Next Article in Journal
In-Site and Ex-Site Date Palm Exposure to Heavy Metals Involved Infra-Individual Biomarkers Upregulation
Previous Article in Journal
Phytotoxic Potential and Phenolic Profile of Extracts from Scrophularia striata
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 10
Issue 1
10.3390/plants10010136
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

DnaJ Proteins Regulate WUS Expression in Shoot Apical Meristem of Arabidopsis

by
Tianqi Jia
,
Fan Li
,
Shuang Liu
,
Jin Dou
and
Tao Huang
*
School of Life Sciences, Xiamen University, Xiamen 361102, China
*
Author to whom correspondence should be addressed.
Plants 2021, 10(1), 136; https://doi.org/10.3390/plants10010136
Submission received: 17 November 2020 / Revised: 10 December 2020 / Accepted: 31 December 2020 / Published: 12 January 2021
(This article belongs to the Section Plant Development and Morphogenesis)
Browse Figures
Versions Notes

Abstract

:
WUSCHEL (WUS) protein regulates stem cell function in shoot apical meristem of Arabidopsis. The expression of WUS gene is strictly regulated by developmental cues and environmental factors. As DnaJ domain-containing proteins, SDJ1 and SDJ3 have been proven to play an important role in transcriptional activation of promoter methylated genes. Here, we showed that three DnaJ domain-containing proteins including SDJ1 and SDJ3 can bind WUS protein as a complex, which further maintain the expression of WUS gene by binding to WUS promoter. We propose a model how DnaJ domain-containing proteins are involved in the self-regulation of WUS gene in stem cells maintenance of Arabidopsis.

Graphical Abstract

1. Introduction

The continual propagation and differentiation of stem cells provide a basis for the postembryonic growth and development of plants. The stem cells in shoot apical meristem (SAM) of Arabidopsis are defined by the homeodomain proteins WUSCHEL (WUS), which is expressed in the organization center (OC). WUS protein can move to stem cell region where it can activate downstream gene CLVATA3, which conversely inhibit WUS expression, thereby maintaining stem cell homeostasis in SAM [1,2,3].
Previous studies have demonstrated that abiotic stresses can induce the accumulation of heat shock proteins (HSPs) at different molecular weights [4,5]. As a subfamily of heat shock protein, HSP40s are characteristic of the conserved DnaJ-domain that is responsible for interaction with HSP70s [6,7,8]. HSP40s can be divided into seven subfamilies according to the containing J-domains in Arabidopsis. DnaJA, DnaJB, and DnaJC subfamilies contain a typical J-domain that interacts with HSP70 proteins [9]. DnaJD, DnaJE, DnaJF, and DnaJG proteins are HSP70-independ because of the lacking of a typical J-domain [8,10,11]. HSP40/DnaJ-proteins are involved in the protein homeostasis by regulating protein folding/refolding, assembly, translocation, and stabilization under abiotic stress [10,12,13]. Previous researches have demonstrated the crucial roles of DnaJ-proteins in growth and development, hormone regulation, and acclimation of plants to abiotic stress [14,15,16,17,18,19]. As two members of DnaJD subfamily, SDJ1 and SDJ3 have been shown to interact with SUVH1 or SUVH3 protein as a SUVH-SDJ complex, which further mediates the transcriptional activation of promoter methylated genes [20,21]. SDJ1 protein also has been shown to be involved in flowering time control of Arabidopsis [18]. In this work, we showed that SDJ1 and SDJ3 proteins also interact with WUS protein as a complex which further regulate WUS expression by binding to WUS promoter.

2. Results and Discussion

2.1. WUS Interacts with DnaJ Proteins In Vivo and In Vitro

When we used WUS protein as a bait to screen binding proteins from an Arabidopsis library by yeast-two-hybrid, one DnaJ-domain protein encoded by At1g62970 was identified as a possible WUS-binding protein, which was already named as SDJ3. There are another two DnaJ-domain containing proteins encoded by At5g64360 and At5g09540 sharing high homologue with SDJ3 in Arabidopsis genome. The protein encoded by At5g64360 was already named as SDJ1. SDJ1 and SDJ3 also interacted with WUS protein in yeast (Figure 1a). The interactions between SDJ1/SDJ3/At5g09540 and WUS were also confirmed by bimolecular fluorescence complementation (BiFC) assays in epidermal cells of tobacco (Nicotiana benthamiana). Strong YFP fluorescence was observed in nuclei when WUS-YFPn was co-transformed with SDJ1-YFPc, SDJ3-YFPc and At5g09540-YFPc, respectively (Figure 1b). The interactions between SDJ1/At5g09540and WUS were further confirmed by in vitro pull-down assay. The glutathione S-transferase (GST)-WUS, but not GST, bound the maltose-binding protein (MBP)-fused SDJ1, and MBP-At5g09540 proteins, respectively (Figure 1c). Therefore, DnaJ proteins can bind WUS protein as a complex independent of HSP70 proteins. Interactions in planta between SDJ1/SDJ3/At5g09540 proteins and WUS were also examined using co-immunoprecipitation assays. When HA-tagged SDJ1/SDJ3/At5g09540 proteins and GFP:WUS protein were transiently expressed in the epidermal cells of tobacco leaves, GFP:WUS protein bound SDJ1, SDJ3 and At5g09540, respectively (Figure 2d–f). Taken together, the interactions between SDJ1/SDJ3/At5g09540 proteins and WUS protein were confirmed with multiple methods.

2.2. DnaJ Proteins Function as a Co-Factor of WUS in Activating WUS Expression

Previous studies demonstrated that WUS protein can bind to TAAT motif in the promoter of downstream target genes [22]. WUS promoter also contains many TAAT motifs, indicating that WUS might bind to its own promoter for self-regulation. We examined whether SDJ1/SDJ3/At5g09540 proteins might bind to WUS promoter via interaction with WUS protein as a complex using electrophoretic mobility shift assay (EMSA). Our results showed that WUS protein can specifically bind to TAAT motif in a WUS promoter probe. The substitution of TAAT motif with CCCC abolished the binding to WUS protein to this promoter probe. WUS protein bound to its promoter more efficiently in the presence of SDJ1, SDJ3, and At5g09540 proteins, respectively (Figure 2a,b). SDJ1 and At5g09540 proteins on their own failed to bind to WUS promoter when different promoter regions were used in EMSA (Figure 2c,d). However, the binding of At5g09540 to different regions (P5–P7) of WUS promoter, but not coding region (P8), in 35Spro::HA:At5g09540 plants was confirmed using Chromatin immunoprecipitation (CHIP) assay (Figure 2e), demonstrating that At5g09540 protein can bind to WUS promoter via the interaction with endogenous WUS protein as a complex.
To confirm the direct effects of WUS-DnaJ complex on the activities of WUS promoter, dual luciferase assays were conducted in tobacco leaf epidermal cells in which WUSpro::LUC construct was transformed in combination with the expression of GFP:WUS and HA-tagged SDJ1, SDJ3, and At5g09540 proteins, respectively. The luciferase activity was dramatically increased when GFP:WUS and SDJ1/SDJ3/At5g09540 proteins were combined in comparison with GFP, GFP:WUS or SDJ1/SDJ3/At5g09540 proteins alone (Figure 2f–i). These results demonstrated a positive role of WUS-SDJ1/SDJ3/At5g09540 complex in WUS promoter activity.

2.3. Disruption of DnaJ Proteins by Chimeric Repressor Silencing Technology Led to Premature Termination of SAM

A transcriptional activator can be converted into a strong repressor by fusion with the ERF-associated amphiphilic repression (EAR) motif repression domain (SRDX), which then specifically suppress the expression of target genes by binding to their promoters [23,24,25]. This designated chimeric repressor gene silencing technology (CRES-T) can also be used to examine the protein–protein interactions and protein functions in growth and development of plants [26]. The 35Spro::SDJ1-SRDX, 35Spro::SDJ3-SRDX and 35Spro::At5g09540-SRDX transgenic plants were also created to examine the role of SDJ1/SDJ3/At5g09540 proteins in WUS expression and stem cell maintenance in planta. The strong 35Spro::SDJ3-SRDX lines produced an umbrella structures on the top end of shoot, which is similar to the typical phenotype of wus mutant. The 35Spro::SDJ1-SRDX plants and 35Spro::At5g09540-SRDX plants also showed the premature termination of SAM (Figure 3a–f). GUS staining showed that the WUS promoter activity is significantly repressed in the SAM of 35Spro::SDJ1-SRDX WUSpro::GFP:GUS plants (Figure 3g,h). Taken together, SDJ1/SDJ3/At5g09540 proteins can interact with WUS as a complex which further regulate the expression of WUS gene by binding to WUS promoter.

2.4. SDJ1 and SDJ3 Genes are Expressed in the SAM, RAM and Vascular Tissues of Leaf and Hypocotyl

To examine the expression pattern of SDJ1 and SDJ3 genes, gSDJ3::GFP:GUS and gSDJ1::GFP:GUS transgenic plants were created to express SDJ3:GFP:GUS and SDJ1:GFP:GUS fusion proteins, respectively, under the control of their own promoters (Figure 4a and Figure 5a). The expression of SDJ3:GFP:GUS protein was only detected at mature stage during embryogenesis (Figure 4b–e). However, SDJ1:GFP:GUS protein was already expressed from globular stage during embryogenesis (Figure 5b–e). After germination, GUS staining showed that SDJ3:GFP:GUS protein and SDJ1:GFP:GUS protein are mainly expressed in SAM, RAM and vascular tissues of leaf and hypocotyl, as well as younger but not fully differentiated leaves (Figure 4f–o and Figure 5f–o). In addition, SDJ1/SDJ3/At5g09540 in fusion with GFP protein was transiently expressed and located in nucleus of tobacco epidermal cells (Figure 6).

2.5. DnaJ Proteins Contribute to the Expression of WUS mRNA

The binding of WUS protein to its own promoter might be necessary for keeping the normal expression level of WUS gene. To explore the roles of SDJ1/SDJ3/At5g09540 genes in growth and development of Arabidopsis, the sdj1, sdj3, and at5g09540 knockout mutants were identified by RT-PCR analysis of the relative endogenous SDJ1/SDJ3/at5g09540 expression (Figure 7a). The sdj1 sdj3 at5g09540 triple mutant was also created by genetic crossing. The sdj1 sdj3 at5g09540 mutant grew normally as WT plants under normal growth condition possibly because other redundant DNAJ domain proteins might also interact with WUS protein as a complex, which also might be involved in WUS expression (Figure 7b). Actually, the DnaJ-domain protein encoded by At4g11930 also interacted with WUS protein in BiFC analysis (Figure S1), indicating that more proteins from DnaJ-domain protein family might interact with WUS protein. WUS mRNA in three-day-old sdj1 sdj3 at5g09540 mutant was decreased to a lower level in comparison with that of WT plants, suggesting that SDJ1/SDJ3/At5g09540 proteins contribute to the expression of WUS mRNA (Figure 7c). In addition, as a downstream target of WUS protein, the expression of CLV3 was not significantly changed in sdj1 sdj3 at5g09540 mutant (Figure 7d). The inflorescence meristem morphology of sdj1 sdj3 at5g09540 mutant was not significantly altered in comparison with WT (Figure 7e,f), indicating that SAM development can tolerate a variation range of WUS expression. Taken together, DnaJ proteins can maintain WUS expression by interacting with WUS protein as a complex which further bind to WUS promoter in SAM of Arabidopsis. We also cloned ortholgues of WUS and SDJ1 from Brassica napus. The interaction between BnWUS (CDY30337) and BnSDJ1 (XP_013722826) was also confirmed in BIFC analysis (Figure S2). Therefore, DnaJ proteins might be universally employed as WUS-binding protein to regulate stem cell function in SAM in plant kingdom.

3. Materials and Methods

3.1. Plant Materials and Transformation

All constructs were introduced into Col-0 by Agrobacterium tumefaciens PMP90 strain according to the reported floral-dip protocol [27]. At least three independent transgenic lines were used for subsequent analyses. The sdj3 mutant (Salk_016979), sdj1 mutant (Salk_021078), at5g09540 mutant (SAIL_735_A07), and wus mutant (Salk_114398) were ordered from the European Arabidopsis Stock Centre. All plants were grown in soil at 22 °C under long days (16 h light/8 h dark) with white fluorescent light (120 μmol·m−2·s−1).

3.2. Plasmids Construction for Transgenic Plants

The CaMV 35S promoter in the pB7GW2 vector was replaced with the putative 5.1 Kb SDJ3 promoter (−1 bp–−5100 bp) to create pB7GW2_SDJ3pro. The SDJ3 genomic fragment (from translation start codon to stop codon) and 0.3 Kb downstream region after the coding region were cloned into the pDONR201_GFP:GUS vector to create pDONR201_gSDJ3:GFP:GUS for the in-frame fusion of the GFP:GUS with the SDJ3 gene. The gSDJ3:GFP:GUS usion gene was further cloned into pB7GW2_SDJ3pro to create the gSDJ3:GFP:GUS construct by LR clonase (Invitrogen, Carlsbad, CA, USA). gSDJ1:GFP:GUS construct containing 3.5 Kb promoter region, 1.392 Kb genomic region and 1.0 Kb downstream region was also created by the same strategy. The SDJ1, SDJ3 and At5g09540 cDNAs were amplified with XbaI (5′-end) and SpeI (3′-end) sites and cloned into pDONR201 to create pDONR201-SDJ1/SDJ3/At5g09540, respectively. The GFP cDNA was inserted at the unique XbaI site and unique SpeI site in pDONR201-SDJ1/SDJ3/At5g09540 to create the pDONR201-GFP:SDJ1/SDJ3/At5g09540, respectively. The HA tag and SRDX domain (LDLDLELRLGFA) were also cloned into the pDONR201-SDJ1/SDJ3/At5g09540 to create pDONR201_HA:SDJ1/SDJ3/At5g09540 and pDONR201_ SDJ1/SDJ3/At5g09540:SRDX, respectively. These genes harbored in the pDONR201 was further cloned into pK2GW7 to create 35Spro::GFP:SDJ1/SDJ3/At5g09540, 35Spro::HA:SDJ1/SDJ3/At5g09540 and 35Spro:: SDJ1/SDJ3/At5g09540:SRDX constructs, respectively.

3.3. Protein Purification

The WUS cDNA was cloned into pGEX vector and pMBP-c vector, respectively. SDJ1/SDJ3/At5g09540 cDNAs were also cloned into pMBP-c vector, respectively. The target proteins were expressed in E. coli BL21 with the induction of 0.25–1.0 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 9 h at 16 °C or 22 °C and purified using glutathione resin (Thermo Fisher Scientific, Waltham, MA, USA) or amylose resin (New England Bio-Labs, Ipswich, MA, USA).

3.4. Yeast Two-Hybrid Assay

WUS cDNA was cloned into pGADT7 vector. SDJ1 and SDJ3 cDNAs were cloned into pGBKT7 vector. The bait and prey vectors were transformed into Y2HGold yeast strain following the manufacturer’s instructions (Clontech, Palo Alto, CA, USA).

3.5. In Vitro Pull-Down Assay

MBP:SDJ1, MBP:At5g09540 and MBP were immobilized on amylose resin and incubated with GST:WUS or GST, respectively, in the reaction buffer (5% glycerol, 1% triton-100, 50 mM Tris-HCl(pH 7.4), 150 mM NaCl, 10 mM NaF, 1 mM Na3VO4, 10 mM leupeptin, 1 mM phenylmethylsulfonyl fluoride (PMSF)) for 2 h at 4 °C with rotation. The amylose resin was then washed three times and subjected to immunoblot analysis to detect the precipitated GST:WUS protein using an anti-GST antibody (Cell signaling Technology, Shanghai, China). All pull-down assays were repeated three times with the similar results.

3.6. Bimolecular Fluorescence Complementation (BiFC) Assays

Full-length Arabidopsis WUS and Brassica napus WUS were cloned into p2YN vector containing N-terminal half of YFP to generate the fusion proteins of WUS-YFPn and BnWUS-YFPn, respectively. SDJ1, SDJ3, At5g09540, At4g11930 and BnSDJ1 cDNAs were cloned into p2YC vector containing C-terminal half of YFP to produce the fusion proteins of SDJ1-YFPc, SDJ3-YFPc, At5g09540-YFPc, At4g11930-YFPc, and BnSDJ1-YFPc, respectively. These constructs together with 35Spro::Coilin:RFP were introduced into Nicotiana benthamiana leaves through Agrobacterium infiltration so that Coilin-RFP protein can be localized at nucleus. Each BiFC experiment was repeated with four independent biological replicates. YFP fluorescence and RFP fluorescence were recorded using a confocal laser scanning microscope (Zeiss LSM 780) with excitation/emission values of 513 nm/495–545 nm and 561 nm/578–636 nm, respectively.

3.7. Co-Immunoprecipitation

35Spro::GFP and 35Spro::GFP:WUS in combination with 35Spro::HA:SDJ3, 35Spro::HA:SDJ1, or 35Spro::HA:At5g09540 were introduced into Nicotiana benthamiana leaves through Agrobacterium infiltration to examine the interactions of GFP:WUS with HA:SDJ3, HA:SDJ1 and HA:At5g09540, respectively. The leaves were harvested two days after infiltration and frozen in liquid nitrogen for the isolation of nuclei. The isolated nuclei were lysed with reaction buffer (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1%Triton X-100, 0.1 mM PMSF, 1×Protease inhibitors cocktail) by incubation on ice for 30 min. Clear lysates were mixed with diluting buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 3 mM DTT, 2 mM NaF and 1 mM NaVO3) and immunoprecipitated with GFP-Trap® agarose beads (ChromoTek). The beads were washed three times with the diluting buffer. The proteins recovered from the beads were subjected to immunoblot analysis using anti-GFP antibody (Cell Signaling Technology) or anti-HA antibody (Cell Signaling Technology).

3.8. Chromatin Immunoprecipitation (ChIP)

The 2 g of 4-day-old WT and 35Spro::HA:At5g09540 seedlings were harvested and fixed with 30 mL 1% formaldehyde under vacuum following addition of 2 mL 2M glycine to stop the crosslinking. Nuclei were isolated from tissue powder with 30 mL isolation buffer (10 mM Tris-HCl (pH 8.0), 0.4 M sucrose, 10 mM MgCl2, 5 mM 2-mercaptoethano (β-ME), 1% Triton-X100, 0.1 mM PMSF, 1×Protease inhibitors cocktail) and lysed with 300 μL lysis buffer (50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1% SDS, 0.1 mM PMSF, 1×Protease inhibitors cocktail). Chromatin was sheared to an average size of 200 bp–500 bp by sonication for total 550 s on a Covaris M220 Focused-ultrasonicator. About 10 % of sonicated chromatin was collected as Input. The residue of sonicated chromatin was diluted with 10 times volume of dilution buffer (16.7 mM Tris-HCl (pH 8.0), 1.2 mM EDTA, 167 mM NaCl, 1% Triton-X100, 0.1 mM PMSF, 1×Protease inhibitors cocktail) and precleared by incubation with 30 µL of Dynabeads® protein A (Invitrogen). Then precleared chromatin was incubated with 30 µL of Dynabeads® protein A coupled to an anti-HA antibody or anti-GFP antidody overnight at 4 °C with gentle agitation. The precipitated DNA was used as template for real-time RT-PCR analysis. The relative quantity (RQ) for each immunoprecipitated promoter region was calculated as ChIP/Input ratio. The relative quantity using Anti-HA antibody (RQHA) was normalized to the relative quantity using Anti-GFP antibody (RQGFP) as the relative enrichment of a promoter region. Four different loci in WUS promoter region were analyzed. Actin7 was also used as a negative control. The primers used for ChIP-qPCR are listed in Supplemental Table S1. All ChIP experiments were performed with four independent biological replicates.

3.9. Electrophoretic Mobility Shift Assay (EMSA)

EMSA reactions were performed in a total volume of 10 μL of binding buffer (10 mM HEPES (PH 7.8), 20 mM KCl, 1 mM MgCl2, 21 mM DTT, 7.5% Glycerol, 0.5% Triton-100, 300 ng carrier DNA, 0.02% BSA) containing WUS promoter probes, MBP:WUS and MBP: SDJ1/SDJ3/At5g09540 at 22°C for 30 min. The WUS promoter probe (CTAGAATGAATAATAAAAAAAGTGAAAACCGTTTGATCATAA) containing a TAAT motif was labeled with Texas Red at 3′end. The unlabeled probe was used for competition experiments. The probe with the TAAT motif replaced by CCCC were used as negative control. The EMSA reaction products were resolved on 8% polyacrylamide gel and visualized using a ChemiDoc XRS molecular imaging system (Bio-Rad, Hercules, CA, USA).

3.10. Transactivation Assay in Tobacco

A 47 base pair minimal 35S promoter was amplified and cloned with SpeⅠ and XbaⅠ sites into pGreenII-0800-LUC to generate pGreenII-0800-mini 35S-LUC vector. The 2.0 Kb WUS promoter (−126 bp–−2127 bp) was cloned with KpnⅠ and BamHⅠ sites into pGreenII-0800-mini 35S-LUC vector to create pGreenII-0800-WUSpro-mini 35S-LUC. The dual-luciferase reporters in combination with different effectors (35Spro::GFP, 35Spro::GFP:WUS, 35Spro::HA:SDJ3, 35Spro::HA:SDJ1, 35Spro::HA:At5g09540) were introduced into Nicotiana benthamiana leaves through Agrobacterium infiltration. The activities of firefly luciferase (LUC) and Renilla luciferase (REN) were examined three days after infiltration using a Dual Luciferase Assay kit (Promega, Madison, WI, USA) on a luminometer (GloMax®20/20, Promega). The LUC activity was normalized to the REN activity (LUC/REN), and three replicate assays were performed with independent biological samples.

3.11. Subcellular Localization of DnaJ Proteins

35Spro::GFP:SDJ3, 35Spro::GFP:SDJ1, and 35Spro::GFP:At5g09540 constructs in combination with 35Spro::Coilin:RFP construct were introduced into Nicotiana benthamiana leaves through Agrobacterium infiltration. Then the colocalization of GFP:SDJ1, GFP:SDJ3 and GFP:At5g09540 proteins with Coilin:RFP protein in nucleus was examined using a confocal laser scanning microscope (Zeiss LSM 780) three days later after Agrobacterium infiltration.

3.12. RNA Isolation and Real-Time RT-PCR

Total RNA extraction, reverse transcription and qRT-PCR were performed as a previous report [28]. Three replicate assays were performed with independent RNA samples. All primers used for RT-PCR analysis are listed in Supplemental Table S1.

3.13. Histochemical Localization of GUS Activity

The histological analysis of β-glucuronidase activity was performed as the reported protocol [29]. GUS staining was performed with three independent transgenic lines with similar results.

3.14. Accession Numbers

Sequence data from this article can be found in the Arabidopsis Genome Initiative under the following accession numbers: WUS (At2g17950), SDJ3 (At1g62970), SDJ1 (At5g64360), At5g09540, At4g11930.

Supplementary Materials

The following are available online at https://www.mdpi.com/2223-7747/10/1/136/s1, Figure S1: At4g11930 interacts with WUS protein in tobacco epidermal cells in BiFC assay.,Figure S2: BnSDJ1 interacts with BnWUS protein in tobacco epidermal cells in BiFC assay, Table S1: The primers used in the experiment.

Author Contributions

T.J., F.L., S.L. and J.D. conducted experiments. T.J. analyzed data and prepared figures. T.H. designed research and wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the Ministry of Science and Technique of China (2013CB967302).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Data is contained within the article or supplementary material.

Conflicts of Interest

The authors declare no competing interests.

References

  1. Laux, T.; Mayer, K.F.X.; Berger, J.; Jurgens, G. The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 1996, 122, 87–96. [Google Scholar]
  2. Mayer, K.F.X.; Schoof, H.; Haecker, A.; Lenhard, M.; Jurgens, G.; Laux, T. Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell 1998, 95, 805–815. [Google Scholar] [CrossRef] [Green Version]
  3. Schoof, H.; Lenhard, M.; Haecker, A.; Mayer, K.F.X.; Jurgens, G.; Laux, T. The stem cell population of Arabidopsis shoot meristems is maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell 2000, 100, 635–644. [Google Scholar] [CrossRef] [Green Version]
  4. Georgopoulos, C.; Welch, W.J. Role of the Major Heat-Shock Proteins as Molecular Chaperones. Annu. Rev. Cell Biol. 1993, 9, 601–634. [Google Scholar] [CrossRef] [PubMed]
  5. Lindquist, S.; Craig, E.A. The heat-shock proteins. Annu. Rev. Genet. 1988, 22, 631–677. [Google Scholar] [CrossRef] [PubMed]
  6. Qiu, X.B.; Shao, Y.M.; Miao, S.; Wang, L. The diversity of the DnaJ/Hsp40 family, the crucial partners for Hsp70 chaperones. Cell. Mol. Life Sci. 2006, 63, 2560–2570. [Google Scholar] [CrossRef]
  7. Miernyk, J.A. The J-domain proteins of Arabidopsis thaliana: An unexpectedly large and diverse family of chaperones. Cell Stress Chaperones 2001, 6, 209–218. [Google Scholar] [CrossRef]
  8. Pulido, P.; Leister, D. Novel DNAJ-related proteins in Arabidopsis thaliana. New Phytol. 2018, 217, 480–490. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Kampinga, H.H.; Craig, E.A. The HSP70 chaperone machinery: J proteins as drivers of functional specificity. Nat. Rev. Mol. Cell Biol. 2010, 11, 579–592. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Rajan, V.B.V.; D’Silva, P. Arabidopsis thaliana J-class heat shock proteins: Cellular stress sensors. Funct. Integr. Genom. 2009, 9, 433–446. [Google Scholar] [CrossRef] [PubMed]
  11. Finka, A.; Mattoo, R.U.H.; Goloubinoff, P. Meta-analysis of heat- and chemically upregulated chaperone genes in plant and human cells. Cell Stress Chaperones 2011, 16, 15–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Du, Y.M.; Zhao, J.P.; Chen, T.Y.; Liu, Q.; Zhang, H.L.; Wang, Y.; Hong, Y.G.; Xiao, F.M.; Zhang, L.; Shen, Q.H.; et al. Type I J-Domain NbMIP1 Proteins Are Required for Both Tobacco Mosaic Virus Infection and Plant Innate Immunity. PLoS Pathog. 2013, 9. [Google Scholar] [CrossRef]
  13. Wang, W.X.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2004, 9, 244–252. [Google Scholar] [CrossRef] [PubMed]
  14. Bekh-Ochir, D.; Shimada, S.; Yamagami, A.; Kanda, S.; Ogawa, K.; Nakazawa, M.; Matsui, M.; Sakuta, M.; Osada, H.; Asami, T.; et al. A novel mitochondrial DnaJ/Hsp40 family protein BIL2 promotes plant growth and resistance against environmental stress in brassinosteroid signaling. Planta 2013, 237, 1509–1525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Boonsirichai, K.; Sedbrook, J.C.; Chen, R.J.; Gilroy, S.; Masson, P.H. ALTERED RESPONSE TO GRAVITY is a peripheral membrane protein that modulates gravity-induced cytoplasmic alkalinization and lateral auxin transport in plant statocytes. Plant Cell 2003, 15, 2612–2625. [Google Scholar] [CrossRef] [Green Version]
  16. Christensen, C.A.; Gorsich, S.W.; Brown, R.H.; Jones, L.G.; Brown, J.; Shaw, J.M.; Drews, G.N. Mitochondrial GFA2 is required for synergid cell death in Arabidopsis. Plant Cell 2002, 14, 2215–2232. [Google Scholar] [CrossRef] [Green Version]
  17. Harrison, B.R.; Masson, P.H. ARL2, ARG1 and PIN3 define a gravity signal transduction pathway in root statocytes. Plant J. 2008, 53, 380–392. [Google Scholar] [CrossRef]
  18. Park, H.Y.; Lee, S.Y.; Seok, H.Y.; Kim, S.H.; Sung, Z.R.; Moon, Y.H. EMF1 Interacts with EIP1, EIP6 or EIP9 Involved in the Regulation of Flowering Time in Arabidopsis. Plant Cell Physiol. 2011, 52, 1376–1388. [Google Scholar] [CrossRef] [Green Version]
  19. Park, M.Y.; Kim, S.Y. The Arabidopsis J Protein AtJ1 is Essential for Seedling Growth, Flowering Time Control and ABA Response. Plant Cell Physiol. 2014, 55, 2152–2163. [Google Scholar] [CrossRef] [Green Version]
  20. Harris, C.J.; Scheibe, M.; Wongpalee, S.P.; Liu, W.L.; Cornett, E.M.; Vaughan, R.M.; Li, X.Q.; Chen, W.; Xue, Y.; Zhong, Z.H.; et al. A DNA methylation reader complex that enhances gene transcription. Science 2018, 362, 1182–1186. [Google Scholar] [CrossRef] [Green Version]
  21. Zhao, Q.Q.; Lin, R.N.; Li, L.; Chen, S.; He, X.J. A methylated-DNA-binding complex required for plant development mediates transcriptional activation of promoter methylated genes. J. Integr. Plant Biol. 2019, 61, 120–139. [Google Scholar] [CrossRef] [PubMed]
  22. Perales, M.; Rodriguez, K.; Snipes, S.; Yadav, R.K.; Diaz-Mendoza, M.; Reddy, G.V. Threshold-dependent transcriptional discrimination underlies stem cell homeostasis. Proc. Natl. Acad. Sci. USA 2016, 113, E6298–E6306. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Ohta, M.; Matsui, K.; Hiratsu, K.; Shinshi, H.; Ohme-Takagi, M. Repression domains of class II ERF transcriptional repressors share an essential motif for active repression. Plant Cell 2001, 13, 1959–1968. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Hiratsu, K.; Matsui, K.; Koyama, T.; Ohme-Takagi, M. Dominant repression of target genes by chimeric repressors that include the EAR motif, a repression domain, in Arabidopsis. Plant J. 2003, 34, 733–739. [Google Scholar] [CrossRef] [PubMed]
  25. Matsui, K.; Tanaka, H.; Ohme-Takagi, M. Suppression of the biosynthesis of proanthocyanidin in Arabidopsis by a chimeric PAP1 repressor. Plant Biotechnol. J. 2004, 2, 487–493. [Google Scholar] [CrossRef]
  26. Matsui, K.; Ohme-Takagi, M. Detection of protein-protein interactions in plants using the transrepressive activity of the EAR motif repression domain. Plant J. 2010, 61, 570–578. [Google Scholar] [CrossRef]
  27. Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [Green Version]
  28. Cui, Y.C.; Rao, S.F.; Chang, B.B.; Wang, X.S.; Zhang, K.D.; Hou, X.L.; Zhu, X.Y.; Wu, H.J.; Tian, Z.X.; Zhao, Z.; et al. AtLa1 protein initiates IRES-dependent translation of WUSCHEL mRNA and regulates the stem cell homeostasis of Arabidopsis in response to environmental hazards. Plant Cell Environ. 2015, 38, 2098–2114. [Google Scholar] [CrossRef]
  29. Jefferson, R.A.; Kavanagh, T.A.; Bevan, M.W. Gus Fusions—Beta-Glucuronidase as a Sensitive and Versatile Gene Fusion Marker in Higher-Plants. EMBO J. 1987, 6, 3901–3907. [Google Scholar] [CrossRef]
Plants 10 00136 g001 550
Figure 1. WUS protein interacts with DnaJ proteins (a) WUS protein interacts with SDJ1 and SDJ3 proteins in Yeast-two-hybrid assays. (b) Bimolecular fluorescence complementation in tobacco epidermal cells. WUS:YFPn protein in combination with SDJ3:YFPc, SDJ1:YFPc, and At5g09540:YFPc, respectively, was colocalized with Coilin:RFP protein in nucleus. CAT:YFPn and CAT:YFPc were used in control assays. Scale bar = 25 μm. (c) Input of recombinant proteins detected by immunoblotting with anti-GST antibody and anti-MBP antibody (Left) and pull down of GST-tagged WUS protein through MBP-tagged SDJ1 and MBP-tagged At5g09540 proteins detected by immunoblotting with anti-GST antibody (right). (d–f) Co-immunoprecipitation of GFP:WUS and HA:SDJ3 (d), GFP:WUS and HA:SDJ1 (e), GFP:WUS and HA:At5g09540 (f) detected by immunoblotting with anti-HA antibody.
Figure 1. WUS protein interacts with DnaJ proteins (a) WUS protein interacts with SDJ1 and SDJ3 proteins in Yeast-two-hybrid assays. (b) Bimolecular fluorescence complementation in tobacco epidermal cells. WUS:YFPn protein in combination with SDJ3:YFPc, SDJ1:YFPc, and At5g09540:YFPc, respectively, was colocalized with Coilin:RFP protein in nucleus. CAT:YFPn and CAT:YFPc were used in control assays. Scale bar = 25 μm. (c) Input of recombinant proteins detected by immunoblotting with anti-GST antibody and anti-MBP antibody (Left) and pull down of GST-tagged WUS protein through MBP-tagged SDJ1 and MBP-tagged At5g09540 proteins detected by immunoblotting with anti-GST antibody (right). (d–f) Co-immunoprecipitation of GFP:WUS and HA:SDJ3 (d), GFP:WUS and HA:SDJ1 (e), GFP:WUS and HA:At5g09540 (f) detected by immunoblotting with anti-HA antibody.
Plants 10 00136 g001
Plants 10 00136 g002 550
Figure 2. WUS-DnaJ complexes bind to WUS promoter and regulate WUS promoter activity. (a) Diagram of amplicon locations in WUS promoter. (b) DnaJ proteins bind to Texas red-labeled WUS promoter probe via the interaction with WUS protein as a complex in EMSA assay. The unlabeled probe was used as competitor. The TAAT box was substituted by CCCC in WUS mutant probe to abolish the binding of WUS protein. (c,d) SDJ1 and At5g09540 proteins failed to bind to P1(−312 bp–+25 bp) and P2 (−608 bp–−285 bp)regions (c) and P3 (−926 bp–−580 bp)and P4(−1203 bp–−895 bp) regions (d) of WUS promoter in EMSA assay. (e) Chromatin immunoprecipitation of At5g09540 protein with different regions (P5, P6, P7, P8) of WUS promoter and an Actin7 promoter region in 35Spro::HA:At5g09540 plants. P5(−1570 bp–−1481bp), P6(−869 bp–−774 bp), and P7(−515 bp–−340 bp) regions contain TAAT box, but not P8 (+12 bp–+121 bp) region. The ChIP signal was calculated with three independent biological replicates, Student-t test, * p < 0.05. (f–i) LUC/REN activity in tobacco cells co-transformed with WUSpro;min35S::LUC reporter construct and indicated effectors. (f) Diagram ofWUSpro; Min35S::LUC reporter construct. 35S: CaMV 35S promoter; WUSpro: 2.2 Kb WUS promoter (−1–−2200 bp); Min35S: 47 base pair 35S minimal element; REN: Renilla luciferase, LUC: firefly luciferase. LB/RB: T-DNA left or right border. The WUS promoter activity was significantly increased by WUS protein in combination with SDJ3 (g), SDJ1 (h), and At5g09540 (i), respectively. Error bar = mean ± SEM (n = 4 biological replicates). Student-t test, * p < 0.05.
Figure 2. WUS-DnaJ complexes bind to WUS promoter and regulate WUS promoter activity. (a) Diagram of amplicon locations in WUS promoter. (b) DnaJ proteins bind to Texas red-labeled WUS promoter probe via the interaction with WUS protein as a complex in EMSA assay. The unlabeled probe was used as competitor. The TAAT box was substituted by CCCC in WUS mutant probe to abolish the binding of WUS protein. (c,d) SDJ1 and At5g09540 proteins failed to bind to P1(−312 bp–+25 bp) and P2 (−608 bp–−285 bp)regions (c) and P3 (−926 bp–−580 bp)and P4(−1203 bp–−895 bp) regions (d) of WUS promoter in EMSA assay. (e) Chromatin immunoprecipitation of At5g09540 protein with different regions (P5, P6, P7, P8) of WUS promoter and an Actin7 promoter region in 35Spro::HA:At5g09540 plants. P5(−1570 bp–−1481bp), P6(−869 bp–−774 bp), and P7(−515 bp–−340 bp) regions contain TAAT box, but not P8 (+12 bp–+121 bp) region. The ChIP signal was calculated with three independent biological replicates, Student-t test, * p < 0.05. (f–i) LUC/REN activity in tobacco cells co-transformed with WUSpro;min35S::LUC reporter construct and indicated effectors. (f) Diagram ofWUSpro; Min35S::LUC reporter construct. 35S: CaMV 35S promoter; WUSpro: 2.2 Kb WUS promoter (−1–−2200 bp); Min35S: 47 base pair 35S minimal element; REN: Renilla luciferase, LUC: firefly luciferase. LB/RB: T-DNA left or right border. The WUS promoter activity was significantly increased by WUS protein in combination with SDJ3 (g), SDJ1 (h), and At5g09540 (i), respectively. Error bar = mean ± SEM (n = 4 biological replicates). Student-t test, * p < 0.05.
Plants 10 00136 g002
Plants 10 00136 g003 550
Figure 3. Overexpression of DnaJ-SRDX protein inhibits SAM development in Arabidopsis. (a–e) The premature termination of SAM in strong lines of 35Spro::SDJ3-SRDX WUSpro::GFP:GUS plant (a), 35Spro::SDJ1-SRDX WUSpro::GFP:GUS plant (b), 35Spro::At5g09540-SRDX WUSpro::GFP:GUS plant (c), and wus mutant (d) in comparison with that of WUSpro::GFP:GUS control plant (e). (f) Phenotypes of weak lines of four-week-old 35Spro::SDJ3-SRDX WUSpro::GFP:GUS plant and 35Spro::SDJ1-SRDX WUSpro::GFP:GUS plant in comparison with WUSpro::GFP:GUS control plant. (g,h) WUS promoter activity in 35Spro::SDJ1-SRDX WUSpro::GFP:GUS plant (h) in comparison with WUSpro::GFP:GUS plant (g) examined by GUS staining. Scale bar = 5 mm in (a–e), 50 μm in (g,h).
Figure 3. Overexpression of DnaJ-SRDX protein inhibits SAM development in Arabidopsis. (a–e) The premature termination of SAM in strong lines of 35Spro::SDJ3-SRDX WUSpro::GFP:GUS plant (a), 35Spro::SDJ1-SRDX WUSpro::GFP:GUS plant (b), 35Spro::At5g09540-SRDX WUSpro::GFP:GUS plant (c), and wus mutant (d) in comparison with that of WUSpro::GFP:GUS control plant (e). (f) Phenotypes of weak lines of four-week-old 35Spro::SDJ3-SRDX WUSpro::GFP:GUS plant and 35Spro::SDJ1-SRDX WUSpro::GFP:GUS plant in comparison with WUSpro::GFP:GUS control plant. (g,h) WUS promoter activity in 35Spro::SDJ1-SRDX WUSpro::GFP:GUS plant (h) in comparison with WUSpro::GFP:GUS plant (g) examined by GUS staining. Scale bar = 5 mm in (a–e), 50 μm in (g,h).
Plants 10 00136 g003
Plants 10 00136 g004 550
Figure 4. Expression of SDJ3 gene in different organs at different developmental stages. (a) Diagram of gSDJ3::GFP:GUS construct. (b–e) SDJ3:GFP:GUS fusion protein is expressed at mature stage (e), but not global stage (b), heart stage (c), and torpedo stage (d) during the embryogenesis of gSDJ3::GFP:GUS plant by GFP fluorescence scanning. (f–o) Expression of SDJ3:GF:GUS fusion protein in 3-day-old seedling (f), 7-day-old seedling (g), cotyledon (h), hypocotyl (i), root (j), and RAM (k) of 7-day-old seedling, 14-day-old seedling (l), SAM of 14-day-old seedling (m), Flower (n), and Silique (o) examined by GUS staining. Scale bar= 10 μm in (b–d); 50 μm in (e,m); 1000 μm in (f–l,n) and o; 100 μm in (i–k).
Figure 4. Expression of SDJ3 gene in different organs at different developmental stages. (a) Diagram of gSDJ3::GFP:GUS construct. (b–e) SDJ3:GFP:GUS fusion protein is expressed at mature stage (e), but not global stage (b), heart stage (c), and torpedo stage (d) during the embryogenesis of gSDJ3::GFP:GUS plant by GFP fluorescence scanning. (f–o) Expression of SDJ3:GF:GUS fusion protein in 3-day-old seedling (f), 7-day-old seedling (g), cotyledon (h), hypocotyl (i), root (j), and RAM (k) of 7-day-old seedling, 14-day-old seedling (l), SAM of 14-day-old seedling (m), Flower (n), and Silique (o) examined by GUS staining. Scale bar= 10 μm in (b–d); 50 μm in (e,m); 1000 μm in (f–l,n) and o; 100 μm in (i–k).
Plants 10 00136 g004
Plants 10 00136 g005 550
Figure 5. Expression of SDJ1 gene in different organs at different developmental stages. (a) Diagram of gSDJ1::GFP:GUS construct. (b–e) SDJ1:GFP:GUS fusion protein is expressed at global stage (b), heart stage (c), and torpedo stage (d), and mature stage (e) during the embryogenesis of gSDJ1::GFP:GUS plant by GFP fluorescence scanning. (f–o) Expression of SDJ1:GFP:GUS fusion protein in 3-day-old seedling (f), 7-day-old seedling (g), cotyledon (h), hypocotyl (i), root (j), and RAM (k) of 7-day-old seedling, 14-day-old seedling (l), SAM of 14-day-old seedling (m), Flower (n), and Silique (o) examined by GUS staining. Scale bar= 10 μm in (b–d); 50 μm in (e,m); 1000 μm in (f–l,n) and o; 100 μm in (i–k).
Figure 5. Expression of SDJ1 gene in different organs at different developmental stages. (a) Diagram of gSDJ1::GFP:GUS construct. (b–e) SDJ1:GFP:GUS fusion protein is expressed at global stage (b), heart stage (c), and torpedo stage (d), and mature stage (e) during the embryogenesis of gSDJ1::GFP:GUS plant by GFP fluorescence scanning. (f–o) Expression of SDJ1:GFP:GUS fusion protein in 3-day-old seedling (f), 7-day-old seedling (g), cotyledon (h), hypocotyl (i), root (j), and RAM (k) of 7-day-old seedling, 14-day-old seedling (l), SAM of 14-day-old seedling (m), Flower (n), and Silique (o) examined by GUS staining. Scale bar= 10 μm in (b–d); 50 μm in (e,m); 1000 μm in (f–l,n) and o; 100 μm in (i–k).
Plants 10 00136 g005
Plants 10 00136 g006 550
Figure 6. Localization of DnaJ proteins in nucleus. (a–c) The transiently expressed GFP:SDJ3, GFP:SDJ1, and GFP:At5g09540 proteins are colocalized with Coilin:RFP protein in nucleus in tobacco epidermal cells. (d) GFP protein is freely distributed in cytoplasm and nucleus. Scale bar = 25 μm.
Figure 6. Localization of DnaJ proteins in nucleus. (a–c) The transiently expressed GFP:SDJ3, GFP:SDJ1, and GFP:At5g09540 proteins are colocalized with Coilin:RFP protein in nucleus in tobacco epidermal cells. (d) GFP protein is freely distributed in cytoplasm and nucleus. Scale bar = 25 μm.
Plants 10 00136 g006
Plants 10 00136 g007 550
Figure 7. DnaJ protein regulate WUS mRNA expression. (a) RT-PCR analysis of of relative genes in sdj3, sdj1and at5g09540 mutants. (b) Growth phenotype of WT, sdj3, sdj1, at5g09540, sdj3 sdj1, sdj1 at5g09540, sdj3 at5g09540, and sdj3 sdj1 at5g09540 plants. (c,d) WUS mRNA level and CLV3 mRNA level in WT and sdj3 sdj1 at5g09540 plants by quantitative RT-PCR analysis. Student-t test, * p < 0.05 (e,f) SAM histology of WT and sdj3 sdj1 at5g09540 plants.
Figure 7. DnaJ protein regulate WUS mRNA expression. (a) RT-PCR analysis of of relative genes in sdj3, sdj1and at5g09540 mutants. (b) Growth phenotype of WT, sdj3, sdj1, at5g09540, sdj3 sdj1, sdj1 at5g09540, sdj3 at5g09540, and sdj3 sdj1 at5g09540 plants. (c,d) WUS mRNA level and CLV3 mRNA level in WT and sdj3 sdj1 at5g09540 plants by quantitative RT-PCR analysis. Student-t test, * p < 0.05 (e,f) SAM histology of WT and sdj3 sdj1 at5g09540 plants.
Plants 10 00136 g007
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Jia, T.; Li, F.; Liu, S.; Dou, J.; Huang, T. DnaJ Proteins Regulate WUS Expression in Shoot Apical Meristem of Arabidopsis. Plants 2021, 10, 136. https://doi.org/10.3390/plants10010136

AMA Style

Jia T, Li F, Liu S, Dou J, Huang T. DnaJ Proteins Regulate WUS Expression in Shoot Apical Meristem of Arabidopsis. Plants. 2021; 10(1):136. https://doi.org/10.3390/plants10010136

Chicago/Turabian Style

Jia, Tianqi, Fan Li, Shuang Liu, Jin Dou, and Tao Huang. 2021. "DnaJ Proteins Regulate WUS Expression in Shoot Apical Meristem of Arabidopsis" Plants 10, no. 1: 136. https://doi.org/10.3390/plants10010136

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop