Effects of Ecologically Relevant Concentrations of Cadmium on the Microbiota, Short-Chain Fatty Acids, and FFAR2 Expression in Zebrafish
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Embryo Breeding
2.2. Embryo Treatment
2.3. Microbiota Analysis
2.4. SCFAs Quantification by GC-MS
2.5. FFAR2 Expression Examination via qPCR
2.6. Preparation of Graphics and Statistical Analysis
3. Results
3.1. Alterations in the Structure of the Gut Microbiota in Zebrafish Larvae
3.2. Changes in the Concentrations of SCFAs in Zebrafish Larvae
3.3. Correlation Analysis between SCFAs and Gut Flora
3.4. Effects of Cd Exposure on Host Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhao, X.M.; Yao, L.A.; Ma, Q.L.; Zhou, G.J.; Wang, L.; Fang, Q.L.; Xu, Z.C. Distribution and ecological risk assessment of cadmium in water and sediment in Longjiang River, China: Implication on water quality management after pollution accident. Chemosphere 2018, 194, 107–116. [Google Scholar] [CrossRef] [PubMed]
- Hyder, O.; Chung, M.; Cosgrove, D.; Herman, J.M.; Li, Z.; Firoozmand, A.; Gurakar, A.; Koteish, A.; Pawlik, T.M. Cadmium exposure and liver disease among US adults. J. Gastrointest. Surg. 2013, 17, 1265–1273. [Google Scholar] [CrossRef]
- Ba, Q.; Li, M.; Chen, P.; Huang, C.; Duan, X.; Lu, L.; Li, J.; Chu, R.; Xie, D.; Song, H.; et al. Sex-Dependent Effects of Cadmium Exposure in Early Life on Gut Microbiota and Fat Accumulation in Mice. Environ. Health Perspect 2017, 125, 437–446. [Google Scholar] [CrossRef] [PubMed]
- Feng, W.; Guo, Z.; Xiao, X.; Peng, C.; Shi, L.; Ran, H.; Xu, W. Atmospheric deposition as a source of cadmium and lead to soil-rice system and associated risk assessment. Ecotoxicol. Environ. Saf. 2019, 180, 160–167. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Li, Y.; Liu, K.; Shen, J. Exposing to cadmium stress cause profound toxic effect on microbiota of the mice intestinal tract. PLoS ONE 2014, 9, e85323. [Google Scholar] [CrossRef]
- Du, X.; Lan, T.; Yuan, B.; Chen, J.; Hu, J.; Ren, W.; Chen, Z. Cadmium-induced microsatellite instability in the kidneys and leukocytes of C57BL/6J mice. Environ. Toxicol. 2015, 30, 683–692. [Google Scholar] [CrossRef]
- Xia, Y.; Zhu, J.; Xu, Y.; Zhang, H.; Zou, F.; Meng, X. Effects of ecologically relevant concentrations of cadmium on locomotor activity and microbiota in zebrafish. Chemosphere 2020, 257, 127220. [Google Scholar] [CrossRef]
- Doroszkiewicz, J.; Groblewska, M.; Mroczko, B. The Role of Gut Microbiota and Gut-Brain Interplay in Selected Diseases of the Central Nervous System. Int. J. Mol. Sci. 2021, 22, 10028. [Google Scholar] [CrossRef]
- Martin-Gallausiaux, C.; Marinelli, L.; Blottière, H.M.; Larraufie, P.; Lapaque, N. SCFA: Mechanisms and functional importance in the gut. Proc. Nutr. Soc. 2021, 80, 37–49. [Google Scholar] [CrossRef]
- Razazan, A.; Karunakar, P.; Mishra, S.P.; Sharma, S.; Miller, B.; Jain, S.; Yadav, H. Activation of Microbiota Sensing—Free Fatty Acid Receptor 2 Signaling Ameliorates Amyloid-β Induced Neurotoxicity by Modulating Proteolysis-Senescence Axis. Front. Aging. Neurosci. 2021, 13, 735933. [Google Scholar] [CrossRef]
- Kurisu, R.; Takai, M.; Takamoto, M.; Tsujiuchi, T. Effects of free fatty acid receptor-2 (FFAR2)-mediated signaling on the regulation of cellular functions in osteosarcoma cells. Biochem. Biophys. Res. Commun. 2023, 646, 56–62. [Google Scholar] [CrossRef] [PubMed]
- Bahuguna, A.; Bharadwaj, S.; Chauhan, A.K.; Kang, S.C. Inhibitory insights of strawberry (Fragaria × ananassa var. Seolhyang) root extract on tyrosinase activity using computational and in vitro analysis. Int. J. Biol. Macromol. 2020, 165, 2773–2788. [Google Scholar] [CrossRef]
- Duan, H.; Yu, L.; Tian, F.; Zhai, Q.; Fan, L.; Chen, W. Gut microbiota: A target for heavy metal toxicity and a probiotic protective strategy. Sci. Total Environ. 2020, 742, 140429. [Google Scholar] [CrossRef]
- He, X.; Qi, Z.; Hou, H.; Qian, L.; Gao, J.; Zhang, X.X. Structural and functional alterations of gut microbiome in mice induced by chronic cadmium exposure. Chemosphere 2020, 246, 125747. [Google Scholar] [CrossRef] [PubMed]
- Marizzoni, M.; Cattaneo, A.; Mirabelli, P.; Festari, C.; Lopizzo, N.; Nicolosi, V.; Mombelli, E.; Mazzelli, M.; Luongo, D.; Naviglio, D.; et al. Short-Chain Fatty Acids and Lipopolysaccharide as Mediators between Gut Dysbiosis and Amyloid Pathology in Alzheimer’s Disease. J. Alzheimers Dis. 2020, 78, 683–697. [Google Scholar] [CrossRef]
- Colombo, A.V.; Sadler, R.K.; Llovera, G.; Singh, V.; Roth, S.; Heindl, S.; Sebastian Monasor, L.; Verhoeven, A.; Peters, F.; Parhizkar, S.; et al. Microbiota-derived short chain fatty acids modulate microglia and promote Aβ plaque deposition. Elife 2021, 10, e59826. [Google Scholar] [CrossRef]
- Tarawneh, R.; Penhos, E. The gut microbiome and Alzheimer’s disease: Complex and bidirectional interactions. Neurosci. Biobehav. Rev. 2022, 141, 104814. [Google Scholar] [CrossRef]
- Giridharan, V.V.; Barichello De Quevedo, C.E.; Petronilho, F. Microbiota-gut-brain axis in the Alzheimer’s disease pathology—An overview. Neurosci. Res. 2022, 181, 17–21. [Google Scholar] [CrossRef]
- Wiatrak, B.; Balon, K.; Jawień, P.; Bednarz, D.; Jęśkowiak, I.; Szeląg, A. The Role of the Microbiota-Gut-Brain Axis in the Development of Alzheimer’s Disease. Int. J. Mol. Sci. 2022, 23, 4862. [Google Scholar] [CrossRef]
- Liu, Y.; Li, Y.; Xia, Y.; Liu, K.; Ren, L.; Ji, Y. The Dysbiosis of Gut Microbiota Caused by Low-Dose Cadmium Aggravate the Injury of Mice Liver through Increasing Intestinal Permeability. Microorganisms 2020, 8, 211. [Google Scholar] [CrossRef]
- Lu, K.; Abo, R.P.; Schlieper, K.A.; Graffam, M.E.; Levine, S.; Wishnok, J.S.; Swenberg, J.A.; Tannenbaum, S.R.; Fox, J.G. Arsenic exposure perturbs the gut microbiome and its metabolic profile in mice: An integrated metagenomics and metabolomics analysis. Environ. Health Perspect. 2014, 122, 284–291. [Google Scholar] [CrossRef]
- Chatterjee, M.; Kortenkamp, A. Cadmium exposures and deteriorations of cognitive abilities: Estimation of a reference dose for mixture risk assessments based on a systematic review and confidence rating. Environ. Health 2022, 21, 69. [Google Scholar] [CrossRef] [PubMed]
- Michels, N.; Van de Wiele, T.; De Henauw, S. Chronic Psychosocial Stress and Gut Health in Children: Associations with Calprotectin and Fecal Short-Chain Fatty Acids. Psychosom. Med. 2017, 79, 927–935. [Google Scholar] [CrossRef]
- Yang, J.; Zheng, P.; Li, Y.; Wu, J.; Tan, X.; Zhou, J.; Sun, Z.; Chen, X.; Zhang, G.; Zhang, H.; et al. Landscapes of bacterial and metabolic signatures and their interaction in major depressive disorders. Sci. Adv. 2020, 6, eaba8555. [Google Scholar] [CrossRef] [PubMed]
- Petrov, V.A.; Saltykova, I.V.; Zhukova, I.A.; Alifirova, V.M.; Zhukova, N.G.; Dorofeeva, Y.B.; Tyakht, A.V.; Kovarsky, B.A.; Alekseev, D.G.; Kostryukova, E.S.; et al. Analysis of Gut Microbiota in Patients with Parkinson’s Disease. Bull Exp. Biol. Med. 2017, 162, 734–737. [Google Scholar] [CrossRef]
- Castro-Nallar, E.; Bendall, M.L.; Pérez-Losada, M.; Sabuncyan, S.; Severance, E.G.; Dickerson, F.B.; Schroeder, J.R.; Yolken, R.H.; Crandall, K.A. Composition, taxonomy and functional diversity of the oropharynx microbiome in individuals with schizophrenia and controls. PeerJ 2015, 3, e1140. [Google Scholar] [CrossRef]
- Yolken, R.H.; Severance, E.G.; Sabunciyan, S.; Gressitt, K.L.; Chen, O.; Stallings, C.; Origoni, A.; Katsafanas, E.; Schweinfurth, L.A.; Savage, C.L.; et al. Metagenomic Sequencing Indicates That the Oropharyngeal Phageome of Individuals with Schizophrenia Differs from That of Controls. Schizophr. Bull. 2015, 41, 1153–1161. [Google Scholar] [CrossRef]
- Shen, Y.; Xu, J.; Li, Z.; Huang, Y.; Yuan, Y.; Wang, J.; Zhang, M.; Hu, S.; Liang, Y. Analysis of gut microbiota diversity and auxiliary diagnosis as a biomarker in patients with schizophrenia: A cross-sectional study. Schizophr. Res. 2018, 197, 470–477. [Google Scholar] [CrossRef] [PubMed]
- Louis, P.; Hold, G.L.; Flint, H.J. The gut microbiota, bacterial metabolites and colorectal cancer. Nat. Rev. Microbiol. 2014, 12, 661–672. [Google Scholar] [CrossRef]
- Li, Z.; Lai, J.; Zhang, P.; Ding, J.; Jiang, J.; Liu, C.; Huang, H.; Zhen, H.; Xi, C.; Sun, Y.; et al. Multi-omics analyses of serum metabolome, gut microbiome and brain function reveal dysregulated microbiota-gut-brain axis in bipolar depression. Mol. Psychiatry 2022, 27, 4123–4135. [Google Scholar] [CrossRef]
- Soltysova, M.; Tomova, A.; Ostatnikova, D. Gut Microbiota Profiles in Children and Adolescents with Psychiatric Disorders. Microorganisms 2022, 10, 2009. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Chiu, A.T.G.; Li, V.W.Y.; Zhang, X.; Yeung, W.L.; Chan, S.H.S.; Tun, H.M. The role of the gut-microbiome-brain axis in metabolic remodeling amongst children with cerebral palsy and epilepsy. Front. Neurol. 2023, 14, 1109469. [Google Scholar] [CrossRef]
- Scarmeas, N.; Stern, Y.; Mayeux, R.; Manly, J.J.; Schupf, N.; Luchsinger, J.A. Mediterranean diet and mild cognitive impairment. Arch. Neurol. 2009, 66, 216–225. [Google Scholar] [CrossRef] [PubMed]
- McEvoy, C.T.; Guyer, H.; Langa, K.M.; Yaffe, K. Neuroprotective Diets Are Associated with Better Cognitive Function: The Health and Retirement Study. J. Am. Geriatr. Soc. 2017, 65, 1857–1862. [Google Scholar] [CrossRef] [PubMed]
- Gardener, S.; Gu, Y.; Rainey-Smith, S.R.; Keogh, J.B.; Clifton, P.M.; Mathieson, S.L.; Taddei, K.; Mondal, A.; Ward, V.K.; Scarmeas, N.; et al. Adherence to a Mediterranean diet and Alzheimer’s disease risk in an Australian population. Transl. Psychiatry 2012, 2, e164. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Xu, J.; Wang, H.; Luo, J.; Wang, Z.; Chen, G.; Jiang, D.; Cao, R.; Huang, H.; Luo, D.; et al. Profiling the differences of gut microbial structure between schizophrenia patients with and without violent behaviors based on 16S rRNA gene sequencing. Int. J. Legal. Med. 2021, 135, 131–141. [Google Scholar] [CrossRef]
- Dragano, N.R.V.; Solon, C.; Ramalho, A.F.; de Moura, R.F.; Razolli, D.S.; Christiansen, E.; Azevedo, C.; Ulven, T.; Velloso, L.A. Polyunsaturated fatty acid receptors, GPR40 and GPR120, are expressed in the hypothalamus and control energy homeostasis and inflammation. J. Neuroinflammation 2017, 14, 91. [Google Scholar] [CrossRef]
- Falomir-Lockhart, L.J.; Cavazzutti, G.F.; Giménez, E.; Toscani, A.M. Fatty Acid Signaling Mechanisms in Neural Cells: Fatty Acid Receptors. Front. Cell. Neurosci. 2019, 13, 162. [Google Scholar] [CrossRef]
- Fujii, Y.; Nguyen, T.T.T.; Fujimura, Y.; Kameya, N.; Nakamura, S.; Arakawa, K.; Morita, H. Fecal metabolite of a gnotobiotic mouse transplanted with gut microbiota from a patient with Alzheimer’s disease. Biosci. Biotechnol. Biochem. 2019, 83, 2144–2152. [Google Scholar] [CrossRef]
- Schmidt, J.; Smith, N.J.; Christiansen, E.; Tikhonova, I.G.; Grundmann, M.; Hudson, B.D.; Ward, R.J.; Drewke, C.; Milligan, G.; Kostenis, E.; et al. Selective orthosteric free fatty acid receptor 2 (FFA2) agonists: Identification of the structural and chemical requirements for selective activation of FFA2 versus FFA3. J. Biol. Chem. 2011, 286, 10628–10640. [Google Scholar] [CrossRef]
- Jonsson, T.; Stefansson, H.; Steinberg, S.; Jonsdottir, I.; Jonsson, P.V.; Snaedal, J.; Bjornsson, S.; Huttenlocher, J.; Levey, A.I.; Lah, J.J.; et al. Variant of TREM2 associated with the risk of Alzheimer’s disease. N. Engl. J. Med. 2013, 368, 107–116. [Google Scholar] [CrossRef]
- Singh, S.K.; Srivastav, S.; Yadav, A.K.; Srikrishna, S.; Perry, G. Overview of Alzheimer’s Disease and Some Therapeutic Approaches Targeting Aβ by Using Several Synthetic and Herbal Compounds. Oxid. Med. Cell. Longev. 2016, 2016, 7361613. [Google Scholar] [CrossRef] [PubMed]
- Kuboyama, T.; Yang, X.; Tohda, C. Natural Medicines and Their Underlying Mechanisms of Prevention and Recovery from Amyloid Β-Induced Axonal Degeneration in Alzheimer’s Disease. Int. J. Mol. Sci. 2020, 21, 4665. [Google Scholar] [CrossRef] [PubMed]
- Nagpal, R.; Shively, C.A.; Register, T.C.; Craft, S.; Yadav, H. Gut microbiome-Mediterranean diet interactions in improving host health. F1000Research 2019, 8, 699. [Google Scholar] [CrossRef] [PubMed]
- Nagpal, R.; Neth, B.J.; Wang, S.; Mishra, S.P.; Craft, S.; Yadav, H. Gut mycobiome and its interaction with diet, gut bacteria and alzheimer’s disease markers in subjects with mild cognitive impairment: A pilot study. EBioMedicine 2020, 59, 102950. [Google Scholar] [CrossRef] [PubMed]
- Doifode, T.; Giridharan, V.V.; Generoso, J.S.; Bhatti, G.; Collodel, A.; Schulz, P.E.; Forlenza, O.V.; Barichello, T. The impact of the microbiota-gut-brain axis on Alzheimer’s disease pathophysiology. Pharmacol. Res. 2021, 164, 105314. [Google Scholar] [CrossRef]
- Sun, J.; Xu, J.; Ling, Y.; Wang, F.; Gong, T.; Yang, C.; Ye, S.; Ye, K.; Wei, D.; Song, Z.; et al. Fecal microbiota transplantation alleviated Alzheimer’s disease-like pathogenesis in APP/PS1 transgenic mice. Transl. Psychiatry 2019, 9, 189. [Google Scholar] [CrossRef]
- Mishra, S.P.; Karunakar, P.; Taraphder, S.; Yadav, H. Free Fatty Acid Receptors 2 and 3 as Microbial Metabolite Sensors to Shape Host Health: Pharmacophysiological View. Biomedicines 2020, 8, 154. [Google Scholar] [CrossRef]
- Wenzel, T.J.; Gates, E.J.; Ranger, A.L.; Klegeris, A. Short-chain fatty acids (SCFAs) alone or in combination regulate select immune functions of microglia-like cells. Mol. Cell. Neurosci. 2020, 105, 103493. [Google Scholar] [CrossRef]
- Kim, M.S.; Kim, Y.; Choi, H.; Kim, W.; Park, S.; Lee, D.; Kim, D.K.; Kim, H.J.; Choi, H.; Hyun, D.W.; et al. Transfer of a healthy microbiota reduces amyloid and tau pathology in an Alzheimer’s disease animal model. Gut 2020, 69, 283–294. [Google Scholar] [CrossRef]
- Human Proten Atlas. Available online: http://www.proteinatlas.org (accessed on 11 March 2022).
- ALLEN BRAIN MAP 2021. Available online: https://portal.brain-map.org/ (accessed on 25 May 2022).
Gene | Primer (5′-3′) | Accnumber | GeneID | |
---|---|---|---|---|
ffar2 | Forward | cgtcgcatttccaatccgat | NM_001082895.1 | 794045 |
Reverse | tcacatggggattgagctgt | |||
Gadph | Forward | tctgacagtccgtcttgagaaa | NM_001115114.1 | 317741 |
Reverse | acaaagtgatcgttgagagaa |
Average Concentration of Control Group (nmol/g) | Mean Concentration of Cd Group (nmol/g) | p | |
---|---|---|---|
Acetic acid | 51.8441 | 39.9531 | 0.09707 |
Isobutyric acid | 0.04946 | 0.1141 | 0.03857 |
Isovaleric acid | 0.03867 | 0.05075 | 0.3159 |
Valeric acid | 0.09402 | 0.06351 | 0.4989 |
Hexanoic acid | 0.5436 | 0.4975 | 0.7149 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, J.; Li, J.; Zhang, X.; Zhou, Q.; Wang, J.; Chen, Q.; Meng, X.; Xia, Y. Effects of Ecologically Relevant Concentrations of Cadmium on the Microbiota, Short-Chain Fatty Acids, and FFAR2 Expression in Zebrafish. Metabolites 2023, 13, 657. https://doi.org/10.3390/metabo13050657
Yang J, Li J, Zhang X, Zhou Q, Wang J, Chen Q, Meng X, Xia Y. Effects of Ecologically Relevant Concentrations of Cadmium on the Microbiota, Short-Chain Fatty Acids, and FFAR2 Expression in Zebrafish. Metabolites. 2023; 13(5):657. https://doi.org/10.3390/metabo13050657
Chicago/Turabian StyleYang, Jian, Junyi Li, Xiaoshun Zhang, Qin Zhou, Junyi Wang, Qingsong Chen, Xiaojing Meng, and Yuan Xia. 2023. "Effects of Ecologically Relevant Concentrations of Cadmium on the Microbiota, Short-Chain Fatty Acids, and FFAR2 Expression in Zebrafish" Metabolites 13, no. 5: 657. https://doi.org/10.3390/metabo13050657