perennial ryegrass was subjected to heat, salt, chromium (Cr), cadmium (Cd), polyethylene glycol (PEG) and abscisic acid (ABA) revealed that LpHsp90 genes were generally highly expressed under heat stress, but only two LpHsp90 proteins were expressed under Cr stresses. Additionally, the expression of the LpHsp90 proteins differed at each time point in all treatments. This study provides the basis for an understanding of the functions of LpHsp90 proteins in abiotic stress studies and in plant breeding.

1. Introduction

Improving stress tolerance is among the major efforts of breeding advancement in cool season grass species [1]. Perennial ryegrass (Lolium perenne) is one of the major species of forage and turf grasses extensively planted in warm temperate to subtropical regions around the world, because it is to plant, has better tolerance to abiotic stresses, and requires low maintenance [2]. However, achieving the potential yield after cultivation of perennial ryegrass is limited due to exposure to abiotic stresses in cultivated lands [3]. Abiotic stresses such as cold, drought, salinity, freezing, high light intensity and heat cause cell injury resulting in secondary stresses such as osmotic and oxidative stresses that critically impact the quality and yield of the perennial ryegrass plant [4,5,6]. Moreover, the impact of stresses in Lolium perenne is evident in limiting cultivation, leaf appearance, seed emergence, reducing dry matter by up to 25% and causing plant death [7,8,9,10]. The response of plants to heat shock is similar to that of other organisms when exposed to adverse stress conditions, producing highly conserved stress proteins called heat shock proteins (Hsp) [11,12,13].
Heat shock proteins are expressed in response to stresses and are highly conserved at both the cellular and organismic levels [14,15]. Generally, plants have five major classifications of Hsps based on their molecular size: Hsp100, Hsp90, Hsp70, Hsp60 and small Hsp (smHsp) [16]. One of the most numerous proteins in the cytoplasm of prokaryotic and eukaryotes belongs to the Hsp90 family, constituting 1–2% of the total protein level [17]. Hsp90 is an important constituent of cells at developmental stages under normal conditions, aiding in protein translocation, folding and degradation [18]. Furthermore, the heat shock protein transcript is significantly upregulated under heat stress [19], and also some stresses are known to induce synthesis and expression of heat shock proteins in cells [20]. Under stress conditions, Hsp90 functions as a homeostatic agent by reestablishing the damaged normal protein structure [5,21]. Hsp90 has important functions in both animals and plants. Hsp90 is abundantly expressed in the cytoplasm in soluble form at normal temperatures in yeast, fruit flies, and vertebrate families, while it accumulates rapidly in the nucleus under heat shock conditions [22]. Hsp90 has been well characterized in Oryza sativa, Arabidopsis thaliana and Solanum lycopersicum [18,19,20]. Hsp90 was also recently identified in Aeluropus littoralis, Hordeum vulgare, Camellia sinensis and Cucumis sativus [23,24,25,26].
Hsp90 is an ATP-regulated dimeric chaperone mainly consisting of three highly conserved domains: C-terminal domain of about 25 kDa that binds to the substrate, the 35 kDa intermediate domain, and the 12 kDa N-terminal domain of the ATP-binding site. Hsp90 cooperates with other chaperones to form a multiprotein chaperone complex in order to play its role [27]. Hsp90 can be further divided into five subgroups in accordance to the source and subcellular localization. The subgroups are namely Hsp90A, Hsp90B, Hsp90C, TRAP (TNF receptor-associated protein) and HTPG (high temperature protein G) [28]. Hsp90A contains no signal peptide and is located in the cytoplasm. The main subtypes include Hsp90α (inducible form) and Hsp90β (constitutive form), which are the result of gene duplications about 500 million years ago [25,26]. Hsp90B, Hsp90C and TRAP are located in the endoplasmic reticulum, chloroplast and mitochondria (Animalia), respectively, because they contain signal peptides. HTPG refers to the Hsp90 of prokaryotes and is distributed in most bacteria [24,28]. Several biological variants of the HSP90 gene have also been well characterized in some plants. In Arabidopsis, AtHsp90-5 is important for chloroplast biogenesis and embryogenesis [29,30]. In Brassica napus, Hsp90 plays a vital role in the processes of seed development and germination, while in cotton Hsp90 has been found to play a crucial role in cotton fiber differentiation and development by maintaining cellular homeostasis [31,32,33,34,35,36]. Hsp90s, as housekeeping proteins in plants, can be induced by various abiotic and biotic stresses [37]. Expression of Hsp90 in Arabidopsis thaliana is developmentally regulated and is responsive to abiotic stresses, phytohormones, and light and dark transitions [19,21,38,39,40]. The overexpression of AtHsp90-2, AtHsp90-5, and AtHsp90-7 reduces tolerance to salt and drought stresses whiles improving tolerance to high concentrations of Ca2+ [39]. Moreover, the overexpression of Hsp90-2 in Arabidopsis thaliana may inhibit the transcription of HsfA2, and HsfA2 expressed under the inhibition of Hsp90-2 contributes to the resistance to oxidative stress [41]. Similarly, an Hsp90 inhibitor produced by root-peripheral fungi may inhibit plant growth and development, but also increase the resistance of Arabidopsis to high temperatures [42]. The Hsp90 complex in Arabidopsis directly regulates the activity of resistance proteins and plays a key role in disease resistance as well [43]. The induction of ABA responsive genes is delayed by overexpression of cytosolic AtHsp90-2, but is hardly affected by overexpression of AtHsp90-5 and AtHsp90-7 under conditions of salt and drought stress, which implies that different cellular compartment localized Hsp90s in Arabidopsis thaliana might contribute to responses to abiotic stresses by different functional mechanisms, probably through ABA- or Ca2+ dependent pathways [39]. OsHsp90-2 and OsHsp90-4 were also found to be up-regulated to drought, cold, heat and salt stresses [38]. The resistance of tobacco leaves to mosaic virus increases because of the interaction of Hsp90 with RAR1 and TIR-NB-LRR in tobacco leaves [44]. In tobacco, NtHsp90s were strongly induced by heat stress, while weakly activated by ABA treatment, with expression pattern analysis indicating that NtHsp90-4, NtHsp90-5, and NtHsp90-9 were induced by various abiotic stresses. The expression level of UpHsp90 in Ulva pertusa is notably positively regulated by the change in temperature difference between day and night, but it was almost unaffected under long-term treatment with heavy metal stress [45]. In potatoes, Hsp90s may be related to the color of potato tuber chip [46]. Hsp90s play vital roles in the growth of tumor cells. For example, geldanamycin can specifically interact with the ATPase active site of Hsp90, preventing the binding of Hsp90 and ATP, and finally achieve the purpose of inhibiting tumor [47]. Using interference technology, the expression level of Hsp90 was reduced, and it was found that the division rate of U937 cells was significantly reduced [48].
According to previous studies, eight Hsp90 genes were identified in Oryza sativa, seven in Arabidopsis thaliana, eight in Brachypodium distachyon, ten in P. trichocarpa, 21 in Nicotiana tabacum, seven in Solanum lycopersicum, and twelve in Zea mays [40,49,50,51]. However, the identification of the perennial ryegrass Hsp90 gene family has not been studied yet. The completion of genome-wide sequencing of perennial ryegrass will provide the necessary information for data mining of Hsp90 at the whole genome level. In this study, we performed a genome-wide survey of Hsp90 in the perennial ryegrass genome database, and a complete overview was reported on gene structure and phylogenetic and conserved motif characteristics. Additionally, the expression levels of the LpHsp90 genes under various abiotic stresses were studied. The results will be helpful for further study of the functional characteristics of Hsp90 genes in response to abiotic stress in perennial ryegrass.

2. Results

2.1. Identification of LpHsp90 Genes in Perennial Ryegrass

Eight LpHsp90 genes were identified after the removal of redundant sequences from the genome database of perennial ryegrass. LpHps90 proteins were renamed according to their chromosomal locations; that is, LpHsp90-1 to LpHsp90-8. LpHsp90 sequences obtained varied in length, which ranged from 528 (LpHsp90-5) to 862 (LpHsp90-4) amino acids, with an average of 779. The pI values ranged from 4.89 (LpHsp90-5) to 5.57 (LpHsp90-4) and with a MW ranging from 61214.61 kd (LpHsp90-5) to 96712.15 kd (LpHsp90-4). The LpHsp90s were highly cytoplasmic (LpHsp90-1, 2, 3, 5, 7 and 8) with the exception of LpHsp90-4 and LpHsp90-6, which were nuclear and ER subcellular localized, respectively (Table 1). Moreover, the analysis of the cis-acting elements of perennial ryegrass Hsp90 genes showed that plant hormone responsiveness was identified, implying that LpHsp90 genes might be involved in various plant stress-responsive pathways and closely related to the function of plant hormones such as abscisic acid, gibberellin and methyl-jasmonate (Table S1).

2.2. Phylogenetic Analysis and Multiple Sequence Alignment

The Hsp90 protein sequence alignments of Lolium perenne, Oryza sativa, Arabidopsis thaliana and Brachypodium distachyon were used to construct a phylogenetic tree employing the maximum-likelihood method with 1000 bootstraps to explore the evolutionary relationship among the plant species using MEGA6 (Figure 1). The Hsp90 protein sequences were classified into two main groups (group I and II), and each group was further divided into two subgroups (Ia, Ib, IIa and Iib). The group Iib (15 members) had the largest number of members, followed by group Ib (8 members). It was also seen that groups Ia and Iia had 4 members each. Additionally, the phylogenetic tree showed that there was high similarity among cytosolic Hsp90s and less similarity among the organelle-localized members.
The phylogenetic tree analysis showed that there were five pairs of paralogs within species, of which two were from Lolium perenne (LpHsp90-7 and LpHsp90-8, LpHsp90-3 and LpHsp90-5), one pair in Oryza sativa (OsHsp90-3 and OsHsp90-4), one pair in Brachypodium distachyon (Bd3g39620 and Bd3g39590) and one pair in Arabidopsis thaliana (AtHsp90-2 and AtHsp90-3) (Figure S1) [50]. There were three orthologous gene pairs among the species (Bd4g06370 and LpHsp90-4, Bd1g30130 and LpHsp90-6, Bd4g32941 and LpHsp90-2) [51]. The orthologous and paralog genes may predict the functions and characteristics of the LpHsp90 genes in the evolutionary relation with Arabidopsis thaliana, Brachypodium distachyon and Oryza sativa [52].

2.3. Conserved Motif and Gene Structure Analysis of LpHsp90 Proteins

A maximum likelihood phylogenetic tree was constructed using eight protein sequences of LpHsp90 (Figure 2a). The LpHsp90 sequences were divided into two main subgroups according to the bootstrap values and motif compositions. Ten conserved motifs were identified using the online software MEME (Figure 2b). It was observed that all LpHsp90 protein sequences in the same group had similar motif compositions and positionings. All motifs were arranged in the order of motif -5, motif-9, motif-8, motif-6, motif-4, motif-10, motif-3, motif-2, motif-7 and motif-1 apart from LpHsp90-5. In group Ia, it was observed that LpHsp90-5 had only seven motifs with the exclusion of motif-5, motif-9 and motif-8, but was similar in motif position with LpHsp90-1 and LpHsp90-3, which may be due to evolutionary change. Additionally, LpHsp9-2, LpHsp90-7 and LpHsp90-8 in group Iib were similar in motif composition and positioning. Details of motif logo and consensus are listed in supplement file Figure S2. Besides, three heat shock genes (LpHsp90-1, LpHsp90-3 and LpHsp90-5) containing the C-terminal EEVD motif were predicted that they functionally interacted with other family members and were seen to be highly similar (Figure S3).
The analysis of the exon-intron structure of Hsp90 protein sequences of perennial ryegrass may provide insights into the evolution of the LpHsp90 gene family [53]. The online software GSDS tool was used to obtain the exon-intron structure of the Hsp90 protein sequences. Figure 2c revealed a coding sequence of LpHsp90 protein interrupted by introns. The least number of CDS regions was one (LpHsp90-5), with 528 kb amino acids, while the highest was twenty (LpHsp90-4), with 862 kb amino acids, which showed diversity among the protein sequences. LpHsp90-7 had the longest gene structure due to the length of the intron, although LpHsp90 had the highest number of CDS regions. Moreover, comparing LpHsp90-8 and LpHsp90-7, they were different in gene structure but had the same MW, pI and number of amino acids.

2.4. Expression Profile of LpHsp90 in Response to Abiotic Stresses

Most plants have mechanisms for defense against stress, and Hsp90 genes are known to be expressed in response to these abiotic stresses [31]. To analyze the expression pattens of LpHsp90 under abiotic stress, eight LpHsp90 proteins were analyzed using the qRT-PCR technique. As shown in Figure 3, Figure 4 and Figure 5, different expression patterns were observed under ABA, cadmium (Cd), chromium (Cr), salt (NaCl), heat and PEG induced abiotic stresses. It was observed that LpHsp90 gene regulation was consistent across all stresses at the 0-h time point.
LpHsp90 was highly expressed under heat stress as compared to other treatments. LpHsp90-5 had the highest expression value under heat stress, which was recorded at two time points, 6 h and 12 h (Figure 3). At 6 h, it was also observed that LpHsp90-2 and LpHsp90-4 were substantially expressed.
Under salt stress, LpHsp90-5 was significantly expressed at 12 h (Figure 4a). Lphsp90-4 was seen to be expressed at 12 h also. Considering drought induced by PEG treatment at 6 h, LpHsp90-7 was highly induced at 12 h (Figure 4b). LpHsp90-5 and LpHsp90-8 were not expressed at any time point. It was observed that the expression patterns of LpHsp90 proteins were irregular at the various time points, owing to the fact that an increase in expression at 6 h may decrease at 12 h or an increase in expression at 24 h may decrease at 48 h. ABA treatment up-regulated LpHsp90-5 consistently across all time points, while LpHsp90-7 was not induced by ABA across all time points (Figure 4c). Some LpHsp90 genes (LpHsp90-1, LpHsp90-2, LpHsp90-3, LpHsp90-4, LpHsp90-6 and LpHsp90-8) were seen to have an undulating expression pattern, thus their expression may be affected by the longevity of exposure to ABA stress.
Under Cr treatment, LpHsp90-7 was significantly expressed at 6 h but was seen to have reduced with longer time of exposure. LpHsp90-5 was also observed to be expressed at the 6 h time point. Further, LpHsp90-2 was highly expressed at 24 h but reduced at 48 h, while LpHsp90-3 was induced at 48 h under Cd stress (Figure 5a). Cr stress induced the weakest expression, although LpHsp90-1 and LpHsp90-3 were induced at the 48 h time point while all of the remaining six LpHsp90 genes were fairly activated compared to other treatments.
Generally, LpHsp90-1, LpHsp90-3, LpHsp90-4 and LpHsp90-6 were induced under five stresses, while LpHsp90-7 and LpHsp90-8 were induced under only two stresses. LpHsp90 showed the highest expression at 6 h (LpHSP90-5, under heat stress), and the lowest expression was recorded at 48 h (LpHsp90-8, under Cd stress). A heatmap showing the expression of each LpHsp90 gene was drawn under all six abiotic treatments (Figure S4).

3. Discussion

The heat stress proteins have been classified based on their molecular weights into Hsp100, Hsp90, Hsp70, Hsp60 and smHsp [54]; among them, Hsp90 was known to be important and highly conserved [55,56]. HSPs were first identified in the salivary gland chromosomes of Drosophila larva [57]. Later, other studies found organisms that produced a series of proteins of different sizes, known as HSPs, in response to increased temperature [58]. The study of Hsp90 genes proved that they were not only related to stress signal transduction in plants, folding of receptors, transcription factors and kinases and physiological processes [51,52,53,58], but also to assisting cell survival under stresses [59]. Studies have found out that besides high temperatures, abiotic stresses such as drought, salinity, heavy metals and ABA could induce the production of Hsp90 in plants [60,61]. Hsp90 proteins have been identified in plants and differences in their numbers are attributable to their genome sizes. Seven Hsp90 proteins were identified in Arabidopsis thaliana [38], 10 in P. trichocarpa [62], 21 in Nicotiana tabacum [63], seven in Solanum lycopersicum [64], seven in Oryza sativa [65], eight in Brachypodium distachyon and 12 in Zea mays (Maize genome database, http://www.maizegdb.org, accessed on 1 August 2020). As perennial ryegrass is one of the major species of forage and turf grasses extensively planted in warm temperate to subtropical regions around the world, it was expedient to obtain genes that would further aid in its improvement. Therefore, it was necessary to identify Hsp90 genes related to various abiotic stresses in perennial ryegrass. The identification of Lolium perenne Hsp90 will provide more insights and fundamental information into genetic improvements in response to stressful conditions in other plants.
In this study, eight Hsp90 protein sequences were identified in the perennial ryegrass genome database. The Hsp90s may play a role in the physiological and environmental stability of perennial ryegrass. The LpHsp90s identified had different biophysical and chemical properties, which indicated diversity among the LpHsp90 protein sequences. The isoelectric point of the LpHsp90 protein sequences ranged from 4.89 to 5.57, making them acidic, which is consistent with Hsps found in Arabidopsis thaliana, Solanum lycopersicum and other plants [66]. Phylogenetic analysis between Hsp90s of Lolium perenne, Arabidopsis thaliana, Oryza sativa and Brachypodium distachyon divided the Hsps into two groups, consistent with other studies performed [67]. Additionally, phylogenetic analysis aided in the identification of five paralog gene pairs among the plant species. This may imply that most species expanded according to their own species-specific approach during evolution of the Hsp90 family [50,68]. This finding is consistent with gene families found in cereals such as rice and also in Nicotiana tabacum [50,69]. The structure of proteins is known to determine the function they may perform [50,67]. According to the study, LpHsp90 protein sequences had different gene structure. The number of introns is mostly related to the sensitivity of gene transcription regulation, thus the lesser the number of introns, the more likely that a plant has the ability to adapt to different developmental and environmental stimuli [70]. Theoretical pI and number of amino acids between LpHsp90-7 and LpHsp90-8 do not imply they may perform the same function due to the difference in their gene structure. Furthermore, the predicted cis-acting elements from Plantcare stated the likelihood of LpHsp90-7 to be involved in responsiveness to MeJA and gibberellin.
The study of the expression of Hsp90 proteins in response to abiotic stresses has been undertaken in various plant species. In this study, it was seen that most LpHsp90 protein genes were induced under most of the stresses. Heat stress recorded the highest expression in all LpHsp90 proteins, which is consistent with studies in populous and CsHSP90 genes, although the expression levels of certain genes were brief and slightly decreased at individual time points [25,62]. The comparatively lowest level of expression was recorded under Cr stress. LpHsp90-5 was observed to be highly expressed under ABA, heat and salt stress, but these were at different time points. In ABA, there was a rapid rise in the expression of LpHsp90-5, with the highest expression level recorded at 48 h. Unlike ABA, NaCl stress induced high expression in LpHsp90-5 at 12 h but with a rapid reduction at 24 h and 48 h. Under heat stress, there was also a decrease in expression after peaking at 6 h. Additionally, LpHsp90-7 was highly expressed under PEG and Cd stress, and these were also recorded at different time points. LpHsp90-1 and LpHs90-3 were the only Hsp90 proteins expressed under Cr heavy metal stress. This could imply that LpHsp90-5 could be an LpHs90 gene of interest in ABA, heat, and salt stress; LpHsp90-7 to PEG and Cd; and LpHsp90-3 and LpHsp90-1 to Cr. Analysis of AtHsp90-5 and AtHsp90-6 expression revealed that the former is mildly induced by heat shock and that the latter is barely induced by heat shock; this was also observed in LpHsp90-5 in this study. Comparatively, LpHsp90-2 expression levels increased modestly with heat stress; this was also observed in AtHsp90-2, the levels of which were mildly increased after treatment with NaCl or heavy metals [39]. Therefore, further studies may be carried out to explain the functions of LpHsp90-7, LpHsp90-5, LpHsp90-3 and LpHsp90-1 in relation to these stresses. Moreover, the various time points of the expression of the LpHsp90 proteins should also be further investigated, since the effects of stress are influenced by intensity and longevity. It was also observed that the paralogous pairs (Lphsp90-5 and LpHsp90-3, LpHsp90-7 and LpHsp90-8) had different expression profiles under the various abiotic stresses.
These results showed that LpHsp90s were induced under ABA, PEG, Cr, Cd NaCl and heat stress, and individual LpHsp90s may have different regulatory patterns that reflect their potential roles in the response to different abiotic stresses. Heat stress induced the highest response of all stresses, indicating that the LpHsp90 protein was very sensitive to heat stress.

4. Materials and Methods

4.1. Identification of LpHsp90 Genes in Perennial Ryegrass

Arabidopsis thalianaHsp90 protein sequences were downloaded from the TAIR databases (http://www.arabidopsis.org/, accessed on 1 April 2020) [39]. The protein sequences of Arabidopsis thaliana Hsp90 genes were used as queries to perform BLASTP against the genome resource of perennial ryegrass, which was downloaded from the Perennial Ryegrass Genome Sequencing Project (http://185.45.23.197:5080/ryegrassgenome, accessed on 1 April 2020) [71], followed by the removal of redundant proteins. Subcellular localization of LpHsp90 proteins was predicted by using CELLO (http://cello.life.nctu.edu.tw/, accessed on 1 August 2020). The physical and chemical parameters of the LpHsp90 protein sequences were obtained from ProtParam (https://web.expasy.org/protparam, accessed on 1 August 2020).

4.2. Phylogenetic Analysis and Multiple Sequence Alignment

A multiple sequence alignment of Lolium perenne, Arabidopsis thaliana, Brachypodium distachyon and Oryza sativa Hsp90 protein sequences was analyzed using ClustalW [72]. Oryza sativa Hsp90s were obtained from the Rice Genome Annotation Project (http://rice.plantbiology.msu.edu/, accessed on 1 April 2020). Brachypodium distachyon were obtained from the Phytozome link in Brachypodium distachyon Assembly and Gene Annotation in ensemble (http://www.phytozome.net/, accessed on 1 April 2020). A maximum-likelihood (ML) phylogenetic tree was constructed with MEGA version 6.0 employing 1000 bootstraps in order to examine the evolutionary relationships among the Hsp90 family of Lolium perenne, Arabidopsis thaliana, Brachypodium distachyon and Oryza sativa [73,74].

4.3. Exon-Intron Structure, Conserved Motif, Characteristics Analysis of LpHsp90

The exon-intron structure of Hsp90 genes was obtained using the online Gene Structure Display Server v2.0 (GSDS: http://gsds.cbi.pku.edu.cn, accessed on 1 October 2020) [75] with the giff3 file. The MEME program (Multiple Expectation Maximization for Motif Elicitation (http://memesuite.org/tools/meme/, accessed on 1 October 2020) [76] was used to identify the conserved motifs in the LpHsp90 protein sequences.

4.4. Plant Materials, Growth Conditions and Stress Application

Viable seeds of Lolium perenne cv ‘Mathilde’ were grown in a container with dimensions 20 cm × 15 cm × 10 cm. The container was filled with quartz sand and distilled water to one-third of the volume, after which the seeds were evenly spread on the sand to avoid clustering of plants. The container with the seeds was moved to the growth chamber. Plants were grown at a temperature of 20 °C and 15 °C (12 h day/12 h night) at 70% relative humidity and 750 µmol·m−2·s−1 PAR illumination. After 14 days of germination, Hoagland solution dissolved in distilled water following the manufacturer’s protocol was used to supply plants with nutrients for 46 days. The plants were separated into groups of five for the various stress applications.
For salt stress, sodium chloride (NaCl) was used at a concentration of 250 mM by dissolving NaCl in Hoagland solution. For heavy metal stresses, chromium (Cr) (K2Cr2O7) and cadmium (Cd) (CdCl3·6H2O) were used at a concentration of 300 mg/L and 200 mg/L, respectively. Twenty-percent polyethylene glycol 6000 (PEG) was used to stimulate drought stress after dissolving in Hoagland solution. For heat stress, plants were transferred to a growth chamber and subjected to a temperature of 38 °C/30 °C (day/night) with 12 h light/ 12 h dark photoperiod and all other conditions remaining constant, as per the early growth stage. Plants were subjected to 100 mM ABA for the exogenous abscisic acid (ABA) application. Collection of plant leaf samples was performed in time frames of 0 h, 6 h, 12 h, 24 h, 48 h and 72 h after each stress application with three biological replications. Plant leaf samples were collected into a 1.5 mL tube using a pair of surgical scissors, which were intermittently cleaned with ethanol after every stress sample collection to avoid contamination. Approximately 1 g of collected leaves was quickly frozen using liquid nitrogen and stored in a freezer at −80 °C.

4.5. RNA Isolation, cDNA Synthesis and Quantitative Real-Time PCR Expression Analysis

For all RNAs isolated from leaf samples, HiPure Plant RNA Mini Kit (Magen Biotech Co. Ltd., Guangzhou, China) was used following the manufacturer’s protocol. A Nanodrop ND-2000 spectrophotometer (Nano-Drop Technologies, Wilmington, DE, USA) was used to determine RNA concentration, purity, and integrity, followed by 1% agarose gel electrophoresis. M5 Super plus qPCR RT kit with gDNA remover (Mei5 Biotechnology, Co., Ltd. Beijing, China) were used for the RNA reverse transcript. The qRT-PCR technique was used to validate the expression of LpHSP90 genes in the various stress treatments and the specific primers obtained as designed by Premier 3.0 (Table 2). A 10 µL mixture was prepared for each sample, containing 5 μL of abm® EvaGreen 2X qPCR Master Mix (Applied Biological Materials Inc, Richmond, Canada), 1.5 μL of synthesized cDNA product, 0.3 μL of each primer and 2.9 μL of ddH2O. The qRT-PCR reaction protocols were as follows: an enzyme activation step at 95 °C for 10 min with 1 cycle, denaturation at 95 °C for 15 s, and anneal/ extension at 60 °C for 60 s, for a total of 35 cycles. Technical samples and biological samples were used for all qRT-PCRs. Three biological replicates and technical repeats were used for each gene. The relative gene expression level was analyzed according to the 2−ΔΔCt method [77].

5. Conclusions

This study was conducted to identify the Hsp90 gene family in perennial ryegrass; hence, a genome-wide identification and expression analysis of the LpHsp90 gene family was performed. Additionally, the gene structure, conserved motif, evolutionary relationships and expression patterns were studied. Eight Hsp90 proteins were identified within the perennial ryegrass whole genome and were named according to their locations on the chromosomes. The sub-cellular localization of LpHsp90 proteins indicated that they are mostly cytoplasmic. Two pairs of LpHsp90 paralogous genes were identified (LpHsp90-7 and LpHsp90-8, LpHsp90-3 and LpHsp90-5) along with three orthologous gene pairs (Bd4g06370 and LpHsp90-4, Bd1g30130 and LpHsp90-6, Bd4g32941 and LpHsp90-2). Expression pattens indicated that LpHsp90-7, LpHs90-5, LpHs90-3 and LpHsp90-1 were highly expressed under various stresses. LpHsp90 proteins were generally highly expressed under heat stress and weakly under Cr stress. The functions of LpHsp90 proteins remain unknown, and further studies are needed to determine their precise functions. This study provides a basis for future comprehensive studies on the functional analysis of LpHsp90 proteins. Additionally, treatments such as MeJA and gibberellic acid would be of great interest in the experimental design and should be considered in future studies because they are important cellular regulators.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/plants10112509/s1, Table S1: Analysis of cis-acting element of LpHsp90 genes in perennial ryegrass. Figure S1: Unrooted phylogenetic tree of 8(eight) LpHsp90 proteins with annotated functions. The green color represented Hsp90 proteins in Arabidopsis thaliana, red for Oryza sativa, violet for Brachypodium distachyon and blue for Lolium perenne. Figure S2: Details of motif logo and consensus. Figure S3: Amino acid sequence alignment of 8(eight) LpHsp90 and the location of the C-terminal EEVD motif predicted. Figure S4: Heatmap showing the expression pattern of tested LpHsp90 genes of perennial ryegrass under (a) heat (b) NaCl (c) Cd (d) ABA (e) PEG treatment respectively. The color scale indicates expression values normalized by TB tools formula.

Author Contributions

Funding acquisition and experiment design, G.N. and J.Z.; data curation, C.A., Z.-F.Y., W.-Z.X. and Y.-Q.Z.; writing—original draft, G.N., Y.W., C.A. and J.H.; writing—review and editing, G.N. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Agricultural Science and Technology Achievement Transformation Project in Sichuan Province (21NZZH0035), China Agriculture Research System of MOF and MARA, and the Funding of Outstanding Papers Promotion Project for Financial Innovation in Sichuan Province (2018LWJJ-013).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Xu, Y.; Wang, J.; Bonos, S.A.; Meyer, W.A.; Huang, B. Candidate Genes and Molecular Markers Correlated to Physiological Traits for Heat Tolerance in Fine Fescue Cultivars. Int. J. Mol. Sci. 2018, 19, 116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Huang, B.; Dacosta, M.; Jiang, Y. Research advances in mechanisms of turfgrass tolerance to abiotic stresses: From physiology to molecular biology. Crit. Rev. Plant Sci. 2014, 3, 141–189. [Google Scholar] [CrossRef]
  3. Huang, L.; Yan, H.; Jiang, X.; Yin, G.; Zhang, X.; Qi, X.; Zhang, Y.; Yan, Y.; Ma, X.; Peng, Y. Identification of candidate reference genes in perennial ryegrass for quantitative RT-PCR under various abiotic stress conditions. PLoS ONE 2014, 9, e93724. [Google Scholar]
  4. Holmes, W.; Robson, M.J.; Parsons, A.J.; Williams, T.E.; Gill, M.; Beever, D.E.; Osbourn, D.F.; Murdoch, J.C.; Nix, J.S.; Green, B.H. Grass: Its production and utilization. N. Z. J. Agric. Res. 2010, 33, 351. [Google Scholar]
  5. Wang, W.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2004, 9, 244–252. [Google Scholar] [CrossRef]
  6. Nakashima, K.; Yamaguchi-Shinozaki, K. Regulons involved in osmotic stress-responsive and cold stress-responsive gene expression in plants. Physiol. Plant. 2006, 126, 62–71. [Google Scholar] [CrossRef]
  7. Chaves, M.M.; Maroco, J.P.; Pereira, J.S. Understanding plant responses to drought—From genes to the whole plant. Funct. Plant Biol. 2003, 30, 239–264. [Google Scholar] [CrossRef]
  8. Bailey-Serres, J.; Voesenek, L. Flooding stress: Acclimations and genetic diversity. Annu. Rev. Plant Biol. 2008, 59, 313–339. [Google Scholar] [CrossRef] [Green Version]
  9. Norris, I.B. Relationships between growth and measured weather factors among contrasting varieties of Lolium, Dactylis and Festuca species. Grass Forage Sci. 2010, 40, 151–159. [Google Scholar] [CrossRef]
  10. Ollerenshaw, J.H. Influence of waterlogging on the emergence and growth of Lolium perenne L. shoots from seed coated with calcium peroxide. Plant Soil 1985, 85, 131–141. [Google Scholar] [CrossRef]
  11. Pearson, A.; Cogan, N.O.I.; Baillie, R.C.; Hand, M.L.; Bandaranayake, C.K.; Erb, S.; Wang, J.; Kearney, G.A.; Gendall, A.R.; Smithet, K.F. Identification of QTLs for morphological traits influencing waterlogging tolerance in perennial ryegrass (Lolium perenne L.). Theor. Appl. Genet. 2011, 122, 609–622. [Google Scholar] [CrossRef]
  12. Xiong, Y.; Fei, S.Z.; Arora, R.; Brummer, E.C.; Warnke, S.E. Identification of quantitative trait loci controlling winter hardiness in an annual x perennial ryegrass interspecific hybrid population. Mol. Breed. 2007, 19, 125–136. [Google Scholar] [CrossRef]
  13. Queitsch, C.; Sangster, T.A.; Lindquist, S. Hsp90 as a capacitor of phenotypic variation. Nature 2002, 417, 618–624. [Google Scholar] [CrossRef]
  14. Robert, J. Evolution of heat shock protein and immunity. Dev. Comp. Immunol. 2003, 27, 449–464. [Google Scholar] [CrossRef]
  15. Hsu, A.L.; Murphy, C.T.; Kenyon, C. Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science 2003, 300, 1142–1145. [Google Scholar] [CrossRef] [Green Version]
  16. Krishna, P. Plant responses to heat stress. In Plant Responses to Abiotic Stress; Topics in Current Genetics; Springer: Berlin/Heidelberg, Germany, 2003; Volume 4, pp. 73–101. [Google Scholar]
  17. Czar, M.J.; Galigniana, M.D.; Silverstein, A.M.; Pratt, W.B. Geldanamycin, a Heat Shock Protein 90-Binding Benzoquinone Ansamycin, Inhibits Steroid-Dependent Translocation of the Glucocorticoid Receptor from the Cytoplasm to the Nucleus. Biochemistry 1997, 36, 7776–7785. [Google Scholar] [CrossRef]
  18. Pratt, W.B.; Krishna, P.; Olsen, L.J. Hsp90-binding immunophilins in plants: The protein movers. Trends Plant Sci. 2001, 6, 54–58. [Google Scholar] [CrossRef]
  19. Lindquist, S. The Heat-Shock Response. Annu. Rev. Biochem. 1986, 55, 1151–1191. [Google Scholar] [CrossRef]
  20. Iqbal, N.; Farooq, S.; Arshad, R.; Hameed, A. Differential accumulation of high and low molecular weight heat shock proteins in basmati rice (Oryza sativa L.) cultivars. Genet. Resour. Crop. Evol. 2010, 57, 65–70. [Google Scholar] [CrossRef]
  21. Lindquist, S.; Craig, E.A. The heat-shock proteins. Annu. Rev. Genet. 1988, 22, 631–677. [Google Scholar] [CrossRef]
  22. Tapia, H.; Morano, K. Hsp90 nuclear accumulation in quiescence is linked to chaperone function and spore development in yeast. Mol. Biol. Cell 2010, 21, 63–72. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Hashemi-petroudi, S.H.; Nematzadeh, G.; Mohammadi, S.; Kuhlmann, M. Analysis of expression pattern of genome and analysis of HSP90 gene family in Aeluropus littoralis under salinity stress. J. Crop. Breed. 2019, 11, 134–143. [Google Scholar] [CrossRef]
  24. Chaudhary, R.; Baranwal, V.K.; Kumar, R.; Sircar, D.; Chauhan, H. Genome-wide identification and expression analysis of Hsp70, Hsp90, and Hsp100 heat shock protein genes in barley under stress conditions and reproductive development. Funct. Integr. Genom. 2019, 19, 1007–1022. [Google Scholar] [CrossRef] [PubMed]
  25. Chen, J.; Gao, T.; Wan, S.; Zhang, Y.; Yang, J.; Yu, Y.; Wang, W. Genome-Wide identification, classification and expression analysis of the HSP gene superfamily in tea plant (Camellia sinensis). Int. J. Mol. Sci. 2018, 19, 2633. [Google Scholar] [CrossRef] [Green Version]
  26. Zhang, K.; He, S.; Sui, Y.; Gao, Q.; Jia, S.; Lu, X.; Jia, L. Genome-Wide Characterization of HSP90 Gene Family in Cucumber and Their Potential Roles in Response to Abiotic and Biotic Stresses. Front. Genet. 2021, 12, 584886. [Google Scholar] [CrossRef]
  27. Zhang, Z.; Quick, M.K.; Kanelakis, K.C.; Gijzen, M.; Krishna, P. Characterization of a plant homolog of hop, a cochaperone of hsp90. Plant Physiol. 2003, 131, 525–535. [Google Scholar] [CrossRef] [Green Version]
  28. Yamano, T.; Mizukami, S.; Murata, S.; Chiba, T.; Tanaka, K.; Udono, H. Hsp90-mediated assembly of the 26 S proteasome is involved in major histocompatibility complex class I antigen processing. J. Biol. Chem. 2008, 283, 28060–28065. [Google Scholar] [CrossRef] [Green Version]
  29. Feng, J.; Fan, P.; Jiang, P.; Lv, S.; Chen, X.; Li, Y. Chloroplast targeted Hsp90 plays essential roles in plastid development and embryogenesis in Arabidopsis possibly linking with VIPP1. Physiol. Plant. 2014, 150, 292–307. [Google Scholar] [CrossRef]
  30. Oh, S.E.; Yeung, C.; Babaei-Rad, R.; Zhao, R. Cosuppression of the chloroplast localized molecular chaperone HSP90.5 impairs plant development and chloroplast biogenesis in Arabidopsis. BMC Res. Notes 2014, 7, 643. [Google Scholar] [CrossRef] [Green Version]
  31. Reddy, R.K.; Chaudhary, S.; Patil, P.; Krishna, P. The 90 kDa heat shock protein (hsp90) is expressed throughout Brassica napus seed development and germination. Plant Sci. 1998, 131, 131–137. [Google Scholar] [CrossRef]
  32. Sable, A.; Rai, K.M.; Choudhary, A.; Yadav, V.K.; Agarwal, S.K.; Sawant, S.V. Inhibition of heat shock proteins HSP90 and HSP70 induce oxidative stress, suppressing cotton fiber development. Sci. Rep. 2018, 8, 3620. [Google Scholar] [CrossRef]
  33. Hoffmann, T.; Hovemann, B. Heat-shock proteins, Hsp84 and Hsp86, of mice and men: Two related genes encode formerly identified tumour-specific transplantation antigens. Gene 1988, 74, 491–501. [Google Scholar] [CrossRef]
  34. Rebbe, N.F.; Ware, J.; Bertina, R.M.; Modrich, P.; Stafford, D.W. Nucleotide sequence of a cDNA for a member of the human 90-kDa heat-shock protein family. Gene 1987, 53, 235–245. [Google Scholar] [CrossRef]
  35. Krone, P.H.; Sass, J.B. Hsp 90α and Hsp 90β genes are present in the zebrafish and are differentially regulated in developing embryos. Biochem. Biophys. Res. Commun. 1994, 204, 746–752. [Google Scholar] [CrossRef]
  36. Chen, B.; Zhong, D.; Monteiro, A. Comparative genomics and evolution of the HSP90 family of genes across all kingdoms of organisms. BMC Genom. 2006, 7, 156. [Google Scholar] [CrossRef] [Green Version]
  37. Song, H.; Fan, P.; Li, Y. Overexpression of organellar and cytosolic AtHSP90 in Arabidopsis thaliana impairs plant tolerance to oxidative stress. Plant Mol. Biol. Rep. 2009, 27, 342–349. [Google Scholar] [CrossRef]
  38. Hu, W.; Hu, G.; Han, B. Genome-wide survey and expression profiling of heat shock proteins and heat shock factors revealed overlapped and stress specific response under abiotic stresses in rice. Plant Sci. 2009, 176, 583–590. [Google Scholar] [CrossRef]
  39. Krishna, P.; Gloor, G. The Hsp90 family of proteins in Arabidopsis thaliana. Cell Stress Chaperones 2001, 6, 238–246. [Google Scholar] [CrossRef]
  40. Yang, X.; Zhu, W.; Zhang, H.; Liu, N.; Tian, S. Heat shock factors in tomatoes: Genome-wide identification, phylogenetic analysis and expression profiling under development and heat stress. PeerJ 2016, 4, e1961. [Google Scholar] [CrossRef] [Green Version]
  41. Yamada, K.; Fukao, Y.; Hayashi, M.; Fukazawa, M.; Nishimura, M. Cytosolic HSP90 regulates the heat shock response that is responsible for heat acclimation in Arabidopsis thaliana. J. Biol. Chem. 2007, 282, 37794–37804. [Google Scholar] [CrossRef] [Green Version]
  42. McLellan, C.A.; Turbyville, T.J.; Wijeratne, E.M.K.; Kerschen, A.; Vierling, E.; Queitsch, C.; Whitesell, L.; Gunatilaka, A.A.L. A rhizosphere fungus enhances Arabidopsis thermotolerance through production of an HSP90 inhibitor. Plant Physiol. 2007, 145, 174–182. [Google Scholar] [CrossRef]
  43. Takahashi, A.; Casais, C.; Ichimura, K.; Shirasu, K. HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc. Natl. Acad. Sci. USA 2003, 100, 11777–11782. [Google Scholar] [CrossRef] [Green Version]
  44. Liu, Y.; Burch-Smith, T.; Schiff, M.; Feng, S.; Dinesh-Kumar, S.P. Molecular chaperone Hsp90 associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an innate immune response in plants. J. Biol. Chem. 2004, 279, 2101–2108. [Google Scholar] [CrossRef]
  45. Tominaga, H.; Coury, D.A.; Amano, H.; Miki, W.; Kakinuma, M. cDNA cloning and expression analysis of two heat shock protein genes, Hsp90 and Hsp60, from a sterile Ulva pertusa (Ulvales, Chlorophyta). Fish. Sci. 2012, 78, 415–429. [Google Scholar] [CrossRef]
  46. Sołtys-Kalina, D.; Szajko, K.; Sierocka, I.; Śliwka, J.; Strzelczyk-Żyta, D.; Wasilewicz-Flis, I.; Jakuczun, H.; Szweykowska-Kulinska, Z.; Marczewski, W. Novel candidate genes AuxRP and Hsp90 influence the chip color of potato tubers. Mol. Breed. 2015, 35, 224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Manchado, M.; Salas-Leiton, E.; Infante, C.; Ponce, M.; Asensio, E.; Crespo, A.; Zuasti, E.; Cañavate, J.P. Molecular characterization, gene expression and transcriptional regulation of cytosolic Hsp90s in the flatfish Senegalese sole (Solea senegalensis Kaup). Gene 2008, 416, 77–84. [Google Scholar] [CrossRef] [PubMed]
  48. Galea-Lauri, J.; Latchman, D.S.; Katz, D.R. The role of the 90-kDa heat shock protein in cell cycle control and differentiation of the monoblastoid cell line U937. Exp. Cell Res. 1996, 226, 243–254. [Google Scholar] [CrossRef] [PubMed]
  49. Zhang, H.; Li, L.; Ye, T.; Chen, R.; Gao, X.; Xu, Z. Molecular characterization, expression pattern and function analysis of the OsHSP90 family in rice. Biotechnol. Biotechnol. Equip. 2016, 30, 669–676. [Google Scholar] [CrossRef] [Green Version]
  50. Bai, J.; Pennill, L.A.; Ning, J.; Lee, S.W.; Ramalingam, J.; Webb, C.A.; Zhao, B.; Sun, Q.; Nelson, J.C.; Leach, J.E.; et al. Diversity in nucleotide binding site-leucine-rich repeat genes in cereals. Genome Res. 2002, 12, 1871–1884. [Google Scholar] [CrossRef] [Green Version]
  51. Han, Y.; Chen, Y.; Yin, S.; Zhang, M.; Wang, W. Over-expression of TaEXPB23, a wheat expansin gene, improves oxidative stress tolerance in transgenic tobacco plants. J. Plant Physiol. 2015, 173, 62–71. [Google Scholar] [CrossRef]
  52. Chory, J.; Wu, D. Weaving the Complex Web of Signal Transduction. Plant Physiol. 2001, 125, 77–80. [Google Scholar] [CrossRef] [Green Version]
  53. Mach, J. Alternative splicing produces a JAZ protein that is not broken down in response to jasmonic acid. Plant Cell 2009, 21, 14. [Google Scholar] [CrossRef] [Green Version]
  54. Al-Whaibi, M.H. Plant heat-shock proteins: A mini review. J. King Saud Univ. Sci. 2011, 23, 139–150. [Google Scholar] [CrossRef] [Green Version]
  55. Genest, O.; Wickner, S.; Doyle, S.M. Hsp90 and Hsp70 chaperones: Collaborators in protein remodeling. J. Biol. Chem. 2019, 294, 2109–2120. [Google Scholar] [CrossRef] [Green Version]
  56. Milioni, D.; Hatzopoulos, P. Genomic organization of Hsp90 gene family in Arabidopsis. Plant Mol. Biol. 1997, 35, 955–961. [Google Scholar] [CrossRef]
  57. Ritossa, F. A new puffing pattern induced by temperature shock and DNP in drosophila. Experientia 1962, 18, 571–573. [Google Scholar] [CrossRef]
  58. Cha, J.; Ahn, G.; Kim, J.Y.; Kang, S.B.; Kim, M.R.; Su’udi, M.; Kim, W.Y.; Son, D. Structural and functional differences of cytosolic 90-kDa heat-shock proteins (Hsp90s) in Arabidopsis thaliana. Plant Physiol. Biochem. 2013, 70, 368–373. [Google Scholar] [CrossRef] [Green Version]
  59. Jackson, S.E.; Queitsch, C.; Toft, D. Hsp90: From structure to phenotype. Nat. Struct. Mol. Biol. 2004, 11, 1152–1155. [Google Scholar] [CrossRef]
  60. Shinozaki, F.; Minami, M.; Chiba, T.; Suzuki, M.; Yoshimatsu, K.; Ichikawa, Y.; Terasawa, K.; Emori, Y.; Matsumoto, K.; Kurosaki, T.; et al. Depletion of hsp90beta induces multiple defects in B cell receptor signaling. J. Biol. Chem. 2006, 281, 16361–16369. [Google Scholar] [CrossRef] [Green Version]
  61. Rehn, A.; Moroni, E.; Zierer, B.K.; Tippel, F.; Morra, G.; John, C.; Richter, K.; Colombo, G.; Buchner, J. Allosteric Regulation Points Control the Conformational Dynamics of the Molecular Chaperone Hsp90. J. Mol. Biol. 2016, 428, 4559–4571. [Google Scholar] [CrossRef]
  62. Zhang, J.; Li, J.; Liu, B.; Zhang, L.; Chen, J.; Lu, M. Genome-wide analysis of the Populus Hsp90 gene family reveals differential expression patterns, localization, and heat stress responses. BMC Genom. 2013, 14, 532. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Song, Z.; Pan, F.; Yang, C.; Jia, H.; Jiang, H.; He, F.; Li, N.; Lu, X.; Zhang, H. Genome-wide identification and expression analysis of HSP90 gene family in Nicotiana tabacum. BMC Genet. 2019, 20, 35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Zai, W.S.; Miao, L.X.; Xiong, Z.L.; Zhang, H.L.; Ma, Y.R.; Li, Y.L.; Chen, Y.B.; Ye, S.G. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum. Genet. Mol. Res. 2015, 14, 7811–7820. [Google Scholar] [CrossRef] [PubMed]
  65. Kawahara, Y.; de la Bastide, M.; Hamilton, J.P.; Kanamori, H.; McCombie, W.R.; Ouyang, S.; Schwartz, D.C.; Tanaka, T.; Wu, J.; Zhou, S.; et al. Improvement of the Oryza sativa Nipponbare reference genome using next generation sequence and optical map data. Rice 2013, 6, 4. [Google Scholar] [CrossRef] [Green Version]
  66. Liu, Y.; Wan, H.; Yang, Y.; Wei, Y.; Li, Z.; Ye, Q.; Wang, R.; Ruan, M.; Yao, Z.; Zhou, G. Genome-wide identification and analysis of heat shock protein 90 in tomato. Yi Chuan 2014, 36, 1043–1052. [Google Scholar]
  67. Jain, M.; Tyagi, A.K.; Khurana, J.P. Genome-wide analysis, evolutionary expansion, and expression of early auxin-responsive SAUR gene family in rice (Oryza sativa). Genomics 2006, 88, 360–371. [Google Scholar] [CrossRef] [Green Version]
  68. Skolnick, J.; Fetrow, J.S. From genes to protein structure and function: Novel applications of computational approaches in the genomic era. Trends Biotechnol. 2000, 18, 34–39. [Google Scholar] [CrossRef]
  69. Singh, R.K.; Lee, J.K.; Selvaraj, C.; Singh, R.; Li, J.; Kim, S.Y.; Kalia, V.C. Protein Engineering Approaches in the Post-Genomic Era. Curr. Protein Pept. Sci. 2018, 19, 5–15. [Google Scholar] [CrossRef]
  70. Jin, Z.; Chandrasekaran, U.; Liu, A. Genome-wide analysis of the Dof transcription factors in castor bean (Ricinus communis L.). Genes Genom. 2014, 36, 527–537. [Google Scholar] [CrossRef]
  71. Byrne, S.L.; Nagy, I.; Pfeifer, M.; Armstead, I.; Asp, T. A synteny-based draft genome sequence of the forage grass Lolium perenne. Plant J. 2015, 84, 816–826. [Google Scholar] [CrossRef]
  72. Larkin, M.A. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Green Version]
  73. Guidon, S.; Gascuel, O. A simple, fast and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 2003, 52, 696–704. [Google Scholar] [CrossRef] [Green Version]
  74. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Green Version]
  75. Hu, B.; Jin, J.; Guo, A.Y.; Zhang, H.; Luo, J.; Gao, G. GSDS 2.0: An upgraded gene feature visualization server. Bioinformatics 2014, 31, 1296–1297. [Google Scholar] [CrossRef] [Green Version]
  76. Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37, W202–W208. [Google Scholar] [CrossRef]
  77. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
Plants 10 02509 g001 550
Figure 1. Unrooted phylogenetic tree representing relationships among the Hsp90 protein sequences of Lolium perenne, Arabidopsis thaliana, Brachypodium distachyon and Oryza sativa. The tree was divided into two main groups (I and II) and further divided into subgroups (Ia, Ib, Iia and Iib). Ia had 4 members, and Ib had 8 members; Iia had 4 members and Iib had 15 members.
Figure 1. Unrooted phylogenetic tree representing relationships among the Hsp90 protein sequences of Lolium perenne, Arabidopsis thaliana, Brachypodium distachyon and Oryza sativa. The tree was divided into two main groups (I and II) and further divided into subgroups (Ia, Ib, Iia and Iib). Ia had 4 members, and Ib had 8 members; Iia had 4 members and Iib had 15 members.
Plants 10 02509 g001
Plants 10 02509 g002 550
Figure 2. Phylogenetic relationship, gene structure and motif composition of Hsp90 genes in perennial ryegrass. (a) A multiple sequence alignment of the full length of LpHsp90 protein sequences was executed using Clustal W, and a maximum-likelihood phylogenetic tree with 1000 bootstraps was constructed using MEGA 6.0 software. The four subgroups were marked with different colors. (b) Schematic representation of the conserved motifs obtained using MEME online tool in LpHsp90 proteins. Different motifs are represented by colored boxes of corresponding colors. The grey lines represent the non-conserved. (c) The exon/intron structure of the LpHsp90 protein sequences was obtained employing the online tool GSDS.
Figure 2. Phylogenetic relationship, gene structure and motif composition of Hsp90 genes in perennial ryegrass. (a) A multiple sequence alignment of the full length of LpHsp90 protein sequences was executed using Clustal W, and a maximum-likelihood phylogenetic tree with 1000 bootstraps was constructed using MEGA 6.0 software. The four subgroups were marked with different colors. (b) Schematic representation of the conserved motifs obtained using MEME online tool in LpHsp90 proteins. Different motifs are represented by colored boxes of corresponding colors. The grey lines represent the non-conserved. (c) The exon/intron structure of the LpHsp90 protein sequences was obtained employing the online tool GSDS.
Plants 10 02509 g002
Plants 10 02509 g003 550
Figure 3. Expression patterns of LpHsp90s in response to heat. The values are the mean values of expression (n = 3).
Figure 3. Expression patterns of LpHsp90s in response to heat. The values are the mean values of expression (n = 3).
Plants 10 02509 g003
Plants 10 02509 g004 550
Figure 4. Expression patterns of LpHsp90s in response to (a) NaCl (b) PEG and (c) ABA treatment. The values are the mean values of expression (n = 3).
Figure 4. Expression patterns of LpHsp90s in response to (a) NaCl (b) PEG and (c) ABA treatment. The values are the mean values of expression (n = 3).
Plants 10 02509 g004
Plants 10 02509 g005 550
Figure 5. Expression patterns of LpHsp90s in response to (a) Cd and (b) Cr treatment. The values are the mean values of expression (n = 3).
Figure 5. Expression patterns of LpHsp90s in response to (a) Cd and (b) Cr treatment. The values are the mean values of expression (n = 3).
Plants 10 02509 g005
Table
Table 1. The biophysical characteristics and subcellular localization of Lphsp90 proteins.
Table 1. The biophysical characteristics and subcellular localization of Lphsp90 proteins.
GeneMolecular WeightTheoretical pINumber of Amino AcidsInstability IndexPredicted Sub-Cellular Location
LpHsp90-180,409.244.9670041.43Cytoplasmic
LpHsp90-289,044.85.1978743.15Cytoplasmic
LpHsp90-380,947.924.9571040.22Cytoplasmic
LpHsp90-496,712.155.5786243.84Nuclear
LpHsp90-561,214.615.0852844.14Cytoplasmic
LpHsp90-692,834.854.8980937.71Endoplasmic reticulum
LpHsp90-788,305.634.977947.45Cytoplasmic
LpHsp90-888,305.634.977947.4Cytoplasmic
Table
Table 2. Primer information for LpHsp90 genes.
Table 2. Primer information for LpHsp90 genes.
GeneForward-Primer (5′-3′)Reverse-Primer (5′-3′)
Lphsp90-1ATCGTCTCTGACCGTGTTGTAAGCATCACCAGGTCCTTGA
Lphsp90-2GCACACTTCACAACAGAGGGCTCGCCATCAAAGTCATCCG
Lphsp90-3CATCATGGACAACTGCGAGGGGCGTAGTCCTCCTTGTTCT
Lphsp90-4AGGAGGTGTTTCTTCGGGAGTGCAATGGTCCCAAGAGAGT
Lphsp90-5TCGGAGTTCATCAGCTACCCGCTCACCTCCTTCACCTTCT
Lphsp90-6GCAAGGACTCGAAGCTCAAGTTGATCTCCAGGACACGCTT
Lphsp90-7GCCAATTGATGAGGTTGCCATCGCAGACCAACCAAACTTG
Lphsp90-8GCGGAGGAGAAGTTCGAGTACATCCCAATGCCAGTGTCAG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Appiah, C.; Yang, Z.-F.; He, J.; Wang, Y.; Zhou, J.; Xu, W.-Z.; Nie, G.; Zhu, Y.-Q. Genome-Wide Identification of Hsp90 Gene Family in Perennial Ryegrass and Expression Analysis under Various Abiotic Stresses. Plants 2021, 10, 2509. https://doi.org/10.3390/plants10112509

AMA Style

Appiah C, Yang Z-F, He J, Wang Y, Zhou J, Xu W-Z, Nie G, Zhu Y-Q. Genome-Wide Identification of Hsp90 Gene Family in Perennial Ryegrass and Expression Analysis under Various Abiotic Stresses. Plants. 2021; 10(11):2509. https://doi.org/10.3390/plants10112509

Chicago/Turabian Style

Appiah, Charlotte, Zhong-Fu Yang, Jie He, Yang Wang, Jie Zhou, Wen-Zhi Xu, Gang Nie, and Yong-Qun Zhu. 2021. "Genome-Wide Identification of Hsp90 Gene Family in Perennial Ryegrass and Expression Analysis under Various Abiotic Stresses" Plants 10, no. 11: 2509. https://doi.org/10.3390/plants10112509

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop