In Vitro Activity of Sulbactam–Durlobactam against Carbapenem-Resistant Acinetobacter baumannii Clinical Isolates: A Multicentre Report from Italy
by
, , , , and
Bernardetta Segatore
1, 
Alessandra Piccirilli
1,
Sabrina Cherubini
1,
Luigi Principe
2,*,
Giovanni Alloggia
1,
Maria Lina Mezzatesta
3,
Mario Salmeri
3,
Stefano Di Bella
4
,
Roberta Migliavacca
5,
Aurora Piazza
5,
Elisa Meroni
6,
Paolo Fazii
7,
Daniela Visaggio
8,9,
Paolo Visca
8,9,
Venere Cortazzo
10,
Giulia De Angelis
10,
Arianna Pompilio
11,12 and
Mariagrazia Perilli
1 1
Department of Biotechnological and Applied Clinical Sciences, University of L’Aquila, 67100 L’Aquila, Italy
2
Clinical Pathology and Microbiology Unit, “S. Giovanni di Dio” Hospital, 88900 Crotone, Italy
3
Department of Biomedical and Biotechnological Sciences, Section of Microbiology, University of Catania, 95131 Catania, Italy
4
Clinical Department of Medical, Surgical and Health Sciences, University of Trieste, 34129 Trieste, Italy
5
Unit of Microbiology and Clinical Microbiology, Department of Clinical-Surgical, Diagnostic and Pediatric Sciences, University of Pavia, 27100 Pavia, Italy
6
Clinical Microbiology and Virology Unit, “A. Manzoni” Hospital, 23900 Lecco, Italy
7
Clinical Microbiology and Virology Unit, Spirito Santo Hospital, 65122 Pescara, Italy
8
Department of Science, Roma Tre University, Viale G. Marconi 446, 00146 Rome, Italy
9
Santa Lucia Foundation IRCCS, 00179 Rome, Italy
10
Dipartimento di Scienze Biotecnologiche di Base, Cliniche Intensivologiche e Perioperatorie, Università Cattolica del Sacro Cuore, 00168 Rome, Italy
11
Department of Medical, Oral and Biotechnological Sciences, “G. d’Annunzio” University of Chieti-Pescara, 66100 Chieti, Italy
12
Center of Advanced Studies and Technology (CAST), “G. d’Annunzio” University of Chieti-Pescara, 66100 Chieti, Italy
*
Author to whom correspondence should be addressed.
Antibiotics 2022, 11(8), 1136; https://doi.org/10.3390/antibiotics11081136
Submission received: 2 August 2022
/
Revised: 18 August 2022
/
Accepted: 19 August 2022
/
Published: 22 August 2022
(This article belongs to the Special Issue Antibiotic Resistance of Acinetobacter baumannii)
Abstract
:In the present study, the in vitro activity of the sulbactam–durlobactam (SUL–DUR) combination was evaluated against 141 carbapenem-resistant A. baumannii (CRAb) clinical strains collected from six Italian laboratories. Over half (54.6%) of these isolates were resistant to colistin. The SUL–DUR combination was active against these CRAb isolates with MIC50 and MIC90 values of 0.5 mg/L and 4 mg/L, respectively. Only eleven isolates were resistant to SUL–DUR with MIC values ranging from 8 to 128 mg/L. The SUL–DUR resistant A. baumannii exhibited several antimicrobial resistance genes (ARGs) such as blaOXA-20, blaOXA-58, blaOXA-66, blaADC-25, aac(6′)-Ib3 and aac(6′)-Ib-cr and mutations in gyrA (S81L) and parC (V104I, D105E). However, in these isolates, mutations Q488K and Y528H were found in PBP3. Different determinants were also identified in these CRAb isolates, including adeABC, adeFGH, adeIJK, abeS, abaQ and abaR, which encode multidrug efflux pumps associated with resistance to multiple antibacterial agents. This is the first report on the antimicrobial activity of SUL–DUR against carbapenem-resistant A. baumannii isolates selected from multiple regions in Italy.
1. Introduction
Acinetobacter baumannii has emerged in the last two decades as one of the major causes of nosocomial infections associated with significant morbidity and mortality and it has been recognized by World Health Organization (WHO) as a “critical priority pathogen” (www.who.int, accesssed on 2 August 2022) [1,2]. A. baumannii is ubiquitous and can be found in various environmental sources including soil, water, vegetables, meat and fish [3,4]. In hospital settings, especially in intensive care units, A. baumannii can cause ventilator-associated pneumonia and bloodstream infections [5,6,7,8]. The success of this organism is attributed to its ability to survive long-term in hospital environments and its prodigious capacity to acquire new antimicrobial resistance determinants [9]. The mechanisms of resistance in A. baumannii include enzymatic inactivation by β-lactamases, modification of target sites (e.g., Penicillin Binding Proteins, PBPs), alterations of porin proteins that result in decreased permeability and the upregulation of the activity of multidrug efflux pumps [9]. Currently, carbapenem-resistant A. baumannii (CRAb) pose a global threat to human health. CRAb is emerging worldwide, and the majority of these isolates show multidrug-resistant (MDR), extensively drug-resistant (XDR) and pandrug-resistant (PDR) phenotypes [10,11,12,13]. Currently, few therapeutic options are available for CRAb treatment [14,15]. Generally, colistin (CST), tigecycline and aminoglycosides are used against MDR A. baumannii, although there are limitations due to toxicity and poor pharmacokinetic properties [16]. CST has been successfully used to treat pneumoni and, bloodstream and meningitis infections caused by CRAb [17,18]. However, colistin-resistant isolates are emerging worldwide [19]. The intravenous fosfomycin is also used in combination with colistin or tigecycline or aminoglycoside for the treatment of hospital-acquired pneumonia caused by CRAb [20]. Cefiderocol, a novel siderophore cephalosporin, has recently been approved for the treatment of MDR A. baumannii [21]. Durlobactam (DUR), previously called ETX2514, is a non-β-lactam diazabicyclooctane (DBO) inhibitor with activity against Ambler class A, C and D β-lactamases [22,23]. Recently, some studies have shown that sulbactam in combination with durlobactam is active against MDR A. baumannii [24,25,26,27,28,29,30,31]. Sulbactam (SUL) is one of the first β-lactamase inhibitors used in combination with ampicillin for the treatment of class A β-lactamase-producing pathogens. In A. baumannii, SUL also has antibacterial activity by targeting PBPs (i.e., PBP1a/b and PBP3), enzymes required for cell wall synthesis [32]. DUR inactivates serine-β-lactamases by forming a reversible covalent bond with the active site serine [33]. This potent activity of durlobactam allows the susceptibility of CRAb to sulbactam to be restored [22,27]. The aim of the present study was to examine the in vitro activity of sulbactam–durlobactam (SUL–DUR) against 141 CRAb clinical isolates retrospectively collected from six clinical microbiology laboratories located across the national territories representative of northern, central and southern Italy.
2. Results
2.1. Antimicrobial Susceptibility
Antimicrobial susceptibility of CRAb isolates was previously assessed by each center using commercial systems in the context of normal clinical routine. Consistently, the associated traits were as follows: imipenem and meropenem, MICs > 8 mg/L; gentamicin, MICs > 8 mg/L; ciprofloxacin, MICs > 2 mg/L and SXT, MICs > 8 mg/L (based on trimethoprim concentration). Overall, 64 CRAb isolates were XDR (MIC values for colistin ≤ 2 mg/L), while 77 CRAb isolates showed a PDR phenotype (MIC values for colistin > 2 mg/L).
The in vitro activity of SUL–DUR was evaluated for 141 CRAb clinical isolates using SUL, DUR and CST as comparators. Overall, 77 out 141 (54.6%) A. baumannii isolates exhibited resistance to CST with Minimal Inhibitory Concentration (MIC) values of ≥4 mg/L. The MIC50 and MIC90 for CST were 4 mg/L and >4 mg/L, respectively (Table 1). As shown in Table 1, 131 out of 141 CRAb isolates exhibited MICs > 4 mg/L for SUL and the MIC50 and MIC90 values were 16 mg/L and 128 mg/L, respectively. DUR had MIC50 and MIC90 values of 64 mg/L and 128 mg/L, respectively. The SUL–DUR combination was more potent against these CRAb isolates with MIC50 and MIC90 values of 0.5 mg/L and 4 mg/L, respectively. Only eleven isolates exhibited MIC values > 4 mg/L, the preliminary susceptible breakpoint for SUL–DUR (Table 1) [34,35]. All of the SUL–DUR resistant CRAb isolates were from the Clinical Microbiology Laboratory of Catania University located in southern Italy (Table 2).
2.2. Whole-Genome Sequencing of SUL–DUR Resistant A. baumannii: Resistome and Virulome Characterization
Whole-genome sequencing of the eleven SUL–DUR resistant CRAb isolates was performed and these isolates were found to encode several antibiotic resistance genes (ARGs) (Table 3) and virulence-associated genes (VAGs) (Table 4). Among the eleven analyzed strains, all encoded for the class D β-lactamases OXA-20, OXA-58 and OXA-66, in addition to ADC-25, a chromosomally encoded class C β-lactamase. While the presence of these β-lactamases most likely confer resistance to β-lactam antibiotics such as carbapenems, durlobactam has been shown to effectively inhibit these enzymes, so are not a likely cause of the elevated SUL–DUR MICs. Genes that confer resistance to other classes of antibiotics were also detected including aminoglycoside resistance (aac(6′)-Ib3 and aac(6′)-Ib-cr) and fluoroquinolone resistance (mutations in gyrA (S81L) and parC (V104I, D105E) (Table 2). The Insertion Sequence (IS) IS26 and ISAba125 were also identified in all eleven CRAb, and the transposon Tn6018 was found in two isolates (CT24 and CT58). All of the SUL–DUR-resistant CRAb showed the same profile of virulence factors (Table 4); however, isolates CT57 and CT58 possessed, in addition, lpsB and lpx VAGs which confer resistance to CST. The eleven CRAb isolates showed the presence of AdeABC, AdeFGH, AdeIJK, abeS, abaQ and abaR multidrug efflux pumps. As shown in Table 4, several genes involved in the biofilm formation system were also identified. Resistance mediated by quorum sensing is represented by abaI and abaR genes. The pbpG, also known as PBP7, was also identified in all SUL–DUR-resistant CRAb (Table 4). The impact of these genes on SUL–DUR susceptibility is not known.
2.3. Molecular Analysis of PBP-3 Gene
The amplification of the PBP-3 gene of the eleven SUL–DUR-resistant A. baumannii isolates gave an amplicon of about 1800 bp which was entirely sequenced. In all A. baumannii analyzed, the PBP3 showed the following amino acid substitutions: Q488K and Y528H.
3. Discussion
The production of carbapenem-hydrolysing β-lactamases is one of the most common mechanisms responsible for carbapenem resistance in A. baumannii [10]. Several carbapenemases have been identified in A. baumannii, in particular, serine β-lactamases, belonging to class D and metallo-β-lactamases (class B enzymes). Nevertheless, metallo-β-lactamases are very rare in this microorganism [10]. However, in addition to β-lactamases, other mechanisms of resistance to carbapenems, including overexpression of efflux pumps, the reduction or inactivation of the expression of porins and the modification in the expression or synthesis of new PBPs, are found in A. baumannii isolates [10]. In the 141 A. baumannii analyzed in the present study, class C and D β-lactamases such as OXA-23, OXA-58, OXA-66 (OXA-51-like enzyme), OXA-82 (OXA-51-like enzyme) and ADC-25 were previously identified [36,37,38,39,40,41,42,43,44,45,46,47]. The blaOXA-types are, usually, flanked by one or two copies of the insertion sequences (i.e., ISAba1, ISAba125) which are located in opposite orientations. These ISAba insertion sequences enhance the expression of blaOXA genes and they give genetic plasticity to A. baumannii species [48]. Herein, we have demonstrated potent in vitro activity of the SUL–DUR combination against 92% of the CRAb clinical isolates collected from a range of geographical regions within Italy. Of note, SUL–DUR demonstrated antimicrobial activity against both OXA-23- and OXA-58-producing isolates. Moreover, all but two of the colistin-resistant isolates (more than 50% of total isolates) were susceptible to the SUL–DUR combination. Eleven isolates (all from the Microbiology Clinical Laboratory of Catania University) were resistant to SUL–DUR, with most of them belonging to ST2 (n = 8) and showing a MIC range of 8–>128 mg/L. Two of these isolates were also resistant to CST. The whole genome analysis of the eleven SUL–DUR-resistant CRAb showed the presence of several ARGs, including blaOXA-20 (blaOXA-58 like gene), blaOXA-58, blaADC-25, aac(6′)Ib-cr, aac(6′)-Ib3, and tetA(41), a tetracycline efflux pump protein closely related to Tet(39) often found in Acinetobacter spp. [49]. Multiple VAGs were also found in these isolates. The multidrug efflux systems (RND, SMR, MFS families) are associated with multiple resistance mechanisms which are capable of extruding a broad range of structurally unrelated compounds [50,51,52]. The contribution of these ARGs and VAGs to the SUL–DUR-resistant phenotype seen in these isolates is not known. However, in the eleven SUL–DUR-resistant A. baumannii we found Q488K and Y528H mutations in PBP3. To date, reports of SUL–DUR resistance have been rare and resistance is usually attributed to the presence of metallo-β-lactamases, which DUR does not inhibit, or to mutations near the active site of PBP3, the target of sulbactam [24,25,26]. Few therapeutic choices are available to treat CRAb isolates [14,16,53]. CRAb pneumonia is a major clinical issue with unmet therapeutic needs; in fact, both colistin and tigecycline did not reach a satisfactory epithelial lining fluid concentration and cefiderocol showed disappointing clinical outcomes [54]. DUR displayed an acceptable ratio of epithelial lining fluid to plasma concentrations of 0.37 while SUL reached a 0.5 ratio [34,55]. Another important clinical issue to consider is that the SUL–DUR combination is expected to have a lower degree of nephrotoxicity compared to CST (ATTACK Trial. Available online: https://investors.entasistx.com/news-releases/news-release-details/entasis-therapeutics-announces-positive-topline-results, accessed on 2 August 2022), and in general be more safe. Taking into account the significant MIC reduction reached upon adding DUR to SUL and the promising clinical data from the phase 3 clinical trial comparing the safety and efficacy of SUL–DUR to CST for the treatment of infections caused by CRAb (SUL–DUR mortality 19%, CST mortality 32%, 95% CI: −30.0, 3.5), if approved, SUL–DUR may be an important option for CRAb treatment regimens. Further studies are needed to elucidate the molecular mechanisms responsible for resistance to SUL-DUR and to explore its therapeutic potential. It will also be necessary to combine in vitro findings with additional pharmacokinetic and pharmacodynamic data in order to provide more meaningful predictions of the in vivo efficacy of SUL-DUR combination in clinical practice.
4. Materials and Methods
4.1. Antibiotics and Inhibitors
SUL and DUR (ETX2514) were kindly provided by Dr. Alita A. Miller, Entasis Therapeutics, Waltham, MA, USA.
4.2. Bacterial Strains Selection
A total of 141 non duplicate CRAb strains, which were previously characterized for their mechanisms of resistance, were included in this study [36,37,38,39,40,41,42,43,44,45,46,47]. In particular, we retrospectively selected 64 XDR and 77 PDR previously characterized CRAb clinical isolates collected in six centers from Italy. Isolates were selected on the basis of this extensive resistance although resistance determinants were different (mostly including OXA-type enzymes, as reported in related publications). Most of the isolates (121 out of 141) were collected from five clinical microbiology laboratories distributed throughout northern, central and southern Italy. Specifically, 16 A. baumannii were collected from the Microbiology Laboratory of the University of Pavia (Northern Italy) during 2018, 26 isolates were collected from the teaching “Gemelli” Hospital Rome (central Italy) between 2020 and 2022, 8 isolates were collected from Spirito Santo Hospital Pescara (Central Italy) in 2020–2021, 1 isolate was from the University of L’Aquila (Central Italy) and 70 isolates were collected from the Clinical Microbiology Laboratory of the University of Catania (Southern Italy) between 2008 and 2018. In addition, 20 A. baumannii were kindly given by Professor Visca, Clinical Microbiology Laboratory of Roma Tre University (Central Italy). These strains were collected in 2004–2014 from different countries during the project “Carbapenem-resistant Acinetobacter baumannii: whole-genomic and phenomic investigation of the traits that favored the predominance and shift to OXA-23-producing IC2 isolates”; funded by ESCMID in 2017. The antimicrobial susceptibility of CRAb isolates was previously assessed by participating centers using commercial systems in the context of normal clinical routine. Tested antibiotics were imipenem, meropenem, gentamicin, ciprofloxacin and colistin. All strains were collected from different wards including intensive care units, infectious diseases units, neurosurgery, pneumology, thoracic surgery and internal medicine. All A. baumannii were isolated from clinical sources, including sputum, blood, urine, wounds, peritoneal fluid, liquor and stool. The A. baumannii isolates belonged to the following sequence types: ST2 (n = 121), ST1 (n = 6), ST4 (n = 1), ST20 (n = 5), ST78 (n = 2), ST81 (n = 1), ST95 (n = 1), ST109 (n = 1), ST196 (n = 1) and ST197 (n = 1). In these A. baumannii strains, the carbapenem resistance was mainly mediated by the presence of OXA-23 (80 isolates), OXA-58 (48 isolates), OXA-66 (4 isolates) and OXA-82 (4 isolates). The simultaneous presence of OXA-23 and OXA-58 was found in 11 isolates and, in addition, ADC-25, a chromosomal AmpC enzyme, was also identified [36,37,38,39,40,41,42,43,44,45,46,47].
MDR isolates were defined as those with acquired non-susceptibility to at least one agent in three or more antimicrobial categories. XDR isolates were defined as those with acquired non-susceptibility to all antibiotics, except for one or two. PDR isolates were defined as those with acquired non-susceptibility to all antibiotics.
4.3. Bacterial Strains Identification
A. baumannii isolates were collected by standard methods, followed by isolation in pure culture on MacConkey agar plates, identified by the Vitek 2 system (bioMerieux, Marcy l’Etoile, France) and stored in Brain Hearth Infusion broth with 15% glycerol and frozen at −80 °C.
4.4. MIC Determination
The MIC experiments were performed by conventional broth microdilution procedures in Mueller Hinton broth supplemented with calcium and magnesium to physiological concentrations (CAMHB), using an inoculum of 5 × 105 CFU/mL according to the Clinical and Laboratory Standards Institute (CLSI) [56]. One hundred and forty-one non-duplicate A. baumannii isolates were tested against DUR alone as well as SUL alone, plus SUL–DUR and CST. For SUL, a susceptibility breakpoint of 4 mg/L was used, based on the CLSI ampicillin–sulbactam susceptible breakpoint of 8/4 mg/L for Acinetobacter spp [56]. SUL–DUR MICs were performed as 2-fold dilutions of SUL with DUR at a fixed concentration of 4 mg/L [56]. MICs were interpreted using CLSI breakpoints where available. Concurrent quality control (QC) procedures were performed by testing Escherichia coli ATCC 25922, examined for each MIC run. Following 18 to 20 h of aerobic incubation at 37 °C, the microplates were examined for growth. The determination of all MICs was performed in three separate sets of experiments.
4.5. Whole-Genome Sequencing
Total nucleic acid was extracted using MagMax Microbiome Ultra Nucleic Acid Isolation kit (Applied Biosystems and ThermoFisher Scientific, Monza, Italy). Genomic libraries were prepared using Swift 2S Turbo DNA Library kit (Swift Biosciences, Ann Arbor, MI, USA) as previously reported [57,58]. WGS was performed on an Illumina MiSeq using v3 reagent kits generating 2 × 300 bp paired-end reads (Illumina, San Diego, CA, USA). DRAGEN FastQC + MultiQC v3.9.5 (https://basespace.illumina.com/apps/10562553/DRAGEN-FastQC-MultiQC, accessed on 24 May 2022) were used for quality control and sequences filtering. Paired-end reads were assembled with Velvet de novo Assembly v1.0.0 (https://basespace.illumina.com/apps/8556549/Velvet-de-novo-Assembly, accessed on 5 June 2022). Multi-Locus Sequence Typing (MLST) on assembled A. baumannii genomes was performed according to the Pasteur scheme. ResFinder4.1 and MobileElementFinder 1.0.3 were used to detect acquired antimicrobial resistance genes and mobile genetic elements, respectively. ResFinder and MobileElementFinder 1.0.3 databases were synchronized with databases from Center for Genomic Epidemiology (http://www.genomicepidemiology.org/, accessed on 10 June 2022). Virulence Factor Database (VFDB) was used for the detection of virulence genes (http://www.mgc.ac.cn/VFs/, accessed on 2 August 2022).
4.6. PBP-3 Amplification and Sequencing
The amplification of the PBP-3 gene was performed in PCR using the total genome of the SUL–DUR-resistant A. baumannii (CT20, CT24, CT25, CT26, CT29, CT30, CT31, CT32, CT57, CT58, CT68) and the following external primers: PBP-3_F 5′TTACCTGCGAATAGGATTTTCTG and PBP-3_R 5′ ATGTGGCGGTTTTATCTGCT. The amplicons obtained were purified and directly sequenced on both strands by using a BigDye Sequencing Reaction Kit and an ABI PRISM 3500 capillary automated sequencer (Applied Biosystem, Monza, Italy).
5. Conclusions
In the present study, SUL–DUR demonstrated good in vitro antimicrobial activity against XDR and PDR A. baumanni clinical isolates, collected from different regions across Italy. These data confirmed the results from recent studies showing good activity of the SUL–DUR combination against MDR, XDR and PDR A. baumannii [59]. To the best our knowledge, this study also represents the first report on SUL–DUR activity against a large number of carbapenem-resistant, and largely colistin-resistant, A. baumannii isolates from Italy.
Author Contributions
Conceptualization, B.S., A.P. (Alessandra Piccirilli), M.P. and L.P.; methodology, B.S., A.P. (Arianna Pompilio), G.A., M.S., R.M., A.P. (Aurora Piazza), E.M., D.V., V.C. and G.D.A.; investigation, B.S., A.P. (Alessandra Piccirilli), M.P., S.C. and A.P. (Arianna Pompilio); data curation, B.S., S.D.B., L.P., M.L.M. and M.P.; writing—original draft preparation, L.P., M.L.M., A.P. (Alessandra Piccirilli) and M.P.; writing—review and editing, L.P., M.L.M., A.P. (Alessandra Piccirilli), P.F., P.V. and M.P.; visualization, B.S., A.P. (Arianna Pompilio), G.A., M.S., R.M., A.P. (Aurora Piazza), E.M., D.V., V.C., L.P., M.L.M., A.P. (Alessandra Piccirilli) and G.D.A.; supervision, M.P. All authors have read and agreed to the published version of the manuscript.
Funding
This research received no external funding.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Acknowledgments
The authors wish to thank Anna Toso (Toronto Catholic District School Board, Toronto, Canada) for the language revision of the manuscript.
Conflicts of Interest
The authors declare no conflict of interest.
References
- World Health Organization. Global Priority List of Antibiotic-Resistant Bacteria to Guide Research, Discovery, and Development of New Antibiotics. Available online: http://www.who.int/medicines/publications/WHO-PPL-Short_Summary_25Feb-ET_NM_WHO.pdf?ua=1 (accessed on 1 August 2022).
- Mancuso, G.; Midiri, A.; Gerace, E.; Biondo, C. Bacterial antibiotic resistance: The most critical pathogens. Pathogens 2021, 10, 1310. [Google Scholar] [CrossRef] [PubMed]
- Carvalheira, A.; Silva, J.; Teixeira, P. Acinetobacter spp. in food and drinking water—A review. Food Microbiol. 2021, 95, 103675. [Google Scholar] [CrossRef] [PubMed]
- Kittinger, C.; Kirschner, A.; Lipp, M.; Baumert, R.; Mascher, F.; Farnleitner, A.H.; Zarfel, G.E. Antibiotic resistance of Acinetobacter spp. Isolates from the River Danube: Susceptibility stays high. Int. J. Environ. Res. Public Health 2017, 15, 52. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salehi, M.; Jafari, S.; Ghafouri, L.; Ardakani, H.M.; Abdollahi, A.; Beigmohammadi, M.T.; Manshadi, S.A.D.; Feizabadi, M.M.; Ramezani, M.; Abtahi, H.; et al. Ventilator-associated pneumonia: Multidrug resistant Acinetobacter vs. extended Sspectrum β-Lactamase-producing Klebsiella. J. Infect. Dev. Ctries. 2020, 14, 660–663. [Google Scholar] [CrossRef] [PubMed]
- Russo, A.; Gavaruzzi, F.; Ceccarelli, G.; Borrazzo, C.; Oliva, A.; Alessandri, F.; Magnanimi, E.; Pugliese, F.; Venditti, M. Multidrug-resistant Acinetobacter baumannii infections in COVID-19 patients hospitalized in intensive care unit. Infection 2022, 50, 83–92. [Google Scholar] [CrossRef]
- Andersen, C.T.; Langendorf, C.; Garba, S.; Sayinzonga-Makombe, N.; Mambula, C.; Mouniaman, I.; Hanson, K.E.; Grais, R.F.; Isanaka, S. Risk of community- and hospital-acquired bacteremia and profile of antibiotic resistance in children hospitalized with severe acute malnutrition in Niger. Int. J. Infect. Dis. 2022, 119, 163–171. [Google Scholar] [CrossRef]
- Manyahi, J.; Kibwana, U.; Mgimba, E.; Majigo, M. Multi-drug resistant bacteria predict mortality in bloodstream infection in a tertiary setting in Tanzania. PLoS ONE 2020, 15, e0220424. [Google Scholar] [CrossRef] [Green Version]
- Kyriakidis, I.; Vasileiou, E.; Pana, Z.D.; Tragiannidis, A. Acinetobacter baumannii antibiotic resistance mechanisms. Pathogens 2021, 10, 373. [Google Scholar] [CrossRef]
- Ramirez, M.S.; Bonomo, R.A.; Tolmasky, M.E. Carbapenemases: Transforming Acinetobacter baumannii into a yet more dangerous menace. Biomolecules 2020, 10, 720. [Google Scholar] [CrossRef]
- Nodari, C.S.; Cayô, R.; Streling, A.P.; Lei, F.; Wille, J.; Almeida, M.S.; de Paula, A.I.; Pignatari, A.C.C.; Seifert, H.; Higgins, P.G.; et al. Genomic analysis of carbapenem-resistant Acinetobacter baumannii isolates belonging to major endemic clones in South America. Front. Microbiol. 2020, 11, 584603. [Google Scholar] [CrossRef]
- Hammer, P.; Nguyen, N.H.; Nguyen, T.N.M.; Splettstoesser, W.D.; Makarewicz, O.; Neubauer, H.; Sprague, L.D.; Pletz, M.W. Phenotypic and WGS-derived antimicrobial resistance profiles of clinical and non-clinical Acinetobacter baumannii isolates from Germany and Vietnam. Int. J. Antimicrob. Agents 2020, 56, 106127. [Google Scholar]
- Zarrilli, R.; Bagattini, M.; Migliaccio, A.; Esposito, E.P.; Triassi, M. Molecular epidemiology of carbapenem-resistant Acinetobacter baumannii in Italy. Ann. Ig. 2021, 33, 401–409. [Google Scholar] [PubMed]
- Vrancianu, C.O.; Gheorghe, I.; Czobor, I.B.; Chifiriuc, M.C. Antibiotic resistance profiles, molecular mechanisms and innovative treatment strategies of Acinetobacter baumannii. Microorganisms 2020, 8, 935. [Google Scholar] [CrossRef] [PubMed]
- Tacconelli, E.; Carrara, E.; Savoldi, A.; Harbarth, S.; Mendelson, M.; Monnet, D.L.; Pulcini, C.; Kahlmeter, G.; Kluytmans, J.; Carmeli, Y.; et al. WHO Pathogens Priority List Working Group. Discovery, research, and development of new antibiotics: The WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis. 2018, 18, 318–327. [Google Scholar] [CrossRef]
- Asif, M.; Alvi, I.A.; Rehman, S.U. Insight into Acinetobacter baumannii: Pathogenesis, global resistance, mechanisms of resistance, treatment options, and alternative modalities. Infect. Drug Resist. 2018, 11, 1249–1260. [Google Scholar] [CrossRef] [Green Version]
- Bartal, C.; Rolston, K.V.I.; Nesher, L. Carbapenem-resistant Acinetobacter baumannii: Colonization, Infection and Current Treatment Options. Infect. Dis. Ther. 2022, 11, 683–694. [Google Scholar] [CrossRef]
- Garnacho-Montero, J.; Ortiz-Leyba, C.; Jiménez-Jiménez, F.J.; Barrero-Almodóvar, A.E.; García-Garmendia, J.L.; Bernabeu-Wittell, M.; Gallego-Lara, S.L.; Madrazo-Osuna, J. Treatment of multidrug-resistant Acinetobacter baumannii ventilator-associated pneumonia (VAP) with intravenous colistin: A comparison with imipenem-susceptible VAP. Clin. Infect. Dis. 2003, 36, 1111–1118. [Google Scholar] [CrossRef] [Green Version]
- Pormohammad, A.; Mehdinejadiani, K.; Gholizadeh, P.; Nasiri, M.J.; Mohtavinejad, N.; Dadashi, M.; Karimaei, S.; Safari, H.; Azimi, T. Global prevalence of colistin resistance in clinical isolates of Acinetobacter baumannii: A systematic review and meta-analysis. Microb. Pathog. 2020, 139, 103887. [Google Scholar] [CrossRef]
- Russo, A.; Bassetti, M.; Bellelli, V.; Bianchi, L.; Marincola Cattaneo, F.; Mazzocchetti, S.; Paciacconi, E.; Cottini, F.; Schiattarella, A.; Tufaro, G.; et al. Efficacy of a fosfomycin-containing regimen for treatment of severe pneumonia caused by multidrug-resistant Acinetobacter baumannii: A prospective, observational study. Infect. Dis. Ther. 2021, 10, 187–200. [Google Scholar] [CrossRef]
- Kazmierczak, K.M.; Tsuji, M.; Wise, M.G.; Hackel, M.; Yamano, Y.; Echols, R.; Sahm, D.F. In Vitro activity of cefiderocol, a siderophore cephalosporin, against a recent collection of clinically relevant carbapenem non-susceptible Gram-negative bacilli, including serine carbapenemase- and metallo-β-lactamase producing isolates (SIDERO-WT-2014). Int. J. Antimicrob. Agents 2019, 53, 177–184. [Google Scholar] [CrossRef]
- Barnes, M.D.; Kumar, V.; Bethel, C.R.; Moussa, S.H.; O’Donnell, J.; Rutter, J.D.; Good, C.E.; Hujer, K.M.; Hujer, A.M.; Marshall, S.H.; et al. Targeting multidrug-resistant Acinetobacter spp.: Sulbactam and the diazabicyclooctenone b-lactamase inhibitor ETX2514 as a novel therapeutic agent. mBio 2019, 10, e00159-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shapiro, A.B.; Gao, N. Interactions of the diazabicyclooctane serine β-lactamase inhibitor ETX1317 with target enzymes. ACS Infect. Dis. 2021, 7, 114–122. [Google Scholar] [CrossRef] [PubMed]
- Granata, G.; Taglietti, F.; Schiavone, F.; Petrosillo, N. Durlobactam in the treatment of multidrug-resistant Acinetobacter baumannii infections: A systematic review. J. Clin. Med. 2022, 11, 3258. [Google Scholar] [CrossRef] [PubMed]
- Petropoulou, D.; Siopi, M.; Vourli, S.; Pournaras, S. Activity of sulbactam-durlobactam and comparators against a national collection of carbapenem-resistant Acinetobacter baumannii isolates from Greece. Front. Cell. Infect. Microbiol. 2022, 11, 814530. [Google Scholar] [CrossRef]
- Findlay, J.; Poirel, L.; Bouvier, M.; Nordmann, P. In-Vitro activity of sulbactam-durlobactam against carbapenem-resistant Acinetobacter baumannii and mechanisms of resistance. J. Glob. Antimicrob. Resist. 2022, 9, 32. [Google Scholar] [CrossRef]
- Durand-Réville, T.F.; Guler, S.; Comita-Prevoir, J.; Chen, B.; Bifulco, N.; Huynh, H.; Lahiri, S.; Shapiro, A.B.; McLeod, S.M.; Carter, N.M.; et al. ETX2514 is a broad-spectrum β-lactamase inhibitor for the treatment of drug-resistant Gram-negative bacteria including Acinetobacter baumannii. Nat. Microbiol. 2017, 2, 17104. [Google Scholar] [CrossRef]
- McLeod, S.M.; Moussa, S.H.; Hackel, M.A.; Miller, A.A. In Vitro activity of sulbactam-durlobactam against Acinetobacter baumannii-calcoaceticus complex isolates collected globally in 2016 and 2017. Antimicrob. Agents Chemother. 2020, 64, e02534-19. [Google Scholar] [CrossRef]
- Yang, Q.; Xu, Y.; Jia, P.; Zhu, Y.; Zhang, J.; Zhang, G.; Deng, J.; Hackel, M.; Bradford, P.A.; Reinhart, H.J. In Vitro activity of sulbactam/durlobactam against clinical isolates of Acinetobacter baumannii collected in China. J. Antimicrob. Chemother. 2020, 75, 1833–1839. [Google Scholar] [CrossRef]
- Nodari, C.S.; Santos, F.F.; Kurihara, M.N.L.; Valiatti, T.B.; Cayô, R.; Gales, A.C. In Vitro activity of sulbactam/durlobactam against extensively drug-resistant Acinetobacter baumannii isolates belonging to South American major clones. J. Glob. Antimicrob. Resist. 2021, 25, 363–366. [Google Scholar] [CrossRef]
- Seifert, H.; Müller, C.; Stefanik, D.; Higgins, P.G.; Miller, A.; Kresken, M. In Vitro activity of sulbactam/durlobactam against global isolates of carbapenem-resistant Acinetobacter baumannii. J. Antimicrob. Chemother. 2020, 75, 2616–2621. [Google Scholar] [CrossRef]
- Penwell, W.F.; Shapiro, A.B.; Giacobbe, R.A.; Gu, R.F.; Gao, N.; Thresher, J.; McLaughlin, R.E.; Huband, M.D.; DeJonge, B.L.; Ehmann, D.E.; et al. Molecular mechanisms of sulbactam antibacterial activity and resistance determinants in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2015, 59, 1680–1689. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shapiro, A.B.; Gao, N.; Jahic, H.; Carter, N.M.; Chen, A.; Miller, A.A. Reversibility of covalent, broad-spectrum serine β-lactamase inhibition by the diazabicyclooctenone ETX2514. ACS Infect. Dis. 2017, 3, 833–844. [Google Scholar] [CrossRef] [PubMed]
- Rodvold, K.A.; Gotfried, M.H.; Isaacs, R.D.; O’Donnell, J.P.; Stone, E. Plasma and intrapulmonary concentrations of ETX2514 and sulbactam following intravenous administration of ETX2514SUL to healthy adult subjects. Antimicrob. Agents Chemother. 2018, 62, e01089-18. [Google Scholar] [CrossRef] [Green Version]
- O’Donnell, J.; Rubino, C.; Onufrak, N.J.; Bhaunani, S.M.; Ambrose, P.G.; Tommasi, R.; Stone, E.; Rodvold, K.; Mueller, J.; Isaacs, R.; et al. Pharmacokinetics/Pharmacodynamics and Phase 3 Dose Projection for the Novel β-Lactamase Inhibitor ETX2514 in Combination with Sulbactam against Acinetobacter baumannii-calcoaceticus Complex (ABC), Poster AAR-LB-14; Microbe: San Francisco, CA, USA, 2019. [Google Scholar]
- Mezzatesta, M.L.; D’Andrea, M.M.; Migliavacca, R.; Giani, T.; Gona, F.; Nucleo, E.; Fugazza, G.; Pagani, L.; Rossolini, G.M.; Stefani, S. Epidemiological characterization and distribution of carbapenem-resistant Acinetobacter baumannii clinical isolates in Italy. Clin. Microbiol. Infect. 2012, 18, 160–166. [Google Scholar] [CrossRef] [Green Version]
- Caio, C.; Maugeri, G.; Zingali, T.; Gona, F.; Stefani, S.; Mezzatesta, M.L. Extensively drug-resistant ArmA-producing Acinetobacter baumannii in an Italian intensive care unit. New Microbiol. 2018, 41, 159–161. [Google Scholar] [PubMed]
- Mezzatesta, M.L.; Caio, C.; Gona, F.; Cormaci, R.; Salerno, I.; Zingali, T.; Denaro, C.; Gennaro, M.; Quattrone, C.; Stefani, S. Carbapenem and multidrug resistance in Gram-negative bacteria in a single centre in Italy: Considerations on In Vitro assay of active drugs. Int. J. Antimicrob. Agents 2014, 44, 112–116. [Google Scholar] [CrossRef]
- Carcione, D.; Siracusa, C.; Sulejmani, A.; Migliavacca, R.; Mercato, A.; Piazza, A.; Principe, L.; Clementi, N.; Mancini, N.; Leoni, V.; et al. In Vitro antimicrobial activity of the siderophore cephalosporin cefiderocol against Acinetobacter baumannii strains recovered from clinical samples. Antibiotics 2021, 10, 1309. [Google Scholar] [CrossRef]
- Migliavacca, R.; Espinal, P.; Principe, L.; Drago, M.; Fugazza, G.; Roca, I.; Nucleo, E.; Bracco, S.; Vila, J.; Pagani, L.; et al. Characterization of resistance mechanisms and genetic relatedness of carbapenem-resistant Acinetobacter baumannii isolated from blood, Italy. Diagn. Microbiol. Infect. Dis. 2013, 75, 180–186. [Google Scholar] [CrossRef]
- Principe, L.; Piazza, A.; Giani, T.; Bracco, S.; Caltagirone, M.S.; Arena, F.; Nucleo, E.; Tammaro, F.; Rossolini, G.M.; Pagani, L.; et al. AMCLI-CRAb Survey Participants. Epidemic diffusion of OXA-23-producing Acinetobacter baumannii isolates in Italy: Results of the first cross-sectional countrywide survey. J. Clin. Microbiol. 2014, 52, 3004–3010. [Google Scholar] [CrossRef] [Green Version]
- Nucleo, E.; Steffanoni, L.; Fugazza, G.; Migliavacca, R.; Giacobone, E.; Navarra, A.; Pagani, L.; Landini, P. Growth in glucose-based medium and exposure to subinhibitory concentrations of imipenem induce biofilm formation in a multidrug-resistant clinical isolate of Acinetobacter baumannii. BMC Microbiol. 2009, 9, 270. [Google Scholar] [CrossRef] [Green Version]
- Cherubini, S.; Perilli, M.; Segatore, B.; Fazii, P.; Parruti, G.; Frattari, A.; Amicosante, G.; Piccirilli, A. Whole-genome sequencing of ST2 A. baumannii causing bloodstream infections in COVID-19 patients. Antibiotics 2022, 11, 955. [Google Scholar] [CrossRef] [PubMed]
- D’Arezzo, S.; Principe, L.; Capone, A.; Petrosillo, N.; Petrucca, A.; Visca, P. Changing carbapenemase gene pattern in an epidemic multidrug-resistant Acinetobacter baumannii lineage causing multiple outbreaks in central Italy. J. Antimicrob. Chemother. 2011, 66, 54–61. [Google Scholar] [CrossRef] [PubMed]
- Higgins, P.G.; Prior, K.; Harmsen, D.; Seifert, H. Development and evaluation of a core genome multilocus typing scheme for whole-genome sequence-based typing of Acinetobacter baumannii. PLoS ONE 2017, 12, e0179228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iacono, M.; Villa, L.; Fortini, D.; Bordoni, R.; Imperi, F.; Bonnal, R.J.; Sicheritz-Ponten, T.; Bellis, G.D.; Visca, P.; Cassone, A.; et al. Whole-genome pyrosequencing of an epidemic multidrug-resistant Acinetobacter baumannii strain belonging to the European clone II group. Antimicrob. Agents Chemother. 2008, 52, 2616–2625. [Google Scholar] [CrossRef] [Green Version]
- Vranić-Ladavac, M.; Bedenić, B.; Minandri, F.; Ištok, M.; Bošnjak, Z.; Frančula-Zaninović, S.; Ladavac, R.; Visca, P. Carbapenem resistance and acquired class D β-lactamases in Acinetobacter baumannii from Croatia 2009–2010. Eur. J. Clin. Microbiol. Infect. Dis. 2014, 33, 471–478. [Google Scholar] [CrossRef] [PubMed]
- Corvec, S.; Poirel, L.; Naas, T.; Drugeon, H.; Nordmann, P. Genetics and expression of the carbapenem-hydrolyzing oxacillinase gene blaOXA-23 in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2007, 51, 1530–1533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Agersø, Y.; Petersen, A. The tetracycline resistance determinant Tet 39 and the sulphonamide resistance gene sulII are common among resistant Acinetobacter spp. isolated from integrated fish farms in Thailand. J. Antimicrob. Chemother. 2007, 59, 23–27. [Google Scholar] [CrossRef]
- Piddock, L.J. Multidrug-resistance efflux pumps-not just for resistance. Nat. Rev. Microbiol. 2006, 4, 629–636. [Google Scholar] [CrossRef]
- Pérez-Varela, M.; Corral, J.; Aranda, J.; Barbé, J. Functional Characterization of AbaQ, a novel efflux pump mediating quinolone resistance in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2018, 62, e00906-18. [Google Scholar] [CrossRef] [Green Version]
- Srinivasan, V.B.; Rajamohan, G.; Gebreyes, W.A. Role of AbeS, a novel efflux pump of the SMR family of transporters, in resistance to antimicrobial agents in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2009, 53, 5312–5316. [Google Scholar] [CrossRef] [Green Version]
- Piperaki, E.T.; Tzouvelekis, L.S.; Miriagou, V.; Daikos, G.L. Carbapenem-resistant Acinetobacter baumannii: In pursuit of an effective treatment. Clin. Microbiol. Infect. 2019, 25, 951–957. [Google Scholar] [CrossRef]
- Bassetti, M.; Echols, R.; Matsunaga, Y.; Ariyasu, M.; Doi, Y.; Ferrer, R.; Lodise, T.P.; Naas, T.; Niki, Y.; Paterson, D.L.; et al. Efficacy and safety of cefiderocol or best available therapy for the treatment of serious infections caused by carbapenem-resistant Gram-negative bacteria (CREDIBLE-CR): A randomised, open-label, multicentre, pathogen-focused, descriptive, phase 3 trial. Lancet Infect. Dis. 2021, 21, 226–240. [Google Scholar] [CrossRef]
- Drwiega, E.N.; Rodvold, K.A. Penetration of antibacterial agents into pulmonary epithelial lining fluid: An update. Clin. Pharmacokinet. 2022, 61, 17–46. [Google Scholar] [CrossRef] [PubMed]
- Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically, 11th ed.; Approved Standard M07-A11; CLSI: Wayne, PA, USA, 2018. [Google Scholar]
- Piccirilli, A.; Cherubini, S.; Azzini, A.M.; Tacconelli, E.; Lo Cascio, G.; Maccacaro, L.; Bazaj, A.; Naso, L.; Amicosante, G.; Ltcf-Veneto Working Group; et al. Whole-genome sequencing (WGS) of carbapenem-resistant K. pneumoniae isolated in Long-Term Care Facilities in the Northern Italian Region. Microorganisms 2021, 9, 1985. [Google Scholar] [CrossRef] [PubMed]
- Cherubini, S.; Perilli, M.; Azzini, A.M.; Tacconelli, E.; Maccacaro, L.; Bazaj, A.; Naso, L.; Amicosante, G.; LTCF-Veneto Working Group; Lo Cascio, G.; et al. Resistome and virulome of multi-drug resistant E. coli ST131 isolated from residents of Long-Term Care Facilities in the Northern Italian Region. Diagnostics 2022, 12, 213. [Google Scholar] [CrossRef] [PubMed]
- Shapiro, A.B.; Moussa, S.H.; McLeod, S.M.; Durand-Réville, T.; Miller, A.A. Durlobactam, a new diazabicyclooctane β-lactamase inhibitor for the treatment of Acinetobacter infections in combination with sulbactam. Front. Microbiol. 2021, 12, 709974. [Google Scholar] [CrossRef]
Table 1.
In vitro activities of sulbactam–durlobactam and comparators against 141 carbapenem-resistant Acinetobacter baumannii collected in Italy.
Table 1.
In vitro activities of sulbactam–durlobactam and comparators against 141 carbapenem-resistant Acinetobacter baumannii collected in Italy.
| Antimicrobial Agent | Number of Isolates at Each MIC (mg/L) | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0.06 | 0.125 | 0,25 | 0.5 | 1 | 2 | 4 | >4 | 8 | 16 | 32 | 64 | 128 | >128 | MIC RANGE | MIC50 | MIC90 | |
| SUL | / | / | / | / | / | 2 | 8 | _ | 27 | 45 | 33 | 8 | 13 | 5 | 0.06–>128 | 16 | 128 |
| DUR | / | / | / | / | / | / | / | _ | 3 | 7 | 44 | 39 | 47 | 1 | 0.06–>128 | 64 | 128 |
| SUL–DUR | / | 4 | 25 | 51 | 30 | 14 | 6 | _ | 4 | 2 | / | / | / | 5 | 0.06/4–>128/4 | 0.5 | 4 |
| CST | / | 7 | 6 | 12 | 20 | 19 | 22 | 55 | _ | _ | _ | _ | _ | _ | 0.06–>4 | 4 | >4 |
/ = the number of isolates equal to zero. _, no values available. In SUL–DUR combination, DUR was at fixed concentration of 4 mg/L.
Table 2.
MIC distribution of sulbactam–durlobactam and comparators against 141 CRAb isolates by location of the clinical microbiology laboratory.
Table 2.
MIC distribution of sulbactam–durlobactam and comparators against 141 CRAb isolates by location of the clinical microbiology laboratory.
| City (No. Isolates) Antimicrobial Agents | Number of Isolates with MIC (mg/L) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0.06 | 0.125 | 0.25 | 0.5 | 1 | 2 | 4 | >4 | 8 | 16 | 32 | 64 | 128 | >128 | |
| Pavia (16) | ||||||||||||||
| SUL | / | / | / | / | / | / | 1 | - | 1 | 5 | 7 | 2 | / | / |
| DUR | / | / | / | / | / | / | / | - | / | / | / | 2 | 13 | 1 |
| SUL–DUR | / | / | / | 6 | 6 | 4 | / | - | / | / | / | / | / | / |
| CST | / | / | 1 | 6 | 9 | / | / | / | - | - | - | - | - | - |
| Gemelli (26) | ||||||||||||||
| SUL | / | / | / | / | / | 1 | 2 | - | 4 | 11 | 7 | 1 | / | / |
| DUR | / | / | / | / | / | / | / | - | / | 2 | 6 | 11 | 7 | / |
| SUL–DUR | / | / | 3 | 16 | 7 | / | / | - | / | / | / | / | / | / |
| CST | / | / | / | / | / | / | 13 | 13 | - | - | - | - | - | - |
| PE/AQ (9) | ||||||||||||||
| SUL | / | / | / | / | / | / | / | - | / | 1 | 6 | 1 | 1 | / |
| DUR | / | / | / | / | / | / | / | - | / | / | 3 | 2 | 4 | / |
| SUL–DUR | / | / | 1 | 2 | 2 | 4 | / | - | / | / | / | / | / | / |
| CST | / | / | / | / | / | / | / | 9 | - | - | - | - | - | - |
| Roma Tre (20) | ||||||||||||||
| SUL | / | / | / | / | / | 1 | 3 | - | 3 | 5 | 7 | 1 | / | / |
| DUR | / | / | / | / | / | / | / | - | / | / | 6 | 6 | 8 | / |
| SUL–DUR | / | / | 3 | 7 | 7 | 1 | 2 | - | / | / | / | / | / | / |
| CST | / | / | / | / | / | 7 | 7 | 6 | - | - | - | - | - | - |
| Catania (70) | ||||||||||||||
| SUL | / | / | / | / | / | / | 2 | - | 19 | 23 | 6 | 3 | 12 | 5 |
| DUR | / | / | / | / | / | / | / | - | 3 | 5 | 29 | 18 | 15 | / |
| SUL–DUR | / | 4 | 18 | 20 | 8 | 5 | 4 | - | 4 | 2 | / | / | / | 5 |
| CST | / | 7 | 5 | 6 | 11 | 12 | 2 | 27 | - | - | - | - | - | - |
Pavia, isolates collected from the Microbiology Laboratory of the University of Pavia. Gemelli, isolates collected from the teaching “Gemelli” Hospital Rome. PE/AQ, isolates collected from Spirito Santo Hospital Pescara and the University of L’Aquila. Roma Tre, isolates collected from the Clinical Microbiology Laboratory of Roma Tre University. Catania, isolates collected from the Clinical Microbiology Laboratory of the University of Catania./= the number of isolates equal to zero. _, no values available. In the SUL–DUR combination, DUR was at a fixed concentration of 4 mg/L.
Table 3.
Characterization of Sulbactam–Durlobactam-resistant A. baumannii.
| Strain | Sequence Type | Ward | Sample | SUL–DUR MIC (mg/L) | SUL MIC (mg/L) | DUR MIC (mg/L) | CST MIC (mg/L) | Resistance Genes | Mobile Genetic Elements | |
|---|---|---|---|---|---|---|---|---|---|---|
| β-Lactamases | Other | |||||||||
| A. baumannii CT20 | 2 | transplant | BAL | 8 | 128 | 128 | 0.125 | blaADC-25 blaOXA-20 blaOXA-58 | aac(6′)-Ib-cr aac(6′)-Ib3 tetA(41) | IS26, ISAba125 |
| A. baumannii CT57 | 2 | ICU | BAL | 8 | 128 | 64 | 64 |
blaADC-25 blaOXA-20 blaOXA-58 | aac(6′)-Ib-cr aac(6′)-Ib3 tetA(41) | Tn6018, IS26, ISAba125 |
| A. baumannii CT58 | 2 | ICU | wound | 8 | 128 | 32 | 32 |
blaADC-25 blaOXA-20 blaOXA-58 | aac(6′-)Ib-cr aac(6′)-Ib3 tetA(41) | Tn6018, IS26, ISAba125 |
| A. baumannii CT68 | 2 | ICU | blood | 8 | 128 | 64 | 0.25 |
blaADC-25 blaOXA-20 blaOXA-58 | aac(6′)-Ib-cr aac(6′)-Ib3 sul1 | IS26, ISAba125 |
| A. baumannii CT24 | 2 | ICU | blood | 16 | 64 | 128 | 0.5 |
blaADC-25 blaOXA-20 blaOXA-58 blaOXA-66 | aac(6′)-Ib-cr aac(6′)-Ib3 qacE sul1 gyrA (S81L) parC(V104I, D105E) | IS26, ISAba125 |
| A. baumannii CT25 | 2 | ICU | catheter | 16 | 128 | 64 | 1 |
blaADC-25 blaOXA-20 blaOXA-58 blaOXA-66 | aac(6′)-Ib-cr aac(6′)-Ib3 sul1 | IS26, ISAba125 |
| A. baumannii CT26 | 2 | surgery | bile | >128 | >128 | 64 | 0.5 |
blaADC-25 blaOXA-20 blaOXA-58 blaOXA-66 | aac(6′)-Ib-cr aac(6′)-Ib3 qacE sul1 gyrA (S81L) parC (V104I, D105E) | IS26, ISAba125 |
| A. baumannii CT29 | 2 | ICU | exudate | >128 | >128 | 128 | 1 |
blaADC-25 blaOXA-20 blaOXA-58 blaOXA-66 | aac(6′)-Ib-cr aac(6′)-Ib3 qacE sul1 gyrA (S81L) parC (V104I, D105E) | IS26, ISAba125 |
| A. baumannii CT30 | 20 | ICU | catheter | >128 | >128 | 32 | 1 |
blaADC-25 blaOXA-20 blaOXA-58 blaOXA-66 | aac(6′)-Ib-cr aac(6′)-Ib3 qacE sul1 gyrA (S81L) parC (V104I, D105E) | IS26, ISAba125 |
| A. baumannii CT31 | 20 | ICU | pus | >128 | >128 | 128 | 0.125 |
blaADC-25 blaOXA-20 blaOXA-58 blaOXA-66 | aac(6′)-Ib-cr aac(6′)-Ib3 qacE sul1 gyrA (S81L) parC(V104I, D105E) | IS26, ISAba125 |
| A. baumannii CT32 | 20 | ICU | BAL | >128 | >128 | 128 | 1 |
blaADC-25 blaOXA-20 blaOXA-58 blaOXA-66 | aac(6′)-Ib-cr aac(6′)-Ib3 qacE sul1 gyrA (S81L) parC (V104I, D105E) | IS26, ISAba125 |
Table 4.
Virulence factors encoded by the eleven A. baumannii isolates resistant to SUL–DUR.
| SUL–DUR-Resistant A. baumannii (Strains No.: CT20, CT24, CT25, CT26, CT29, CT30, CT31, CT32, CT57, CT58, CT68) | |
|---|---|
| Virulence-Associated Genes | Virulence Factors |
| adeA, adeC, adeF, adeG, adeH, adeI, adeK, adeL, adeN, adeJ, adeR | RND efflux pump AdeABC, AdeFGH and AdeIJK |
| abeS | SMR family of transporter efflux pumps |
| abaQ, abaF | MFS transporters |
| plc, plcD | Phospholipase |
| lpsB (only in CT57 and CT58) | Lipopolysaccharide synthesis (mutations are involved in CST resistance) |
| lpxA, lpxB, lpxC, lpxD, lpxL, lpxM (only in CT57 and CT58) | Biosynthesis of lipid A (mutations are involved in CST resistance) |
| barA, barB basA, basB, basC, basD, basF, basG, basH, basI, basJ bauA, bauB, bauC, bauD, bauE, bauF entE hemO | Iron uptake: acinetobactin and heme utilization |
| bap, pgaA, pgaB, pgaC, pgaD, csuA, csuB, csuC, csuD, csuE, bfmR, bfmS | Biofilm formation system and cell–cell adhesion |
| abaI, abaR | Quorum sensing |
| pbpG (or PBP7) and PBP3Q488K and PBP3Y528H | Penicillin-binding protein |
| katA | A secondary catalase/peroxidase |
RND, resistant-nodulation division. SMR, small multidrug resistance. MFS, major facilitator superfamily.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Segatore, B.; Piccirilli, A.; Cherubini, S.; Principe, L.; Alloggia, G.; Mezzatesta, M.L.; Salmeri, M.; Di Bella, S.; Migliavacca, R.; Piazza, A.; et al. In Vitro Activity of Sulbactam–Durlobactam against Carbapenem-Resistant Acinetobacter baumannii Clinical Isolates: A Multicentre Report from Italy. Antibiotics 2022, 11, 1136. https://doi.org/10.3390/antibiotics11081136
AMA Style
Segatore B, Piccirilli A, Cherubini S, Principe L, Alloggia G, Mezzatesta ML, Salmeri M, Di Bella S, Migliavacca R, Piazza A, et al. In Vitro Activity of Sulbactam–Durlobactam against Carbapenem-Resistant Acinetobacter baumannii Clinical Isolates: A Multicentre Report from Italy. Antibiotics. 2022; 11(8):1136. https://doi.org/10.3390/antibiotics11081136
Chicago/Turabian StyleSegatore, Bernardetta, Alessandra Piccirilli, Sabrina Cherubini, Luigi Principe, Giovanni Alloggia, Maria Lina Mezzatesta, Mario Salmeri, Stefano Di Bella, Roberta Migliavacca, Aurora Piazza, and et al. 2022. "In Vitro Activity of Sulbactam–Durlobactam against Carbapenem-Resistant Acinetobacter baumannii Clinical Isolates: A Multicentre Report from Italy" Antibiotics 11, no. 8: 1136. https://doi.org/10.3390/antibiotics11081136
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
