Pro-Inflammatory and Cytotoxic Effects of Polystyrene Microplastics on Human and Murine Intestinal Cell Lines
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Cultures and PS-MPs Treatment, Cell Viability and Oxidative Stress
2.1.1. Cell Cultures and PS-MPs Treatment
2.1.2. Cell Viability—MTT Assay
2.1.3. Oxidative Stress—SOD Assay
2.2. Magnetic-Beads Panel MultiplexPlex Assay
2.3. RNA Extraction, Retrotranscription and Quantitative Real-Time PCR
2.4. Statistical Analysis
2.4.1. MTT and SOD Assays Statistical Analysis
2.4.2. Magnetic-Beads Panel MultiplexPlex Assay Statistical Analysis
2.4.3. Real-Time PCR Statistical Analysis
3. Results
3.1. Cell Cultures, Cell Viability and Oxidative Stress after PS-MPs Treatment
3.2. Magnetic-Beads Panel MultiplexPlex Luminex Assay
3.3. Quantitative Real-Time PCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
MPs | Microplastics |
PS-MPs | Polystyrene microplastics |
GIT | Gastro-intestinal tract |
EFSA | European Food Safety Authority |
CREDIMA | National Reference Center for Marine Mammals Diagnostics |
MTT | 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide |
SOD | Superoxide dismutase |
ROS | Reactive oxygen species |
References
- Schlatter, C. Environmental Pollution and Human Health. Sci. Total Environ. 1994, 143, 93–101. [Google Scholar] [CrossRef] [PubMed]
- Briggs, D. Environmental Pollution and the Global Burden of Disease. Br. Med. Bull. 2003, 68, 1–24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Longo, V.; Forleo, A.; Radogna, A.V.; Siciliano, P.; Notari, T.; Pappalardo, S.; Piscopo, M.; Montano, L.; Capone, S. A Novel Human Biomonitoring Study by Semiconductor Gas Sensors in Exposomics: Investigation of Health Risk in Contaminated Sites. Environ. Pollut. 2022, 304, 119119. [Google Scholar] [CrossRef]
- Montano, L.; Pironti, C.; Pinto, G.; Ricciardi, M.; Buono, A.; Brogna, C.; Venier, M.; Piscopo, M.; Amoresano, A.; Motta, O. Polychlorinated Biphenyls (PCBs) in the Environment: Occupational and Exposure Events, Effects on Human Health and Fertility. Toxics 2022, 10, 365. [Google Scholar] [CrossRef] [PubMed]
- Waring, R.H.; Harris, R.M.; Mitchell, S.C. Plastic Contamination of the Food Chain: A Threat to Human Health? Maturitas 2018, 115, 64–68. [Google Scholar] [CrossRef] [PubMed]
- Briffa, J.; Sinagra, E.; Blundell, R. Heavy Metal Pollution in the Environment and Their Toxicological Effects on Humans. Heliyon 2020, 6, e04691. [Google Scholar] [CrossRef]
- Manisalidis, I.; Stavropoulou, E.; Stavropoulos, A.; Bezirtzoglou, E. Environmental and Health Impacts of Air Pollution: A Review. Front. Public Health 2020, 8, 14. [Google Scholar] [CrossRef] [Green Version]
- PlascticsEurope. Plastics-the Facts 2021—An Analysis of European Plastics Production, Demand and Waste Data. 2021. Available online: https://plasticseurope.org/wp-content/uploads/2021/12/Plastics-the-Facts-2021-web-final.pdf (accessed on 26 December 2022).
- Meaza, I.; Toyoda, J.H.; Wise, J.P. Microplastics in Sea Turtles, Marine Mammals and Humans: A One Environmental Health Perspective. Front. Environ. Sci. 2021, 8, 575614. [Google Scholar] [CrossRef]
- Mü, R.-J.; Kleeberg, I.; Deckwer, W.-D. Biodegradation of Polyesters Containing Aromatic Constituents. J. Biotechnol. 2001, 86, 87–95. [Google Scholar]
- Edge, M.; Hayes, M.; Mohammadian, M.; Allen, N.S.; Jewitt, T.S.; Brems, K.; Jones, K. Aspects of Poly(Ethylene Terephthalate) Degradation for Archival Life and Environmental Degradation. Polym. Degrad. Stab. 1991, 32, 131–153. [Google Scholar] [CrossRef]
- Allen, N.S.; Edge, M.; Mohammadian, M.; Jones, K. Physicochemical Aspects of the Environmental Degradation of Poly(Ethylene Terephthalate). Polym. Degrad. Stab. 1994, 43, 229–237. [Google Scholar] [CrossRef]
- Webb, H.K.; Arnott, J.; Crawford, R.J.; Ivanova, E.P. Plastic Degradation and Its Environmental Implications with Special Reference to Poly(Ethylene Terephthalate). Polymers 2013, 5, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Paul, M.B.; Stock, V.; Cara-Carmona, J.; Lisicki, E.; Shopova, S.; Fessard, V.; Braeuning, A.; Sieg, H.; Böhmert, L. Micro- And Nanoplastics-Current State of Knowledge with the Focus on Oral Uptake and Toxicity. Nanoscale Adv. 2020, 2, 4350–4367. [Google Scholar] [CrossRef] [PubMed]
- Kutralam-Muniasamy, G.; Shruti, V.C.; Pérez-Guevara, F.; Roy, P.D. Microplastic Diagnostics in Humans: “The 3Ps” Progress, Problems, and Prospects. Sci. Total Environ. 2023, 856, 159164. [Google Scholar] [CrossRef]
- Liu, P.; Zhan, X.; Wu, X.; Li, J.; Wang, H.; Gao, S. Effect of Weathering on Environmental Behavior of Microplastics: Properties, Sorption and Potential Risks. Chemosphere 2020, 242, 125193. [Google Scholar] [CrossRef] [PubMed]
- Presence of Microplastics and Nanoplastics in Food, with Particular Focus on Seafood. EFSA J. 2016, 14, e04501. [CrossRef] [Green Version]
- Zantis, L.J.; Carroll, E.L.; Nelms, S.E.; Bosker, T. Marine Mammals and Microplastics: A Systematic Review and Call for Standardisation. Environ. Pollut. 2021, 269, 116142. [Google Scholar] [CrossRef]
- Panti, C.; Baini, M.; Lusher, A.; Hernandez-Milan, G.; Bravo Rebolledo, E.L.; Unger, B.; Syberg, K.; Simmonds, M.P.; Fossi, M.C. Marine Litter: One of the Major Threats for Marine Mammals. Outcomes from the European Cetacean Society Workshop. Environ. Pollut. 2019, 247, 72–79. [Google Scholar]
- Corazzola, G.; Baini, M.; Grattarola, C.; Panti, C.; Marcer, F.; Garibaldi, F.; Berio, E.; Mancusi, C.; Galli, M.; Mazzariol, S.; et al. Analysis of the Gastro-Intestinal Tract of Marine Mammals: A Multidisciplinary Approach with a New Multi-Sieves Tool. Animals 2021, 11, 1824. [Google Scholar] [CrossRef]
- Pearce, S.C.; Coia, H.G.; Karl, J.P.; Pantoja-Feliciano, I.G.; Zachos, N.C.; Racicot, K. Intestinal in Vitro and Ex Vivo Models to Study Host-Microbiome Interactions and Acute Stressors. Front. Physiol. 2018, 9, 1584. [Google Scholar] [CrossRef] [Green Version]
- Lei, L.; Wu, S.; Lu, S.; Liu, M.; Song, Y.; Fu, Z.; Shi, H.; Raley-Susman, K.M.; He, D. Microplastic Particles Cause Intestinal Damage and Other Adverse Effects in Zebrafish Danio Rerio and Nematode Caenorhabditis Elegans. Sci. Total Environ. 2018, 619–620, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Wu, B.; Wu, X.; Liu, S.; Wang, Z.; Chen, L. Size-Dependent Effects of Polystyrene Microplastics on Cytotoxicity and Efflux Pump Inhibition in Human Caco-2 cells. Chemosphere 2019, 221, 333–341. [Google Scholar] [CrossRef] [PubMed]
- Hesler, M.; Aengenheister, L.; Ellinger, B.; Drexel, R.; Straskraba, S.; Jost, C.; Wagner, S.; Meier, F.; von Briesen, H.; Büchel, C.; et al. Multi-Endpoint Toxicological Assessment of Polystyrene Nano- and Microparticles in Different Biological Models in Vitro. Toxicol. Vitr. 2019, 61, 104610. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Wu, M.; Tian, D.; Qiu, L.; Li, T. Effects of Polystyrene Microbeads on Cytotoxicity and Transcriptomic Profiles in Human Caco-2 Cells. Env. Toxicol. 2020, 35, 495–506. [Google Scholar] [CrossRef]
- Dong, C.-D.; Chen, C.W.; Chen, Y.C.; Chen, H.H.; Lee, J.S.; Lin, C.H. Polystyrene Microplastic Particles: In Vitro Pulmonary Toxicity Assessment. J. Hazard Mater. 2020, 385, 121575. [Google Scholar] [CrossRef] [PubMed]
- Choi, D.; Hwang, J.; Bang, J.; Han, S.; Kim, T.; Oh, Y.; Hwang, Y.; Choi, J.; Hong, J. In Vitro Toxicity from a Physical Perspective of Polyethylene Microplastics Based on Statistical Curvature Change Analysis. Sci. Total Environ. 2021, 752, 142242. [Google Scholar] [CrossRef] [PubMed]
- Stock, V.; Laurisch, C.; Franke, J.; Dönmez, M.H.; Voss, L.; Böhmert, L.; Braeuning, A.; Sieg, H. Uptake and Cellular Effects of PE, PP, PET and PVC Microplastic Particles. Toxicol. Vitr. 2021, 70, 105021. [Google Scholar] [CrossRef]
- Koressaar, T.; Remm, M. Enhancements and Modifications of Primer Design Program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef] [Green Version]
- Benedetto, A.; Squadrone, S.; Prearo, M.; Elia, A.C.; Giorgi, I.; Abete, M.C. Evaluation of ABC Efflux Transporters Genes Expression in Kidney of Rainbow Trout (Oncorhynchus Mykiss) Fed with Melamine and Cyanuric Acid Diets. Chemosphere 2011, 84, 727–730. [Google Scholar] [CrossRef]
- González-Bermúdez, L.; Anglada, T.; Genescà, A.; Martín, M.; Terradas, M. Identification of Reference Genes for RT-QPCR Data Normalisation in Aging Studies. Sci. Rep. 2019, 9, 13970. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Vandesompele, J.; de Preter, K.; Pattyn, F.; Poppe, B.; van Roy, N.; de Paepe, A.; Speleman, F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome. Biol. 2002, 3, 1–12. [Google Scholar] [CrossRef]
- Aves, A.R.; Revell, L.E.; Gaw, S.; Ruffell, H.; Schuddeboom, A.; Wotherspoon, N.E.; Larue, M.; Mcdonald, A.J. First Evidence of Microplastics in Antarctic Snow. Cryosphere 2022, 16, 2127–2145. [Google Scholar] [CrossRef]
- Wang, F.; Lai, Z.; Peng, G.; Luo, L.; Liu, K.; Huang, X.; Xu, Y.; Shen, Q.; Li, D. Microplastic Abundance and Distribution in a Central Asian Desert. Sci. Total Environ. 2021, 800, 149529. [Google Scholar] [CrossRef]
- Gardon, T.; el Rakwe, M.; Paul-Pont, I.; le Luyer, J.; Thomas, L.; Prado, E.; Boukerma, K.; Cassone, A.L.; Quillien, V.; Soyez, C.; et al. Microplastics Contamination in Pearl-Farming Lagoons of French Polynesia. J. Hazard Mater. 2021, 419, 126396. [Google Scholar] [CrossRef] [PubMed]
- Gambino, I.; Bagordo, F.; Grassi, T.; Panico, A.; de Donno, A. Occurrence of Microplastics in Tap and Bottled Water: Current Knowledge. Int. J. Environ. Res. Public Health 2022, 19, 5283. [Google Scholar] [CrossRef]
- Gasperi, J.; Wright, S.L.; Dris, R.; Collard, F.; Mandin, C.; Guerrouache, M.; Langlois, V.; Kelly, F.J.; Tassin, B. Microplastics in Air: Are We Breathing It In? Curr. Opin. Environ. Sci. Health 2018, 1, 1–5. [Google Scholar] [CrossRef] [Green Version]
- Ragusa, A.; Svelato, A.; Santacroce, C.; Catalano, P.; Notarstefano, V.; Carnevali, O.; Papa, F.; Rongioletti, M.C.A.; Baiocco, F.; Draghi, S.; et al. Plasticenta: First Evidence of Microplastics in Human Placenta. Environ. Int. 2021, 146, 106274. [Google Scholar] [CrossRef] [PubMed]
- Ragusa, A.; Notarstefano, V.; Svelato, A.; Belloni, A.; Gioacchini, G.; Blondeel, C.; Zucchelli, E.; de Luca, C.; D’avino, S.; Gulotta, A.; et al. Raman Microspectroscopy Detection and Characterisation of Microplastics in Human Breastmilk. Polymers 2022, 14, 2700. [Google Scholar] [CrossRef] [PubMed]
- Leslie, H.A.; van Velzen, M.J.M.; Brandsma, S.H.; Vethaak, A.D.; Garcia-Vallejo, J.J.; Lamoree, M.H. Discovery and Quantification of Plastic Particle Pollution in Human Blood. Environ. Int. 2022, 163, 107199. [Google Scholar] [CrossRef]
- Wang, Q.; Bai, J.; Ning, B.; Fan, L.; Sun, T.; Fang, Y.; Wu, J.; Li, S.; Duan, C.; Zhang, Y.; et al. Effects of Bisphenol A and Nanoscale and Microscale Polystyrene Plastic Exposure on Particle Uptake and Toxicity in Human Caco-2 Cells. Chemosphere 2020, 254, 126788. [Google Scholar] [CrossRef] [PubMed]
- Lehner, R.; Wohlleben, W.; Septiadi, D.; Landsiedel, R.; Petri-Fink, A.; Rothen-Rutishauser, B. A Novel 3D Intestine Barrier Model to Study the Immune Response upon Exposure to Microplastics. Arch. Toxicol. 2020, 94, 2463–2479. [Google Scholar] [CrossRef]
- Khalid, N.; Aqeel, M.; Noman, A.; Khan, S.M.; Akhter, N. Interactions and Effects of Microplastics with Heavy Metals in Aquatic and Terrestrial Environments. Environ. Pollut. 2021, 290, 118104. [Google Scholar] [CrossRef] [PubMed]
- Lettieri, G.; Carusone, N.; Notariale, R.; Prisco, M.; Ambrosino, A.; Perrella, S.; Manna, C.; Piscopo, M. Morphological, Gene, and Hormonal Changes in Gonads and In-Creased Micrococcal Nuclease Accessibility of Sperm Chromatin Induced by Mercury. Biomolecules 2022, 12, 87. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, A.; Shelver, W.L. Micro- and Nanoplastic Induced Cellular Toxicity in Mammals: A Review. Sci. Total Environ. 2021, 755, 142518. [Google Scholar] [CrossRef] [PubMed]
- Stock, V.; Böhmert, L.; Lisicki, E.; Block, R.; Cara-Carmona, J.; Pack, L.K.; Selb, R.; Lichtenstein, D.; Voss, L.; Henderson, C.J.; et al. Uptake and Effects of Orally Ingested Polystyrene Microplastic Particles in Vitro and in Vivo. Arch. Toxicol. 2019, 93, 1817–1833. [Google Scholar] [CrossRef]
- Palaniappan, S.; Sadacharan, C.M.; Rostama, B. Polystyrene and Polyethylene Microplastics Decrease Cell Viability and Dysregulate Inflammatory and Oxidative Stress Markers of MDCK and L929 Cells In Vitro. Expo. Health 2022, 14, 75–85. [Google Scholar] [CrossRef]
- Stock, V.; Böhmert, L.; Dönmez, M.H.; Lampen, A.; Sieg, H. An Inverse Cell Culture Model for Floating Plastic Particles. Anal. Biochem. 2020, 591, 113545. [Google Scholar] [CrossRef]
- Schirinzi, G.F.; Pérez-Pomeda, I.; Sanchís, J.; Rossini, C.; Farré, M.; Barceló, D. Cytotoxic Effects of Commonly Used Nanomaterials and Microplastics on Cerebral and Epithelial Human Cells. Environ. Res. 2017, 159, 579–587. [Google Scholar] [CrossRef]
- Bhattacharya, P. A review on the impacts of microplastic beads used in cosmetics. Acta Biomed. 2016, 3, 47–52. [Google Scholar]
- Rubio, L.; Marcos, R.; Hernández, A. Potential Adverse Health Effects of Ingested Micro- and Nanoplastics on Humans. Lessons Learned from in Vivo and in Vitro Mammalian Models. J. Toxicol. Environ. Health B Crit. Rev. 2020, 23, 51–68. [Google Scholar] [CrossRef] [PubMed]
- Hirt, N.; Body-Malapel, M. Immunotoxicity and Intestinal Effects of Nano- and Microplastics: A Review of the Literature. Part Fibre Toxicol. 2020, 17, 57. [Google Scholar] [CrossRef] [PubMed]
- Donkers, J.M.; Höppener, E.M.; Grigoriev, I.; Will, L.; Melgert, B.N.; van der Zaan, B.; van de Steeg, E.; Kooter, I.M. Advanced Epithelial Lung and Gut Barrier Models Demonstrate Passage of Microplastic Particles. Microplastics Nanoplastics 2022, 2, 6. [Google Scholar] [CrossRef]
- Zinkernagel, A.S.; Timmer, A.M.; Pence, M.A.; Locke, J.B.; Buchanan, J.T.; Turner, C.E.; Mishalian, I.; Sriskandan, S.; Hanski, E.; Nizet, V. The IL-8 Protease SpyCEP/ScpC of Group A Streptococcus Promotes Resistance to Neutrophil Killing. Cell Host. Microbe 2008, 4, 170–178. [Google Scholar] [CrossRef] [Green Version]
- Quan, J.M.; Martin, T.R.; Rosenberg, G.B.; Foster, D.C.; Whitmore, T.; Goodman, R.B. Antibodies against the N-Terminus of IL-8 Receptor A Inhibit Neutrophil Chemotaxis. Biochem. Biophys. Res. Commun. 1996, 219, 405–411. [Google Scholar] [CrossRef]
- Cotton, J.A.; Platnich, J.M.; Muruve, D.A.; Jijon, H.B.; Buret, A.G.; Beck, P.L. Interleukin-8 in Gastrointestinal Inflammation and Malignancy: Induction and Clinical Consequences. Int. J. Interferon Cytokine Mediat. Res. 2016, 8, 13–34. [Google Scholar]
- Prata, J.C.; da Costa, J.P.; Lopes, I.; Duarte, A.C.; Rocha-Santos, T. Environmental Exposure to Microplastics: An Overview on Possible Human Health Effects. Sci. Total Environ. 2020, 702, 134455. [Google Scholar] [CrossRef]
- Fournier, E.; Etienne-Mesmin, L.; Grootaert, C.; Jelsbak, L.; Syberg, K.; Blanquet-Diot, S.; Mercier-Bonin, M. Microplastics in the Human Digestive Environment: A Focus on the Potential and Challenges Facing in Vitro Gut Model Development. J. Hazard Mater. 2021, 415, 125632. [Google Scholar] [CrossRef]
Analyte | Bead Region | Bead Region | Standard Curve (pg/mL) | Cell Culture | Sensitivity (pg/mL) |
---|---|---|---|---|---|
IL-1β/IL-1F2 | 28 | A | 17.7–4300 | 1:2 | 0.8 |
IL-6 | 13 | A | 4.53–1100 | 1:2 | 1.7 |
IL-7 | 29 | K | 5.14–1250 | 1:2 | 0.410 |
IL-8/CXCL8 | 18 | A | 4.12–1000 | 1:2 | 1.8 |
IL-10 | 22 | A | 4.12–1000 | 1:2 | 1.6 |
IL-15 | 63 | J | 6.3–1550 | 1:2 | 1.01 |
IL-18/IL-1F4 | 78 | C | 7.12–1730 | 1:2 | 1.93 |
IL-23 | 76 | C | 144–35,000 | 1:2 | 11.4 |
IL-33 | 14 | C | 12.3–3000 | 1:2 | 1.8 |
Analyte | Bead Region | Bead Region | Standard Curve (pg/mL) | Cell Culture | Sensitivity (pg/mL) |
---|---|---|---|---|---|
IL-1β/IL-1F2 | 19 | Mouse A | 247–60,000 | 1:2 | 41.8 |
IL-6 | 27 | Mouse A | 28.8–7000 | 1:2 | 2.30 |
IL-7 | 14 | Mouse C | 267–65,000 | 1:2 | 35.4 |
IL-10 | 28 | Mouse A | 12.8–3100 | 1:2 | 8.20 |
IL-33 | 43 | Mouse B | 82.3–20,000 | 1:2 | 57.1 |
Gene | Reference Number | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) | Species |
---|---|---|---|---|
IL-8 | NM_001310420.1 | CTCTTGGCAGCCTTCCTGAT | TTTGGGGTGGAAAGGTTTGGA | Human |
IL-18 | NM_001386420.1 | AAGATGGCTGCTGAACCAGT | TGCCAAAGTAATCTGATTCCAGG | Human |
IL-1β | NM_000576.3 | TCGCCAGTGAAATGATGGCT | GGTCGGAGATTCGTAGCTGG | Human |
Cyclin D1 | NM_053056 | AGCTGTGCATCTACACCGAC | GAAATCGTGCGGGGTCATTG | Human |
MAPK1/ERK | NM_002745.5 | CGTGTTGCAGATCCAGACCA | GCCAGAATGCAGCCTACAGA | Human |
β-Actin | NM_001101.5 | ACAGAGCCTCGCCTTTGC | CGCGGCGATATCATCATCCA | Human |
B2M | NM_004048.4 | CTGCCGTGTGAACCATGTGA | TCAAACCTCCATGATGCTGC | Human |
HPRT | NM_000194.3 | TGCTGAGGATTTGGAAAGGGT | GGGCTACAATGTGATGGCCT | Human |
IL-8/CXCL8 | NM_011339.2 | TGATGCTCCATGGGTGAAGG | CAGAAGCTTCATTGCCGGTG | Murine |
IL-18 | NM_001357221.1 | GGCTGCCATGTCAGAAGACT | ACAGTGAAGTCGGCCAAAGT | Murine |
IL-1β | NM_008361.4 | GCCACCTTTTGACAGTGATGAG | GACAGCCCAGGTCAAAGGTT | Murine |
Cyclin D1 | NM_001379248.1 | AAACAAGGACCCCCTCCATC | GGCTTCAATCTGTTCCTGGC | Murine |
MAPK1/ERK | NM_001038663.1 | CCTCCTGCTGAACACCACTT | ATCTGGATCTGCAACACGGG | Murine |
β-Actin | NM_007393.5 | CTGTCGAGTCGCGTCCACC | CGCAGCGATATCGTCATCCAT | Murine |
B2M | NM_009735.3 | GAGCCCAAGACCGTCTACTG | GGTTCAAATGAATCTTCAGAGCATC | Murine |
HPRT | NM_013556.2 | TTCTTTGCTGACCTGCTGGA | TTATGTCCCCCGTTGACTGA | Murine |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mattioda, V.; Benedetti, V.; Tessarolo, C.; Oberto, F.; Favole, A.; Gallo, M.; Martelli, W.; Crescio, M.I.; Berio, E.; Masoero, L.; et al. Pro-Inflammatory and Cytotoxic Effects of Polystyrene Microplastics on Human and Murine Intestinal Cell Lines. Biomolecules 2023, 13, 140. https://doi.org/10.3390/biom13010140
Mattioda V, Benedetti V, Tessarolo C, Oberto F, Favole A, Gallo M, Martelli W, Crescio MI, Berio E, Masoero L, et al. Pro-Inflammatory and Cytotoxic Effects of Polystyrene Microplastics on Human and Murine Intestinal Cell Lines. Biomolecules. 2023; 13(1):140. https://doi.org/10.3390/biom13010140
Chicago/Turabian StyleMattioda, Virginia, Valerio Benedetti, Carlotta Tessarolo, Francesca Oberto, Alessandra Favole, Marina Gallo, Walter Martelli, Maria Ines Crescio, Enrica Berio, Loretta Masoero, and et al. 2023. "Pro-Inflammatory and Cytotoxic Effects of Polystyrene Microplastics on Human and Murine Intestinal Cell Lines" Biomolecules 13, no. 1: 140. https://doi.org/10.3390/biom13010140